RETRACTED: Fluoxetine Ecofriendly Nanoemulsion Enhances Wound Healing in Diabetic Rats: In Vivo Efficacy Assessment
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Animals
2.3. Experimental Design for Selection of Optimized Formula
2.4. Manufacturing Method
2.5. Characterization of FLX-EFNE Formulations’ Globule Size
2.6. Electron Microscope Assessment of Optimized FLX-EFNE Formulation
2.7. Preparation of Tissue Homogenates
2.8. Measurement of Wound Contraction
2.9. Tissue Homogenate Preparation
2.10. Biochemical Estimation
2.11. Quantitative Real-Time PCR (qRT-PCR)
2.12. Histological Analysis
2.13. Immunohistochemical Analysis of TNF-α, VEGF-A, PDGF-B, and TGF-β1
2.14. Statistical Analysis
3. Results
3.1. Selection of an Optimized FLX-EFNE Implementing Box–Behnken Design
3.2. Optimization of FLX-EFNE
3.3. TEM Assessment of Optimized FLX-EFNE Formulation
3.4. Assessment of Wound Healing
3.5. Histopathological Analysis
3.6. Effect of FLX or FLX-EFNE on Expression of TNF-α
3.7. Effect of FLX or FLX-EFNE on Oxidative Status
3.8. Effect of FLX or FLX-EFNE on Markers of Collagen Deposition
3.9. Effect of FLX and FLX-EFNE on Expression of PDGF-B
3.10. Effect of FLX and FLX-EFNE on Expression of TGF-β1 Proteins
3.11. Effect of FLX and FLX-EFNE on Expression of Ang-1
3.12. Effect of FLX and FLX-EFNE on Expression of VEGF-A
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wagner, R.; Heni, M.; Tabák, A.G.; Machann, J.; Schick, F.; Randrianarisoa, E.; de Angelis, M.H.; Birkenfeld, A.L.; Stefan, N.; Peter, A. Pathophysiology-based subphenotyping of individuals at elevated risk for type 2 diabetes. Nat. Med. 2021, 27, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Ramachandran, A. Know the signs and symptoms of diabetes. Indian J. Med. Res. 2014, 140, 579. [Google Scholar]
- Lachin, J.M.; Nathan, D.M. Understanding metabolic memory: The prolonged influence of glycemia during the diabetes control and complications trial (dcct) on future risks of complications during the study of the epidemiology of diabetes interventions and complications (edic). Diabetes Care 2021, 44, 2216–2224. [Google Scholar] [CrossRef] [PubMed]
- Patel, S.; Srivastava, S.; Singh, M.R.; Singh, D. Mechanistic insight into diabetic wounds: Pathogenesis, molecular targets and treatment strategies to pace wound healing. Biomed. Pharmacother. 2019, 112, 108615. [Google Scholar] [CrossRef]
- Wan, R.; Weissman, J.P.; Grundman, K.; Lang, L.; Grybowski, D.J.; Galiano, R.D. Diabetic wound healing: The impact of diabetes on myofibroblast activity and its potential therapeutic treatments. Wound Repair Regen. 2021, 29, 573–581. [Google Scholar] [CrossRef] [PubMed]
- Md, S.; Alhakamy, N.A.; Aldawsari, H.M.; Kotta, S.; Ahmad, J.; Akhter, S.; Shoaib Alam, M.; Khan, M.A.; Awan, Z.; Sivakumar, P.M. Improved analgesic and anti-inflammatory effect of diclofenac sodium by topical nanoemulgel: Formulation development—In vitro and in vivo studies. J. Chem. 2020, 2020, 4071818. [Google Scholar] [CrossRef]
