Elastin-Derived VGVAPG Fragment Decorated Cell-Penetrating Peptide with Improved Gene Delivery Efficacy
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Peptide/Nucleic Acid Complexes
2.2. Agarose Gel Retardation Analysis
2.3. PAGE Gel Retardation Assay
2.4. Particle Size and Zeta Potential Analysis
2.5. Serum Stability Evaluation
2.6. Cell Culture
2.7. Macrophage Polarization
2.8. Transfection and Endocytosis Mechanism Studies
2.9. Fluorescence Imaging
2.10. Flow Cytometry Analysis
2.11. Confocal Microscope Observation
2.12. Quantitative Real-Time PCR Assay
2.13. Statistical Analysis
3. Results
3.1. Characterization of the RALA-E/pDNA Complexes
3.2. Transfection Efficiency of RALA-E/pDNA in HEK-293T and HeLa Cell Lines
3.3. Endocytosis Mechanism of the RALA-E/pDNA Complexes
3.4. Characterization of the RALA-E/miR-146a Complexes
3.5. Uptake Efficiency of RALA-E/miR-146a in Macrophages
3.6. The Dynamic Uptake Process of RALA-E/miR-146a in Macrophages
3.7. RALA-E/miRNA-146a Can Inhibit the Expression of Targeted Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Song, X.; Liu, C.; Wang, N.; Huang, H.; He, S.; Gong, C.; Wei, Y. Delivery of CRISPR/Cas systems for cancer gene therapy and immunotherapy. Adv. Drug Deliv. Rev. 2021, 168, 158–180. [Google Scholar] [CrossRef] [PubMed]
- Nakagami, H. Development of COVID-19 vaccines utilizing gene therapy technology. Int. Immunol. 2021, 33, 521–527. [Google Scholar] [CrossRef] [PubMed]
- Ylä-Herttuala, S.; Baker, A.H. Cardiovascular Gene Therapy: Past, Present, and Future. Mol. Ther. 2017, 25, 1095–1106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Degors, I.M.S.; Wang, C.; Rehman, Z.U.; Zuhorn, I.S. Carriers Break Barriers in Drug Delivery: Endocytosis and Endosomal Escape of Gene Delivery Vectors. Acc. Chem. Res. 2019, 52, 1750–1760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zu, H.; Gao, D. Non-viral Vectors in Gene Therapy: Recent Development, Challenges, and Prospects. AAPS J. 2021, 23, 78. [Google Scholar] [CrossRef]
- McCarthy, H.O.; McCaffrey, J.; McCrudden, C.M.; Zholobenko, A.; Ali, A.A.; McBride, J.W.; Massey, A.S.; Pentlavalli, S.; Chen, K.H.; Cole, G.; et al. Development and characterization of self-assembling nanoparticles using a bio-inspired amphipathic peptide for gene delivery. J. Control. Release 2014, 189, 141–149. [Google Scholar] [CrossRef]
- Frankel, A.D.; Pabo, C.O. Cellular uptake of the tat protein from human immunodeficiency virus. Cell 1988, 55, 1189–1193. [Google Scholar] [CrossRef]
- Cole, G.; Ali, A.A.; McCrudden, C.M.; McBride, J.W.; McCaffrey, J.; Robson, T.; Kett, V.L.; Dunne, N.J.; Donnelly, R.F.; McCarthy, H.O. DNA vaccination for cervical cancer: Strategic optimisation of RALA mediated gene delivery from a biodegradable microneedle system. Eur. J. Pharm. Biopharm. 2018, 127, 288–297. [Google Scholar] [CrossRef] [Green Version]
- Bennett, R.; Yakkundi, A.; McKeen, H.D.; McClements, L.; McKeogh, T.J.; McCrudden, C.M.; Arthur, K.; Robson, T.; McCarthy, H.O. RALA-mediated delivery of FKBPL nucleic acid therapeutics. Nanomedicine 2015, 10, 2989–3001. [Google Scholar] [CrossRef] [Green Version]
- Yan, L.P.; Castaño, I.M.; Sridharan, R.; Kelly, D.; Lemoine, M.; Cavanagh, B.L.; Dunne, N.J.; McCarthy, H.O.; O’Brien, F.J. Collagen/GAG scaffolds activated by RALA-siMMP-9 complexes with potential for improved diabetic foot ulcer healing. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 114, 111022. [Google Scholar] [CrossRef]
