Targeting Glioblastoma-Associated Macrophages for Photodynamic Therapy Using AGuIX®-Design Nanoparticles
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.1.1. THP-1 Cell Polarization Process
2.1.2. U87 Tumor Cell Line
2.2. Macrophages Characterization Pre- and Post-PDT
2.2.1. PDT Protocol
2.2.2. Cell Morphology Analysis
2.2.3. Real-Time Cell Impedance Measurements
2.2.4. Nucleocytoplasmic Ratio
2.2.5. Phenotype Characterization by Gene Markers
2.3. Secretome Analysis Pre- and Post-PDT
2.4. Macrophages Targeting by AGuIX@PS@KDKPPR
2.4.1. Nanoparticles Uptake
2.4.2. NRP-1 Protein Detection
2.4.3. Macrophages Survival Pre- and Post-PDT
2.5. In Vivo Experiments
2.5.1. Immuno-Histochemical Analysis on Tissues and Frozen Sections
2.5.2. PDT-Guided by MRI
2.5.3. MRI Images Acquisition
2.6. Statistical Analysis
3. Results
3.1. In Vivo Recruitment of M2 Macrophages in the Tumor Stroma of GBM
3.2. Successful Polarization of THP-1 in M1/M2 Phenotypes by Morphological Features and Adhesion Capacities
3.2.1. Macrophage Morphology
3.2.2. Macrophage Gene Expression
3.3. Targeting M2 Macrophages with AGuIX@PS@KDKPPR Nanoparticles
3.3.1. Nanoparticle Uptake by Macrophages
3.3.2. NRP-1 Protein Expression Regarding Macrophages Phenotype
3.3.3. Effect of PDT on Macrophages
3.4. Post-PDT Secretome from U87 on Macrophages
3.5. In Vivo Macrophages Infiltration Post-PDT
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.B.; Belanger, K.; Brandes, A.A.; Marosi, C.; Bogdahn, U.; et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bechet, D.; Mordon, S.R.; Guillemin, F.; Barberi-Heyob, M.A. Photodynamic therapy of malignant brain tumours: A complementary approach to conventional therapies. Cancer Treat. Rev. 2014, 40, 229–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toussaint, M.; Pinel, S.; Auger, F.; Durieux, N.; Thomassin, M.; Thomas, E.; Moussaron, A.; Meng, D.; Plénat, F.; Amouroux, M.; et al. Proton MR Spectroscopy and Diffusion MR Imaging Monitoring to Predict Tumor Response to Interstitial Photodynamic Therapy for Glioblastoma. Theranostics 2017, 7, 436–451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, E.; Colombeau, L.; Gries, M.; Peterlini, T.; Mathieu, C.; Thomas, N.; Boura, C.; Frochot, C.; Vanderesse, R.; Lux, F.; et al. Ultrasmall AGuIX theranostic nanoparticles for vascular-targeted interstitial photodynamic therapy of glioblastoma. Int. J. Nanomed. 2017, 12, 7075–7088. [Google Scholar] [CrossRef] [Scilit]
- Gries, M.; Thomas, N.; Daouk, J.; Rocchi, P.; Choulier, L.; Jubréaux, J.; Pierson, J.; Reinhard, A.; Jouan-Hureaux, V.; Chateau, A.; et al. Multiscale Selectivity and in vivo Biodistribution of NRP-1-Targeted Theranostic AGuIX Nanoparticles for PDT of Glioblastoma. Int. J. Nanomed. 2020, 15, 8739–8758. [Google Scholar] [CrossRef] [Scilit]
- Sun, S.; Lei, Y.; Li, Q.; Wu, Y.; Zhang, L.; Mu, P.-P.; Ji, G.-Q.; Tang, C.-X.; Wang, Y.-Q.; Gao, J.; et al. Neuropilin-1 is a glial cell line-derived neurotrophic factor receptor in glioblastoma. Oncotarget 2017, 8, 74019–74035. [Google Scholar] [CrossRef] [Scilit]