- Iqubal, M.K.; Saleem, S.; Iqubal, A.; Chaudhuri, A.; Pottoo, F.H.; Ali, J.; Baboota, S. Natural, synthetic and their combinatorial nanocarriers based drug delivery system in the treatment paradigm for wound healing via dermal targeting. Curr. Pharm. Des. 2020, 26, 4551–4568. [Google Scholar] [CrossRef]
- Eid, B.G.; Alhakamy, N.A.; Fahmy, U.A.; Ahmed, O.A.; Md, S.; Abdel-Naim, A.B.; Caruso, G.; Caraci, F. Melittin and diclofenac synergistically promote wound healing in a pathway involving tgf-β1. Pharmacol. Res. 2022, 175, 105993. [Google Scholar] [CrossRef]
- Farahani, M.; Shafiee, A. Wound healing: From passive to smart dressings. Adv. Healthc. Mater. 2021, 10, 2100477. [Google Scholar] [CrossRef]
- Rezvanian, M.; Ng, S.-F.; Alavi, T.; Ahmad, W. In-vivo evaluation of alginate-pectin hydrogel film loaded with simvastatin for diabetic wound healing in streptozotocin-induced diabetic rats. Int. J. Biol. Macromol. 2021, 171, 308–319. [Google Scholar] [CrossRef]
- Li, J.; Chou, H.; Li, L.; Li, H.; Cui, Z. Wound healing activity of neferine in experimental diabetic rats through the inhibition of inflammatory cytokines and nrf-2 pathway. Artif. Cells Nanomed. Biotechnol. 2020, 48, 96–106. [Google Scholar] [CrossRef] [PubMed]
- Caruso, G.; Spampinato, S.F.; Cardaci, V.; Caraci, F.; Sortino, M.A.; Merlo, S. Β-amyloid and oxidative stress: Perspectives in drug development. Curr. Pharm. Des. 2019, 25, 4771–4781. [Google Scholar] [CrossRef] [PubMed]
- Di Pietro, V.; Yakoub, K.M.; Caruso, G.; Lazzarino, G.; Signoretti, S.; Barbey, A.K.; Tavazzi, B.; Lazzarino, G.; Belli, A.; Amorini, A.M. Antioxidant therapies in traumatic brain injury. Antioxidants 2020, 9, 260. [Google Scholar] [CrossRef] [PubMed]
- Chhabra, S.; Chhabra, N.; Kaur, A.; Gupta, N. Wound healing concepts in clinical practice of omfs. J. Maxillofac. Oral Surg. 2017, 16, 403–423. [Google Scholar] [CrossRef]
- Caruso, G.; Godos, J.; Privitera, A.; Lanza, G.; Castellano, S.; Chillemi, A.; Bruni, O.; Ferri, R.; Caraci, F.; Grosso, G. Phenolic acids and prevention of cognitive decline: Polyphenols with a neuroprotective role in cognitive disorders and Alzheimer’s disease. Nutrients 2022, 14, 819. [Google Scholar] [CrossRef]
- Pradhan, L.; Nabzdyk, C.; Andersen, N.D.; LoGerfo, F.W.; Veves, A. Inflammation and neuropeptides: The connection in diabetic wound healing. Expert Rev. Mol. Med. 2009, 11, e2. [Google Scholar] [CrossRef]
- Perez-Favila, A.; Martinez-Fierro, M.L.; Rodriguez-Lazalde, J.G.; Cid-Baez, M.A.; Zamudio-Osuna, M.J.; Martinez-Blanco, M.D.R.; Mollinedo-Montaño, F.E.; Rodriguez-Sanchez, I.P.; Castañeda-Miranda, R.; Garza-Veloz, I. Current therapeutic strategies in diabetic foot ulcers. Medicina 2019, 55, 714. [Google Scholar] [CrossRef]
- Alhakamy, N.A.; Caruso, G.; Eid, B.G.; Fahmy, U.A.; Ahmed, O.A.A.; Abdel-Naim, A.B.; Alamoudi, A.J.; Alghamdi, S.A.; Al Sadoun, H.; Eldakhakhny, B.M.; et al. Ceftriaxone and melittin synergistically promote wound healing in diabetic rats. Pharmaceutics 2021, 13, 1622. [Google Scholar] [CrossRef]
- Mirhaj, M.; Labbaf, S.; Tavakoli, M.; Seifalian, A.M. Emerging treatment strategies in wound care. Int. Wound J. 2022. [Google Scholar] [CrossRef]