- Meng, Z.; Luan, L.; Kang, Z.; Feng, S.; Meng, Q.; Liu, K. Histidine-enriched multifunctional peptide vectors with enhanced cellular uptake and endosomal escape for gene delivery. J. Mater. Chem. B 2017, 5, 74–84. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Wan, H.H.; Tian, D.M.; Xu, X.J.; Bi, C.L.; Zhan, X.Y.; Huang, B.H.; Xu, Y.S.; Yan, L.P. Development and Characterization of High Efficacy Cell-Penetrating Peptide via Modulation of the Histidine and Arginine Ratio for Gene Therapy. Materials 2021, 14, 4674. [Google Scholar] [CrossRef] [PubMed]
- Raftery, R.M.; Walsh, D.P.; Blokpoel Ferreras, L.; Mencía Castaño, I.; Chen, G.; LeMoine, M.; Osman, G.; Shakesheff, K.M.; Dixon, J.E.; O’Brien, F.J. Highly versatile cell-penetrating peptide loaded scaffold for efficient and localised gene delivery to multiple cell types: From development to application in tissue engineering. Biomaterials 2019, 216, 119277. [Google Scholar] [CrossRef]
- Dixon, J.E.; Osman, G.; Morris, G.E.; Markides, H.; Rotherham, M.; Bayoussef, Z.; El Haj, A.J.; Denning, C.; Shakesheff, K.M. Highly efficient delivery of functional cargoes by the synergistic effect of GAG binding motifs and cell-penetrating peptides. Proc. Natl. Acad. Sci. USA 2016, 113, E291–E299. [Google Scholar] [CrossRef] [Green Version]
- Almine, J.F.; Bax, D.V.; Mithieux, S.M.; Nivison-Smith, L.; Rnjak, J.; Waterhouse, A.; Wise, S.G.; Weiss, A.S. Elastin-based materials. Chem. Soc. Rev. 2010, 39, 3371–3379. [Google Scholar] [CrossRef]
- Scandolera, A.; Odoul, L.; Salesse, S.; Guillot, A.; Blaise, S.; Kawecki, C.; Maurice, P.; El Btaouri, H.; Romier-Crouzet, B.; Martiny, L.; et al. The Elastin Receptor Complex: A Unique Matricellular Receptor with High Anti-tumoral Potential. Front. Pharmacol. 2016, 7, 32. [Google Scholar] [CrossRef] [Green Version]
- Blanchevoye, C.; Floquet, N.; Scandolera, A.; Baud, S.; Maurice, P.; Bocquet, O.; Blaise, S.; Ghoneim, C.; Cantarelli, B.; Delacoux, F.; et al. Interaction between the elastin peptide VGVAPG and human elastin binding protein. J. Biol. Chem. 2013, 288, 1317–1328. [Google Scholar] [CrossRef] [Green Version]
- Szychowski, K.A.; Skóra, B.; Tobiasz, J.; Gmiński, J. Elastin-derived peptide VGVAPG decreases differentiation of mouse embryo fibroblast (3T3-L1) cells into adipocytes. Adipocyte 2020, 9, 234–245. [Google Scholar] [CrossRef]
- Szychowski, K.A.; Gmiński, J. Elastin-derived peptide VGVAPG affects the proliferation of mouse cortical astrocytes with the involvement of aryl hydrocarbon receptor (Ahr), peroxisome proliferator-activated receptor gamma (Pparγ), and elastin-binding protein (EBP). Cytokine 2020, 126, 154930. [Google Scholar] [CrossRef]
- Szychowski, K.A.; Wójtowicz, A.K.; Gmiński, J. Impact of Elastin-Derived Peptide VGVAPG on Matrix Metalloprotease-2 and -9 and the Tissue Inhibitor of Metalloproteinase-1, -2, -3 and -4 mRNA Expression in Mouse Cortical Glial Cells In Vitro. Neurotox. Res. 2019, 35, 100–110. [Google Scholar] [CrossRef] [Green Version]
- Lemaire, F.; Audonnet, S.; Perotin, J.-M.; Gaudry, P.; Dury, S.; Ancel, J.; Lebargy, F.; Antonicelli, F.; Deslée, G.; Le Naour, R. The elastin peptide VGVAPG increases CD4+ T-cell IL-4 production in patients with chronic obstructive pulmonary disease. Respir. Res. 2021, 22, 14. [Google Scholar] [CrossRef]