- Caponegro, M.D.; Moffitt, R.A.; Tsirka, S.E. Expression of neuropilin-1 is linked to glioma associated microglia and macrophages and correlates with unfavorable prognosis in high grade gliomas. Oncotarget 2018, 9, 35655–35665. [Google Scholar] [CrossRef] [Scilit]
- Korbelik, M. PDT-associated host response and its role in the therapy outcome. Lasers Surg. Med. 2006, 38, 500–508. [Google Scholar] [CrossRef] [Scilit]
- Zhou, F.; Xing, D.; Chen, W.R. Regulation of HSP70 on activating macrophages using PDT-induced apoptotic cells. Int. J. Cancer 2009, 125, 1380–1389. [Google Scholar] [CrossRef] [Scilit]
- Charles, N.A.; Holland, E.C.; Gilbertson, R.; Glass, R.; Kettenmann, H. The brain tumor microenvironment. Glia 2011, 59, 1169–1180. [Google Scholar] [CrossRef] [Scilit]
- da Fonseca, A.C.C.; Badie, B. Microglia and macrophages in malignant gliomas: Recent discoveries and implications for promising therapies. Clin. Dev. Immunol. 2013, 2013, 264124. [Google Scholar] [PubMed]
- Pyonteck, S.M.; Akkari, L.; Schuhmacher, A.J.; Bowman, R.L.; Sevenich, L.; Quail, D.F.; Olson, O.C.; Quick, M.L.; Huse, J.T.; Teijeiro, V.; et al. CSF-1R inhibition alters macrophage polarization and blocks glioma progression. Nat. Med. 2013, 19, 1264–1272. [Google Scholar] [CrossRef] [Scilit]
- Jackson, C.M.; Lim, M.; Drake, C.G. Immunotherapy for brain cancer: Recent progress and future promise. Clin. Cancer Res. 2014, 20, 3651–3659. [Google Scholar] [CrossRef] [Scilit]
- Miyauchi, J.T.; Chen, D.; Choi, M.; Nissen, J.C.; Shroyer, K.R.; Djordevic, S.; Zachary, I.C.; Selwood, D.; Tsirka, S.E. Ablation of Neuropilin 1 from glioma-associated microglia and macrophages slows tumor progression. Oncotarget 2016, 7, 9801–9814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyauchi, J.T.; Caponegro, M.D.; Chen, D.; Choi, M.K.; Li, M.; Tsirka, S.E. Deletion of Neuropilin 1 from Microglia or Bone Marrow–Derived Macrophages Slows Glioma Progression. Cancer Res. 2018, 78, 685–694. [Google Scholar] [CrossRef] [Scilit]
- Song, M.; Liu, T.; Shi, C.; Zhang, X.; Chen, X. Bioconjugated Manganese Dioxide Nanoparticles Enhance Chemotherapy Response by Priming Tumor-Associated Macrophages toward M1-like Phenotype and Attenuating Tumor Hypoxia. ACS Nano 2016, 10, 633–647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Lin, Y.-X.; Qiao, S.-L.; An, H.-W.; Ma, Y.; Qiao, Z.-Y.; Rajapaksha, R.Y.J.; Wang, H. Polymeric nanoparticles promote macrophage reversal from M2 to M1 phenotypes in the tumor microenvironment. Biomaterials 2017, 112, 153–163. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Z.; Scalfi-Happ, C.; Ryabova, A.; Gräfe, S.; Wiehe, A.; Peter, R.-U.; Loschenov, V.; Steiner, R.; Wittig, R. Photodynamic activity of Temoporfin nanoparticles induces a shift to the M1-like phenotype in M2-polarized macrophages. J. Photochem. Photobiol. B Biol. 2018, 185, 215–222. [Google Scholar] [CrossRef] [Scilit]