- Malinin, A.; Oshrine, B.; Serebruany, V. Treatment with selective serotonin reuptake inhibitors for enhancing wound healing. Med. Hypotheses 2004, 63, 103–109. [Google Scholar] [CrossRef]
- García-García, M.L.; Tovilla-Zárate, C.A.; Villar-Soto, M.; Juárez-Rojop, I.E.; González-Castro, T.B.; Genis-Mendoza, A.D.; Ramos-Méndez, M.; López-Nárvaez, M.L.; Saucedo-Osti, A.S.; Ruiz-Quiñones, J.A.; et al. Fluoxetine modulates the pro-inflammatory process of il-6, il-1β and tnf-α levels in individuals with depression: A systematic review and meta-analysis. Psychiatry Res. 2022, 307, 114317. [Google Scholar] [CrossRef] [PubMed]
- Caruso, G.; Grasso, M.; Fidilio, A.; Torrisi, S.A.; Musso, N.; Geraci, F.; Tropea, M.R.; Privitera, A.; Tascedda, F.; Puzzo, D.; et al. Antioxidant activity of fluoxetine and vortioxetine in a non-transgenic animal model of Alzheimer’s disease. Front. Pharmacol. 2021, 12, 809541. [Google Scholar] [CrossRef] [PubMed]
- Farahani, R.M.; Sadr, K.; Rad, J.S.; Mesgari, M. Fluoxetine enhances cutaneous wound healing in chronically stressed wistar rats. Adv. Skin Wound Care 2007, 20, 157–165. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, C.M.; Tartar, D.M.; Bagood, M.D.; So, M.; Nguyen, A.V.; Gallegos, A.; Fregoso, D.; Serrano, J.; Nguyen, D.; Degovics, D.; et al. Topical fluoxetine as a novel therapeutic that improves wound healing in diabetic mice. Diabetes 2019, 68, 1499–1507. [Google Scholar] [CrossRef]
- Jiménez-González, C.; Poechlauer, P.; Broxterman, Q.B.; Yang, B.-S.; Am Ende, D.; Baird, J.; Bertsch, C.; Hannah, R.E.; Dell’Orco, P.; Noorman, H. Key green engineering research areas for sustainable manufacturing: A perspective from pharmaceutical and fine chemicals manufacturers. Org. Process Res. Dev. 2011, 15, 900–911. [Google Scholar] [CrossRef]
- Carbone, C.; Musumeci, T.; Lauro, M.R.; Puglisi, G. Eco-friendly aqueous core surface-modified nanocapsules. Colloids Surf. B Biointerfaces 2015, 125, 190–196. [Google Scholar] [CrossRef]
- Badr-Eldin, S.M.; Labib, G.S.; Aburahma, M.H. Eco-friendly tadalafil surfactant-free dry emulsion tablets (sfdets) stabilized by in situ self-assembled aggregates of natural oil and native cyclodextrins. AAPS Pharm. Sci. Tech. 2019, 20, 255. [Google Scholar] [CrossRef]
- Zakaria, R.; Faraj, J. Evaluation of the wheat germ oil topical formulations for wound healing activity in rats. Pak. J. Biol. Sci. 2021, 24, 706–715. [Google Scholar] [CrossRef]
- Hamdan, S.; Pastar, I.; Drakulich, S.; Dikici, E.; Tomic-Canic, M.; Deo, S.; Daunert, S. Nanotechnology-driven therapeutic interventions in wound healing: Potential uses and applications. ACS Cent. Sci. 2017, 3, 163–175. [Google Scholar] [CrossRef]
- Labib, R.M.; Ayoub, I.M.; Michel, H.E.; Mehanny, M.; Kamil, V.; Hany, M.; Magdy, M.; Moataz, A.; Maged, B.; Mohamed, A. Appraisal on the wound healing potential of Melaleuca alternifolia and Rosmarinus officinalis L. Essential oil-loaded chitosan topical preparations. PLoS ONE 2019, 14, e0219561. [Google Scholar] [CrossRef]