- Dale, M.A.; Xiong, W.; Carson, J.S.; Suh, M.K.; Karpisek, A.D.; Meisinger, T.M.; Casale, G.P.; Baxter, B.T. Elastin-Derived Peptides Promote Abdominal Aortic Aneurysm Formation by Modulating M1/M2 Macrophage Polarization. J. Immunol. 2016, 196, 4536–4543. [Google Scholar] [CrossRef] [Green Version]
- Robinet, A.; Fahem, A.; Cauchard, J.-H.; Huet, E.; Vincent, L.C.; Lorimier, S.; Antonicelli, F.; Soria, C.; Crepin, M.; Hornebeck, W.; et al. Elastin-derived peptides enhance angiogenesis by promoting endothelial cell migration and tubulogenesis through upregulation of MT1-MMP. J. Cell Sci. 2005, 118, 343–356. [Google Scholar] [CrossRef] [Green Version]
- Clogston, J.D.; Patri, A.K. Zeta Potential Measurement. In Characterization of Nanoparticles Intended for Drug Delivery; McNeil, S.E., Ed.; Humana Press: Totowa, NJ, USA, 2011; pp. 63–70. [Google Scholar]
- Loughran, S.P.; McCrudden, C.M.; McCarthy, H.O. Designer peptide delivery systems for gene therapy. Eur. J. Nanomed. 2015, 7, 85–96. [Google Scholar] [CrossRef] [Green Version]
- Rusciani, A.; Duca, L.; Sartelet, H.; Chatron-Colliet, A.; Bobichon, H.; Ploton, D.; Le Naour, R.; Blaise, S.; Martiny, L.; Debelle, L. Elastin Peptides Signaling Relies on Neuraminidase-1-Dependent Lactosylceramide Generation. PLoS ONE 2010, 5, e14010. [Google Scholar] [CrossRef] [Green Version]
- Tian, D.-M.; Wan, H.-H.; Chen, J.-R.; Ye, Y.-B.; He, Y.; Liu, Y.; Tang, L.-Y.; He, Z.-Y.; Liu, K.-Z.; Gao, C.-J.; et al. In-situ formed elastin-based hydrogels enhance wound healing via promoting innate immune cells recruitment and angiogenesis. Mater. Today Bio 2022, 15, 100300. [Google Scholar] [CrossRef]







| Peptide | Sequence |
|---|---|
| RALA | N-WEARLARALA RALARHLARA LARALRACEA-C |
| RALA-E | N-WEARLARALA RALARHLARA LARALRACEAVGVAPG-C |
| Acrylamide 30% | 10× TBE | ddH2O | TEMED | Ammonium Persulfate 10% |
|---|---|---|---|---|
| 33.33 mL | 5 mL | 11.67 mL | 25 µL | 150 µL |
| Gene | Sequence (Forward) | Sequence (Reverse) |
|---|---|---|
| TRAF 6 | TTGCTCTTATGGATTGTCCCC | TTTGCTCTTATGGATTGTCCCC |
| TNF-α | CCTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
| IL-1β | TTCGACACATGGGATAACGAGG | TTTTTGCTGTGAGTCCCGGAG |
| iNOS | TCATCCGCTATGCTGGCTAC | CCCGAAACCACTCGTATTTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, W.-J.; Tian, D.-M.; Fu, L.; Jin, B.; Liu, Y.; Xu, Y.-S.; Ye, Y.-B.; Wang, X.-B.; Xu, X.-J.; Tang, C.; et al. Elastin-Derived VGVAPG Fragment Decorated Cell-Penetrating Peptide with Improved Gene Delivery Efficacy. Pharmaceutics 2023, 15, 670. https://doi.org/10.3390/pharmaceutics15020670
Shen W-J, Tian D-M, Fu L, Jin B, Liu Y, Xu Y-S, Ye Y-B, Wang X-B, Xu X-J, Tang C, et al. Elastin-Derived VGVAPG Fragment Decorated Cell-Penetrating Peptide with Improved Gene Delivery Efficacy. Pharmaceutics. 2023; 15(2):670. https://doi.org/10.3390/pharmaceutics15020670
Chicago/Turabian StyleShen, Wen-Juan, Duo-Mei Tian, Le Fu, Biao Jin, Yu Liu, Yun-Sheng Xu, Yong-Bin Ye, Xiao-Bo Wang, Xiao-Jun Xu, Chun Tang, and et al. 2023. "Elastin-Derived VGVAPG Fragment Decorated Cell-Penetrating Peptide with Improved Gene Delivery Efficacy" Pharmaceutics 15, no. 2: 670. https://doi.org/10.3390/pharmaceutics15020670
APA StyleShen, W.-J., Tian, D.-M., Fu, L., Jin, B., Liu, Y., Xu, Y.-S., Ye, Y.-B., Wang, X.-B., Xu, X.-J., Tang, C., Li, F.-P., Wang, C.-F., Wu, G., & Yan, L.-P. (2023). Elastin-Derived VGVAPG Fragment Decorated Cell-Penetrating Peptide with Improved Gene Delivery Efficacy. Pharmaceutics, 15(2), 670. https://doi.org/10.3390/pharmaceutics15020670