- Simmons, G.W.; Pong, W.W.; Emnett, R.J.; White, C.R.; Gianino, S.M.; Rodriguez, F.J.; Gutmann, D.H. Neurofibromatosis-1 Heterozygosity increases microglia in a spatially and temporally restricted pattern relevant to mouse optic glioma formation and growth. J. Neuropathol. Exp. Neurol. 2011, 70, 51–62. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.Y.; Watabe, K. The roles of microglia/macrophages in tumor progression of brain cancer and metastatic disease. Front. Biosci. 2017, 22, 1805–1829. [Google Scholar] [CrossRef] [Scilit]
- Wei, J.; Gabrusiewicz, K.; Heimberger, A. The Controversial Role of Microglia in Malignant Gliomas. Clin. Dev. Immunol. 2013, 2013, 285246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jacobs, J.F.M.; Idema, A.J.; Bol, K.F.; Grotenhuis, J.A.; de Vries, I.J.M.; Wesseling, P.; Adema, G.J. Prognostic significance and mechanism of Treg infiltration in human brain tumors. J. Neuroimmunol. 2010, 225, 195–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pansa, M.F.; Lamberti, M.J.; Cogno, I.S.; Correa, S.G.; Vittar, N.B.R.; Rivarola, V.A. Contribution of resident and recruited macrophages to the photodynamic intervention of colorectal tumor microenvironment. Tumor Biol. 2015, 37, 541–552. [Google Scholar] [CrossRef] [Scilit]
- Kennedy, B.C.; Showers, C.R.; Anderson, D.E.; Anderson, L.; Canoll, P.; Bruce, J.N.; Anderson, R.C. Tumor-associated macrophages in glioma: Friend or foe? J. Oncol. 2013, 2013, 486912. [Google Scholar] [CrossRef] [Scilit]
- Leblond, M.M.; Gérault, A.; Corroyer-Dulmont, A.; MacKenzie, E.T.; Petit, E.; Bernaudin, M.; Valable, S. Hypoxia induces macrophage polarization and re-education toward an M2 phenotype in U87 and U251 glioblastoma models. Oncoimmunology 2015, 5, e1056442. [Google Scholar] [CrossRef] [Scilit]
- Chanput, W.; Mes, J.J.; Wichers, H.J. THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 2014, 23, 37–45. [Google Scholar] [CrossRef] [Scilit]
- Genin, M.; Clement, F.; Fattaccioli, A.; Raes, M.; Michiels, C. M1 and M2 macrophages derived from THP-1 cells differentially modulate the response of cancer cells to etoposide. BMC Cancer 2015, 15, 577. [Google Scholar] [CrossRef] [Scilit]
- Rőszer, T. Understanding the Mysterious M2 Macrophage through Activation Markers and Effector Mechanisms. Mediat. Inflamm. 2015, 2015, 816460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, Y.; Xu, X.-H.; Jin, L. Macrophage Polarization in Physiological and Pathological Pregnancy. Front. Immunol. 2019, 10, 792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamerlik, P.; Lathia, J.D.; Rasmussen, R.; Wu, Q.; Bartkova, J.; Lee, M.; Moudry, P.; Bartek, J., Jr.; Fischer, W.; Lukas, J.; et al. Autocrine VEGF–VEGFR2–Neuropilin-1 signaling promotes glioma stem-like cell viability and tumor growth. J. Exp. Med. 2012, 209, 507–520. [Google Scholar] [CrossRef] [Scilit]
- Shapouri-Moghaddam, A.; Mohammadian, S.; Vazini, H.; Taghadosi, M.; Esmaeili, S.A.; Mardani, F.; Seifi, B.; Mohammadi, A.; Afshari, J.T.; Sahebka, A. Macrophage plasticity, polarization, and function in health and disease. J. Cell. Physiol. 2018, 233, 6425–6440. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.X.; Zhang, S.X.; Wu, H.J.; Rong, X.L.; Guo, J. M2b macrophage polarization and its roles in diseases. J. Leukoc. Biol. 2019, 106, 345–358. [Google Scholar] [CrossRef] [Scilit]