- Ahmed, O.A.; Afouna, M.I.; El-Say, K.M.; Abdel-Naim, A.B.; Khedr, A.; Banjar, Z.M. Optimization of self-nanoemulsifying systems for the enhancement of in vivo hypoglycemic efficacy of glimepiride transdermal patches. Expert Opin. Drug Deliv. 2014, 11, 1005–1013. [Google Scholar] [CrossRef] [PubMed]
- Goyal, S.N.; Reddy, N.M.; Patil, K.R.; Nakhate, K.T.; Ojha, S.; Patil, C.R.; Agrawal, Y.O. Challenges and issues with streptozotocin-induced diabetes—A clinically relevant animal model to understand the diabetes pathogenesis and evaluate therapeutics. Chem. Biol. Interact. 2016, 244, 49–63. [Google Scholar] [CrossRef] [PubMed]
- Eleazu, C.O.; Eleazu, K.C.; Chukwuma, S.; Essien, U.N. Review of the mechanism of cell death resulting from streptozotocin challenge in experimental animals, its practical use and potential risk to humans. J. Diabetes Metab. Disord. 2013, 12, 60. [Google Scholar] [CrossRef] [PubMed]
- Alhakamy, N.A.; Ahmed, O.A.; Fahmy, U.A.; Md, S. Development and in vitro evaluation of 2-methoxyestradiol loaded polymeric micelles for enhancing anticancer activities in prostate cancer. Polymers 2021, 13, 884. [Google Scholar] [CrossRef]
- Alhakamy, N.A.; Ahmed, O.A.; Fahmy, U.A.; Md, S. Apamin-conjugated alendronate sodium nanocomplex for management of pancreatic cancer. Pharmaceuticals 2021, 14, 729. [Google Scholar] [CrossRef]
- Md, S.; Alhakamy, N.A.; Aldawsari, H.M.; Husain, M.; Kotta, S.; Abdullah, S.; Fahmy, U.A.; Alfaleh, M.A.; Asfour, H.Z. Formulation design, statistical optimization, and in vitro evaluation of a naringenin nanoemulsion to enhance apoptotic activity in A549 lung cancer cells. Pharmaceuticals 2020, 13, 152. [Google Scholar] [CrossRef]
- Puglia, C.; Offerta, A.; Rizza, L.; Zingale, G.; Bonina, F.; Ronsisvalle, S. Optimization of curcumin loaded lipid nanoparticles formulated using high shear homogenization (hsh) and ultrasonication (us) methods. J. Nanosci. Nanotechnol. 2013, 13, 6888–6893. [Google Scholar] [CrossRef]
- Iqubal, M.K.; Iqubal, A.; Imtiyaz, K.; Rizvi, M.M.A.; Gupta, M.M.; Ali, J.; Baboota, S. Combinatorial lipid-nanosystem for dermal delivery of 5-fluorouracil and resveratrol against skin cancer: Delineation of improved dermatokinetics and epidermal drug deposition enhancement analysis. Eur. J. Pharm. Biopharm. 2021, 163, 223–239. [Google Scholar] [CrossRef]
- Iqubal, A.; Sharma, S.; Sharma, K.; Bhavsar, A.; Hussain, I.; Iqubal, M.K.; Kumar, R. Intranasally administered pitavastatin ameliorates pentylenetetrazol-induced neuroinflammation, oxidative stress and cognitive dysfunction. Life Sci. 2018, 211, 172–181. [Google Scholar] [CrossRef]
- Iqubal, A.; Syed, M.A.; Haque, M.M.; Najmi, A.K.; Ali, J.; Haque, S.E. Effect of nerolidol on cyclophosphamide-induced bone marrow and hematologic toxicity in swiss albino mice. Exp. Hematol. 2020, 82, 24–32. [Google Scholar] [CrossRef]
- Fresta, C.G.; Fidilio, A.; Caruso, G.; Caraci, F.; Giblin, F.J.; Leggio, G.M.; Salomone, S.; Drago, F.; Bucolo, C. A new human blood-retinal barrier model based on endothelial cells, pericytes, and astrocytes. Int. J. Mol. Sci. 2020, 21, 1636. [Google Scholar] [CrossRef] [PubMed]