- Bertani, F.R.; Mozetic, P.; Fioramonti, M.; Iuliani, M.; Ribelli, G.; Pantano, F.; Santini, D.; Tonini, G.; Trombetta, M.; Businaro, L.; et al. Classification of M1/M2-polarized human macrophages by label-free hyperspectral reflectance confocal microscopy and multivariate analysis. Sci. Rep. 2017, 7, 8965. [Google Scholar] [CrossRef] [Scilit]
- Rostam, H.M.; Reynolds, P.M.; Alexander, M.R.; Gadegaard, N.; Ghaemmaghami, A.M. Image based Machine Learning for identification of macrophage subsets. Sci. Rep. 2017, 7, 3521. [Google Scholar] [CrossRef] [Scilit]
- Nakagawa, M.; Karim, M.R.; Izawa, T.; Kuwamura, M.; Yamate, J. Immunophenotypical Characterization of M1/M2 Macrophages and Lymphocytes in Cisplatin-Induced Rat Progressive Renal Fibrosis. Cells 2021, 10, 257. [Google Scholar] [CrossRef] [Scilit]
- Kang, M.W.C.; Liu, H.; Kah, J.C.Y. Innate immune activation by conditioned medium of cancer cells following combined phototherapy with photosensitizer-loaded gold nanorods. J. Mater. Chem. B 2020, 8, 10812–10824. [Google Scholar] [CrossRef] [Scilit]
- Broekgaarden, M.; Kos, M.; Jurg, F.A.; van Beek, A.A.; van Gulik, T.M.; Heger, M. Inhibition of NF-κB in Tumor Cells Exacerbates Immune Cell Activation Following Photodynamic Therapy. Int. J. Mol. Sci. 2015, 16, 19960–19977. [Google Scholar] [CrossRef] [Scilit]
- Song, S.; Zhou, F.; Chen, W.R.; Xing, D. PDT-induced HSP70 externalization up-regulates NO production via TLR2 signal pathway in macrophages. FEBS Lett. 2012, 587, 128–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawaguchi, K.; Suzuki, E.; Nishie, M.; Kii, I.; Kataoka, T.R.; Hirata, M.; Inoue, M.; Pu, F.; Iwaisako, K.; Tsuda, M.; et al. Downregulation of neuropilin-1 on macrophages modulates antibody-mediated tumoricidal activity. Cancer Immunol. Immunother. 2017, 66, 1131–1142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Shi, Y.; Wu, M.; Liu, J.; Wu, H.; Xu, C.; Chen, L. Hypoxia-induced polypoid giant cancer cells in glioma promote the transformation of tumor-associated macrophages to a tumor-supportive phenotype. CNS Neurosci. Ther. 2022, 28, 1326–1338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Binnemars-Postma, K.A.; Hoopen, H.W.T.; Storm, G.; Prakash, J. Differential uptake of nanoparticles by human M1 and M2 polarized macrophages: Protein corona as a critical determinant. Nanomedicine 2016, 11, 2889–2902. [Google Scholar] [CrossRef] [Scilit]
- Susnik, E.; Taladriz-Blanco, P.; Drasler, B.; Balog, S.; Petri-Fink, A.; Rothen-Rutishauser, B. Increased Uptake of Silica Nanoparticles in Inflamed Macrophages but Not upon Co-Exposure to Micron-Sized Particles. Cells 2020, 9, 2099. [Google Scholar] [CrossRef] [Scilit]
- Kurynina, A.V.; Erokhina, M.V.; Makarevich, O.A.; Sysoeva, V.Y.; Lepekha, L.N.; Kuznetsov, S.A.; Onishchenko, G.E. Plasticity of Human THP-1 Cell Phagocytic Activity during Macrophagic Differentiation. Biochemistry 2018, 83, 200–214. [Google Scholar] [CrossRef] [Scilit]
- Aleid, A.; Alhussaini, K.; Almijalli, M.; Saad, A.S. Estimation of SPIO Nanoparticles Uptakes by Macrophages Using Transmission Electron Microscopy. Int. J. Mol. Sci. 2022, 23, 13801. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Cavalcante, D.P.; Townley, H.E. Macrophage-like THP-1 cells show effective uptake of silica nanoparticles carrying inactivated diphtheria toxoid for vaccination. J. Nanoparticle Res. 2020, 22, 23. [Google Scholar] [CrossRef] [Scilit]
- Ai, X.; Hu, M.; Wang, Z.; Lyu, L.; Zhang, W.; Li, J.; Yang, H.; Lin, J.; Xing, B. Enhanced Cellular Ablation by Attenuating Hypoxia Status and Reprogramming Tumor-Associated Macrophages via NIR Light-Responsive Upconversion Nanocrystals. Bioconjugate Chem. 2018, 29, 928–938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, M.; Shi, Y.; Zhu, L.; Chen, L.; Zhao, X.; Xu, C. Macrophages in Glioblastoma Development and Therapy: A Double-Edged Sword. Life 2022, 12, 1225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Komohara, Y.; Ohnishi, K.; Kuratsu, J.; Takeya, M. Possible involvement of the M2 anti-inflammatory macrophage phenotype in growth of human gliomas. J. Pathol. 2008, 216, 15–24. [Google Scholar] [CrossRef] [Scilit]
- de Boer, P.; Mandija, S.; Werensteijn-Honingh, A.M.; van den Berg, C.A.T.; de Leeuw, A.A.C.; Jürgenliemk-Schulz, I.M. Cervical cancer apparent diffusion coefficient values during external beam radiotherapy. Phys. Imaging Radiat. Oncol. 2019, 9, 77–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.-S.; Zhang, X.-P.; Tang, L.; Ji, J.; Gu, J.; Cai, Y. Locally Advanced Rectal Carcinoma Treated with preoperative chemotherapy and radiation therapy: Preliminary analysis of diffusion-weighted mr imaging for early detection of tumor histopathologic downstaging. Radiology 2010, 254, 170–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cecic, I.; Korbelik, M. Mediators of peripheral blood neutrophilia induced by photodynamic therapy of solid tumors. Cancer Lett. 2002, 183, 43–51. [Google Scholar] [CrossRef] [Scilit]
- Friedberg, J.S. Photodynamic therapy as an innovative treatment for malignant pleural mesothelioma. Semin. Thorac. Cardiovasc. Surg. 2009, 21, 177–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gollnick, S.O.; Evans, S.S.; Baumann, H.; Owczarczak, B.; Maier, P.; Vaughan, L.; Wang, W.C.; Unger, E.; Henderson, B.W. Role of cytokines in photodynamic therapy-induced local and systemic inflammation. Br. J. Cancer 2003, 88, 1772–1779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akimoto, J.; Fukami, S.; Suda, T.; Ichikawa, M.; Haraoka, R.; Kohno, M.; Shishido-Hara, Y.; Nagao, T.; Kuroda, M. First autopsy analysis of the efficacy of intra-operative additional photodynamic therapy for patients with glioblastoma. Brain Tumor Pathol. 2019, 36, 144–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lebdai, S.; Gigoux, M.; Alvim, R.; Somma, A.; Nagar, K.; Azzouzi, A.R.; Cussenot, O.; Merghoub, T.; Wolchok, J.D.; Scherz, A.; et al. Potentiating vascular-targeted photodynamic therapy through CSF-1R modulation of myeloid cells in a preclinical model of prostate cancer. Oncoimmunology 2019, 8, e1581528. [Google Scholar] [CrossRef] [Scilit]