- Iqubal, A.; Syed, M.A.; Ali, J.; Najmi, A.K.; Haque, M.M.; Haque, S.E. Nerolidol protects the liver against cyclophosphamide-induced hepatic inflammation, apoptosis, and fibrosis via modulation of nrf2, nf-κb p65, and caspase-3 signaling molecules in swiss albino mice. BioFactors 2020, 46, 963–973. [Google Scholar] [CrossRef] [PubMed]
- Cano Sanchez, M.; Lancel, S.; Boulanger, E.; Neviere, R. Targeting oxidative stress and mitochondrial dysfunction in the treatment of impaired wound healing: A systematic review. Antioxidants 2018, 7, 98. [Google Scholar] [CrossRef] [PubMed]
- Caruso, G.; Fresta, C.G.; Grasso, M.; Santangelo, R.; Lazzarino, G.; Lunte, S.M.; Caraci, F. Inflammation as the common biological link between depression and cardiovascular diseases: Can carnosine exert a protective role? Curr. Med. Chem. 2020, 27, 1782–1800. [Google Scholar] [CrossRef]
- Balaji, S.; Han, N.; Moles, C.; Shaaban, A.F.; Bollyky, P.L.; Crombleholme, T.M.; Keswani, S.G. Angiopoietin-1 improves endothelial progenitor cell-dependent neovascularization in diabetic wounds. Surgery 2015, 158, 846–856. [Google Scholar] [CrossRef]
- Sharp, A.; Clark, J. Diabetes and its effects on wound healing. Nurs. Stand. 2011, 25, 41–47. [Google Scholar] [CrossRef]
- Han, G.; Ceilley, R. Chronic wound healing: A review of current management and treatments. Adv. Ther. 2017, 34, 599–610. [Google Scholar] [CrossRef] [PubMed]
- Rosique, R.G.; Rosique, M.J.; Farina Junior, J.A. Curbing inflammation in skin wound healing: A review. Int. J. Inflam. 2015, 2015, 316235. [Google Scholar] [CrossRef]
- Liang, Y.; Li, M.; Yang, Y.; Qiao, L.; Xu, H.; Guo, B. Ph/glucose dual responsive metformin release hydrogel dressings with adhesion and self-healing via dual-dynamic bonding for athletic diabetic foot wound healing. ACS Nano 2022, 16, 3194–3207. [Google Scholar] [CrossRef]
- Abid, W.K.; Naser, A.I. The efficacy of a new paste formulation as an alternative therapeutic agent for traumatic ulcers. J. Taibah. Univ. Med. Sci. 2021, 16, 724–732. [Google Scholar] [CrossRef]
- Velnar, T.; Bailey, T.; Smrkolj, V. The wound healing process: An overview of the cellular and molecular mechanisms. J. Int. Med. Res. 2009, 37, 1528–1542. [Google Scholar] [CrossRef] [PubMed]
- Vijayakumar, V.; Samal, S.K.; Mohanty, S.; Nayak, S.K. Recent advancements in biopolymer and metal nanoparticle-based materials in diabetic wound healing management. Int. J. Biol. Macromol. 2019, 122, 137–148. [Google Scholar] [CrossRef] [PubMed]
- Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in inflammatory disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef] [PubMed]
- Iqubal, M.K.; Chaudhuri, A.; Iqubal, A.; Saleem, S.; Gupta, M.M.; Ahuja, A.; Ali, J.; Baboota, S. Targeted delivery of natural bioactives and lipid-nanocargos against signaling pathways involved in skin cancer. Curr. Med. Chem. 2021, 28, 8003–8035. [Google Scholar] [CrossRef]
- Caruso, G.; Torrisi, S.A.; Mogavero, M.P.; Currenti, W.; Castellano, S.; Godos, J.; Ferri, R.; Galvano, F.; Leggio, G.M.; Grosso, G.; et al. Polyphenols and neuroprotection: Therapeutic implications for cognitive decline. Pharmacol. Ther. 2021, 232, 108013. [Google Scholar] [CrossRef]