- Vidyarthi, A.; Agnihotri, T.; Khan, N.; Singh, S.; Tewari, M.K.; Radotra, B.D.; Chatterjee, D.; Agrewala, J.N. Predominance of M2 macrophages in gliomas leads to the suppression of local and systemic immunity. Cancer Immunol. Immunother. 2019, 68, 1995–2004. [Google Scholar] [CrossRef] [Scilit]










| Marker | Gene | Forward 5′-3′ | Reverse 3′-5′ | Length (bp) | NM |
|---|---|---|---|---|---|
| M1 | TNFα | CCTCAGCCTCTTCTCCTTCC | GGTTGCTACAACATGGCT | 191 | NM_000594.4 |
| CXCL10 | GAGTCTCAGCACCATGAATCAA | CAGTTCTAGAGAGAGGTACTCCTTG | 95 | NM_001565.4 | |
| CD-80 | CATCTGACGAGGGCACATAC | GGTGTAGGGAAGTCAGCTTTG | 112 | NM_005191.4 | |
| M2 | CCL22 | GCGTGGTGTTGCTAACCTTC | CCACGGTCATCAGAGTAGGC | 115 | NM_002990.5 |
| CD-163 | TCACAATGAAGATGCTGGCG | CCTGCAAACCACATCAGCTT | 169 | NM_004244 | |
| CD-206 | ACCTCACAAGTATCCACACCATC | CTTTCATCACCACACAATCCTC | 213 | NM_002438.4 | |
| Reference | GAPDH | AGTCAGCCGCATCTTCTTTT | CCAATACGACCAAATCCGTTG | 97 | NM_002046.7 |
| C-X-C Motif Chemokines | C-C Chemokines | Interleukins | Growth Factors | Other Cytokines |
|---|---|---|---|---|
| CXCL1; CXCL2; CXCL5; CXCL8; CXCL9; CXCL12 | CCL1; CCL2; CCL5; CCL7; CCL8; CCL15; CCL17; CCL22 | IL-1α; IL-6; IL-1β; IL-7; IL-2; IL-10; IL-3; IL-12; IL-4; IL-14; IL-5; IL-15 | PDGF BB; TGF-β; VEGF; IGF-1; EGF | IFNγ; TNFα; TNFβ; G-CSF; M-CSF; GM-CSF; Angiogenin; Thrombopoietin; Leptin; Oncostatin M; SCF |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lerouge, L.; Gries, M.; Chateau, A.; Daouk, J.; Lux, F.; Rocchi, P.; Cedervall, J.; Olsson, A.-K.; Tillement, O.; Frochot, C.; et al. Targeting Glioblastoma-Associated Macrophages for Photodynamic Therapy Using AGuIX®-Design Nanoparticles. Pharmaceutics 2023, 15, 997. https://doi.org/10.3390/pharmaceutics15030997
Lerouge L, Gries M, Chateau A, Daouk J, Lux F, Rocchi P, Cedervall J, Olsson A-K, Tillement O, Frochot C, et al. Targeting Glioblastoma-Associated Macrophages for Photodynamic Therapy Using AGuIX®-Design Nanoparticles. Pharmaceutics. 2023; 15(3):997. https://doi.org/10.3390/pharmaceutics15030997
Chicago/Turabian StyleLerouge, Lucie, Mickaël Gries, Alicia Chateau, Joël Daouk, François Lux, Paul Rocchi, Jessica Cedervall, Anna-Karin Olsson, Olivier Tillement, Céline Frochot, and et al. 2023. "Targeting Glioblastoma-Associated Macrophages for Photodynamic Therapy Using AGuIX®-Design Nanoparticles" Pharmaceutics 15, no. 3: 997. https://doi.org/10.3390/pharmaceutics15030997
APA StyleLerouge, L., Gries, M., Chateau, A., Daouk, J., Lux, F., Rocchi, P., Cedervall, J., Olsson, A.-K., Tillement, O., Frochot, C., Acherar, S., Thomas, N., & Barberi-Heyob, M. (2023). Targeting Glioblastoma-Associated Macrophages for Photodynamic Therapy Using AGuIX®-Design Nanoparticles. Pharmaceutics, 15(3), 997. https://doi.org/10.3390/pharmaceutics15030997