- Bilgen, F.; Ural, A.; Kurutas, E.B.; Bekerecioglu, M. The effect of oxidative stress and raftlin levels on wound healing. Int. Wound J. 2019, 16, 1178–1184. [Google Scholar] [CrossRef]
- Lazzarino, G.; Listorti, I.; Muzii, L.; Amorini, A.M.; Longo, S.; Di Stasio, E.; Caruso, G.; D’Urso, S.; Puglia, I.; Pisani, G.; et al. Low-molecular weight compounds in human seminal plasma as potential biomarkers of male infertility. Hum. Reprod. 2018, 33, 1817–1828. [Google Scholar] [CrossRef]
- Lazzarino, G.; Listorti, I.; Bilotta, G.; Capozzolo, T.; Amorini, A.M.; Longo, S.; Caruso, G.; Lazzarino, G.; Tavazzi, B.; Bilotta, P. Water- and fat-soluble antioxidants in human seminal plasma and serum of fertile males. Antioxidants 2019, 8, 96. [Google Scholar] [CrossRef]
- Abood, W.N.; Al-Henhena, N.A.; Najim Abood, A.; Al-Obaidi, M.M.; Ismail, S.; Abdulla, M.A.; Al Batran, R. Wound-healing potential of the fruit extract of phaleria macrocarpa. Bosn. J. Basic Med. Sci. 2015, 15, 25–30. [Google Scholar] [CrossRef]
- Perihan, O.; Ergul, K.B.; Neslihan, D.; Filiz, A. The activity of adenosine deaminase and oxidative stress biomarkers in scraping samples of acne lesions. J. Cosmet. Dermatol. 2012, 11, 323–328. [Google Scholar] [CrossRef]
- Behr, G.A.; Moreira, J.C.; Frey, B.N. Preclinical and clinical evidence of antioxidant effects of antidepressant agents: Implications for the pathophysiology of major depressive disorder. Oxid Med. Cell. Longev. 2012, 2012, 609421. [Google Scholar] [CrossRef] [PubMed]
- Evans, N.D.; Oreffo, R.O.; Healy, E.; Thurner, P.J.; Man, Y.H. Epithelial mechanobiology, skin wound healing, and the stem cell niche. J. Mech. Behav. Biomed. Mater. 2013, 28, 397–409. [Google Scholar] [CrossRef] [PubMed]
- Sorg, H.; Tilkorn, D.J.; Hager, S.; Hauser, J.; Mirastschijski, U. Skin wound healing: An update on the current knowledge and concepts. Eur. Surg. Res. 2017, 58, 81–94. [Google Scholar] [CrossRef]
- Yao, C.; Markowicz, M.; Pallua, N.; Noah, E.M.; Steffens, G. The effect of cross-linking of collagen matrices on their angiogenic capability. Biomaterials 2008, 29, 66–74. [Google Scholar] [CrossRef] [PubMed]
- Jansen, R.G.; van Kuppevelt, T.H.; Daamen, W.F.; Kuijpers-Jagtman, A.M.; Von den Hoff, J.W. Tissue reactions to collagen scaffolds in the oral mucosa and skin of rats: Environmental and mechanical factors. Arch. Oral Biol. 2008, 53, 376–387. [Google Scholar] [CrossRef] [PubMed]
- Boakye, Y.D.; Agyare, C.; Ayande, G.P.; Titiloye, N.; Asiamah, E.A.; Danquah, K.O. Assessment of wound-healing properties of medicinal plants: The case of Phyllanthus muellerianus. Front. Pharmacol. 2018, 9, 945. [Google Scholar] [CrossRef]
- Eming, S.A.; Krieg, T. Molecular mechanisms of vegf-a action during tissue repair. J. Investig. Dermatol. Symp. Proc. 2006, 11, 79–86. [Google Scholar] [CrossRef]
- El Gazaerly, H.; Elbardisey, D.M.; Eltokhy, H.M.; Teaama, D. Effect of transforming growth factor beta 1 on wound healing in induced diabetic rats. Int. J. Health Sci. 2013, 7, 160–172. [Google Scholar] [CrossRef]
- Beck, L.S.; Deguzman, L.; Lee, W.P.; Xu, Y.; McFatridge, L.A.; Amento, E.P. Tgf-beta 1 accelerates wound healing: Reversal of steroid-impaired healing in rats and rabbits. Growth Factors 1991, 5, 295–304. [Google Scholar] [CrossRef]
- Bao, P.; Kodra, A.; Tomic-Canic, M.; Golinko, M.S.; Ehrlich, H.P.; Brem, H. The role of vascular endothelial growth factor in wound healing. J. Surg. Res. 2009, 153, 347–358. [Google Scholar] [CrossRef]
- Den Dekker, A.; Davis, F.M.; Kunkel, S.L.; Gallagher, K.A. Targeting epigenetic mechanisms in diabetic wound healing. Transl. Res. 2019, 204, 39–50. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Hu, Z.; Yan, F.; Lei, S.; Li, T.; Li, X.; Xu, C.; Sun, B.; Pan, C.; Chen, L. Angelica dahurica promoted angiogenesis and accelerated wound healing in db/db mice via the hif-1α/pdgf-β signaling pathway. Free. Radic. Biol. Med. 2020, 160, 447–457. [Google Scholar] [CrossRef] [PubMed]
- Okonkwo, U.A.; DiPietro, L.A. Diabetes and wound angiogenesis. Int. J. Mol. Sci. 2017, 18, 1419. [Google Scholar] [CrossRef] [PubMed]
- Torrisi, S.A.; Geraci, F.; Tropea, M.R.; Grasso, M.; Caruso, G.; Fidilio, A.; Musso, N.; Sanfilippo, G.; Tascedda, F.; Palmeri, A.; et al. Fluoxetine and vortioxetine reverse depressive-like phenotype and memory deficits induced by aβ(1-42) oligomers in mice: A key role of transforming growth factor-β1. Front. Pharmacol. 2019, 10, 693. [Google Scholar] [CrossRef]
- Caraci, F.; Spampinato, S.F.; Morgese, M.G.; Tascedda, F.; Salluzzo, M.G.; Giambirtone, M.C.; Caruso, G.; Munafò, A.; Torrisi, S.A.; Leggio, G.M.; et al. Neurobiological links between depression and ad: The role of tgf-β1 signaling as a new pharmacological target. Pharmacol. Res. 2018, 130, 374–384. [Google Scholar] [CrossRef]
- Grasso, M.; Caruso, G.; Godos, J.; Bonaccorso, A.; Carbone, C.; Castellano, S.; Currenti, W.; Grosso, G.; Musumeci, T.; Caraci, F. Improving cognition with nutraceuticals targeting tgf-β1 signaling. Antioxidants 2021, 10, 1075. [Google Scholar] [CrossRef]
- Pakyari, M.; Farrokhi, A.; Maharlooei, M.K.; Ghahary, A. Critical role of transforming growth factor beta in different phases of wound healing. Adv. Wound Care 2013, 2, 215–224. [Google Scholar] [CrossRef]
- Mao, X.; Li, Z.; Li, B.; Wang, H. Baicalin regulates mrna expression of vegf-c, ang-1/tie2, tgf-β and smad2/3 to inhibit wound healing in streptozotocin-induced diabetic foot ulcer rats. J. Biochem. Mol. Toxicol. 2021, 35, e22893. [Google Scholar] [CrossRef]
- Caraci, F.; Tascedda, F.; Merlo, S.; Benatti, C.; Spampinato, S.F.; Munafò, A.; Leggio, G.M.; Nicoletti, F.; Brunello, N.; Drago, F.; et al. Fluoxetine prevents aβ(1-42)-induced toxicity via a paracrine signaling mediated by transforming-growth-factor-β1. Front. Pharmacol. 2016, 7, 389. [Google Scholar] [CrossRef]
- Lee, K.M.; Kim, Y.K. The role of il-12 and tgf-beta1 in the pathophysiology of major depressive disorder. Int. Immunopharmacol. 2006, 6, 1298–1304. [Google Scholar] [CrossRef]
Independent Variables | Levels | ||
---|---|---|---|
−1 | +1 | ||
A: WGO (%) | 15 | 25 | |
B: α-CD concentration (%) | 4 | 8 | |
C: Homogenization time (min) | 4 | 12 | |
Dependent Variable (Response) | Desirability Constraints | ||
Globule size (GS, nm) | Minimum |
Run | Oil (%) | α-CD (%) | Homogenization Time (Min) | Size (nm) |
---|---|---|---|---|
1 | 20 | 8 | 12 | 232 |
2 | 15 | 4 | 8 | 265 |
3 | 20 | 4 | 4 | 417 |
4 | 25 | 8 | 8 | 331 |
5 | 15 | 6 | 12 | 199 |
6 | 20 | 4 | 12 | 318 |
7 | 20 | 6 | 8 | 359 |
8 | 15 | 6 | 4 | 309 |
9 | 15 | 8 | 8 | 224 |
10 | 25 | 6 | 12 | 322 |
11 | 25 | 6 | 4 | 428 |
12 | 20 | 8 | 4 | 341 |
13 | 20 | 6 | 8 | 361 |
14 | 20 | 6 | 8 | 365 |
15 | 25 | 4 | 8 | 421 |
Gene | Forward | Reverse | Gene Bank |
---|---|---|---|
Col1A1 | ATCAGCCCAAACCCCAAGGAGA | CGCAGGAAGGTCAGCTGGATAG | NM_053304.1 |
Ang-1 | CCGAGCCTACTCACAGTACGA | ACCACCAACCTCCTGTTAGCAT | NM_053546.2 |
GAPDH | CCATTCTTCCACCTTTGATGCT | TGTTGCTGTAGCCATATTCATTGT | NM_017008.4 |
Group | RE | FP | CD | IC | Phase I | Phase II | Phase III |
---|---|---|---|---|---|---|---|
Untreated control | − | ++ | + | ++ | ++ | ++ | − |
VEH-treated | − | ++ | + | ++ | ++ | ++ | − |
FLX | + | + | + | + | + | +++ | + |
FLX-EFNE | ++ | + | +++ | +/− | + | +++ | ++ |
Positive control | ++ | + | ++ | + | + | ++ | + |
Group | MDA (nmol/mg Protein) | GSH (nmol/mg Protein) | SOD (Unit/mg Protein) | GPx (Unit/mg Protein) |
---|---|---|---|---|
Untreated Control | 7.81 ± 0.84 | 1.99 ± 0.21 | 6.77 ± 0.65 | 42.48 ± 5.10 |
VEH-treated | 7.22 ± 0.63 | 2.24 ± 0.28 | 6.82 ± 0.71 | 48.21 ± 5.3 |
FLX | 5.81 ± 0.60 *# | 4.30 ± 0.44 *# | 8.43 ± 0.78 *# | 68.74 ± 5.95 *# |
FLX-EFNE | 4.35 ± 0.44 *#ϕѲ | 7.33 ± 0.75 *#ϕѲ | 9.22 ± 0.82 *# | 78.62 ± 6.34 *#ϕѲ |
Positive Control | 5.52 ± 0.56 *# | 4.88 ± 0.51 *# | 8.37 ± 0.84 *# | 65.42 ± 5.91 *# |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alhakamy, N.A.; Caruso, G.; Privitera, A.; Ahmed, O.A.A.; Fahmy, U.A.; Md, S.; Mohamed, G.A.; Ibrahim, S.R.M.; Eid, B.G.; Abdel-Naim, A.B.; et al. RETRACTED: Fluoxetine Ecofriendly Nanoemulsion Enhances Wound Healing in Diabetic Rats: In Vivo Efficacy Assessment. Pharmaceutics 2022, 14, 1133. https://doi.org/10.3390/pharmaceutics14061133
Alhakamy NA, Caruso G, Privitera A, Ahmed OAA, Fahmy UA, Md S, Mohamed GA, Ibrahim SRM, Eid BG, Abdel-Naim AB, et al. RETRACTED: Fluoxetine Ecofriendly Nanoemulsion Enhances Wound Healing in Diabetic Rats: In Vivo Efficacy Assessment. Pharmaceutics. 2022; 14(6):1133. https://doi.org/10.3390/pharmaceutics14061133
Chicago/Turabian StyleAlhakamy, Nabil A., Giuseppe Caruso, Anna Privitera, Osama A. A. Ahmed, Usama A. Fahmy, Shadab Md, Gamal A. Mohamed, Sabrin R. M. Ibrahim, Basma G. Eid, Ashraf B. Abdel-Naim, and et al. 2022. "RETRACTED: Fluoxetine Ecofriendly Nanoemulsion Enhances Wound Healing in Diabetic Rats: In Vivo Efficacy Assessment" Pharmaceutics 14, no. 6: 1133. https://doi.org/10.3390/pharmaceutics14061133
APA StyleAlhakamy, N. A., Caruso, G., Privitera, A., Ahmed, O. A. A., Fahmy, U. A., Md, S., Mohamed, G. A., Ibrahim, S. R. M., Eid, B. G., Abdel-Naim, A. B., & Caraci, F. (2022). RETRACTED: Fluoxetine Ecofriendly Nanoemulsion Enhances Wound Healing in Diabetic Rats: In Vivo Efficacy Assessment. Pharmaceutics, 14(6), 1133. https://doi.org/10.3390/pharmaceutics14061133