Infectious Bronchitis Virus Infection Induces Apoptosis during Replication in Chicken Macrophage HD11 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. Virus Titration and Growth Kinetics
2.3. Cell Viability Assay
2.4. Morphological Analysis
2.5. Indirect Immunofluorescence Assay
2.6. Flow Cytometry
2.7. Caspase Activity Assay
2.8. Quantitative Real-Time Polymerase Chain Reaction Analysis
2.9. Statistical Analysis
3. Results
3.1. Viral Infection in HD11 Cells
3.2. IBV Beaudette Induces Apoptosis in HD11 Cells
3.3. IBV Beaudette Triggers Apoptosis by Induction of Caspase Activity
3.4. Regulation of IBV Beaudette-Inducted Apoptosis Is Regulated by the Fas/FasL and Bcl-2 Family Members
3.5. Cell Apoptosis and Viral Replication are Required Mutually
4. Discussion
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Brierley, I.; Boursnell, M.E.; Binns, M.M.; Bilimoria, B.; Blok, V.C.; Brown, T.D.; Inglis, S.C. An efficient ribosomal frame-shifting signal in the polymerase-encoding region of the coronavirus IBV. EMBO J. 1987, 6, 3779–3785. [Google Scholar] [PubMed]
- Cavanagh, D. Coronavirus avian infectious bronchitis virus. Vet. Res. 2007, 38, 281–297. [Google Scholar] [CrossRef] [PubMed]
- Cook, J.K.; Jackwood, M.; Jones, R.C. The long view: 40 Years of infectious bronchitis research. Avian Pathol. J. WVPA 2012, 41, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Hodgson, T.; Casais, R.; Dove, B.; Britton, P.; Cavanagh, D. Recombinant infectious bronchitis coronavirus Beaudette with the spike protein gene of the pathogenic M41 strain remains attenuated but induces protective immunity. J. Virol. 2004, 78, 13804–13811. [Google Scholar] [CrossRef] [PubMed]
- Jordan, B. Vaccination against infectious bronchitis virus: A continuous challenge. Vet. Microbiol. 2017, 206, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Zhou, Y.; Li, J.; Fu, L.; Ji, G.; Zeng, F.; Zhou, L.; Gao, W.; Wang, H. Recombinant infectious bronchitis virus (IBV) H120 vaccine strain expressing the hemagglutinin-neuraminidase (HN) protein of Newcastle disease virus (NDV) protects chickens against IBV and NDV challenge. Arch. Virol. 2016, 161, 1209–1216. [Google Scholar] [CrossRef] [PubMed]
- Kint, J.; Dickhout, A.; Kutter, J.; Maier, H.J.; Britton, P.; Koumans, J.; Pijlman, G.P.; Fros, J.J.; Wiegertjes, G.F.; Forlenza, M. Infectious bronchitis coronavirus inhibits STAT1 signaling and requires accessory proteins for resistance to type i interferon activity. J. Virol. 2015, 89, 12047–12057. [Google Scholar] [CrossRef] [PubMed]
- Fung, T.S.; Liao, Y.; Liu, D.X. The endoplasmic reticulum stress sensor IRE1α protects cells from apoptosis induced by the coronavirus infectious bronchitis virus. J. Virol. 2014, 88, 12752–12764. [Google Scholar] [CrossRef] [PubMed]
- Cottam, E.M.; Maier, H.J.; Manifava, M.; Vaux, L.C.; Chandra-Schoenfelder, P.; Gerner, W.; Britton, P.; Ktistakis, N.T.; Wileman, T. Coronavirus NSP6 proteins generate autophagosomes from the endoplasmic reticulum via an omegasome intermediate. Autophagy 2011, 7, 1335–1347. [Google Scholar] [CrossRef] [PubMed]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [PubMed]
- Thornberry, N.A.; Lazebnik, Y. Caspases: Enemies within. Science 1998, 281, 1312–1316. [Google Scholar] [CrossRef] [PubMed]
- Fulda, S.; Debatin, K.M. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 2006, 25, 4798–4811. [Google Scholar] [CrossRef] [PubMed]
- Clarke, P.; Tyler, K.L. Apoptosis in animal models of virus-induced disease. Nat. Rev. Microbiol. 2009, 7, 144–155. [Google Scholar] [CrossRef] [PubMed]
- Hay, S.; Kannourakis, G. A time to kill: Viral manipulation of the cell death program. J. Gen. Virol. 2002, 83, 1547–1564. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Xu, H.Y.; Liu, D.X. Induction of caspase-dependent apoptosis in cultured cells by the avian coronavirus infectious bronchitis virus. J. Virol. 2001, 75, 6402–6409. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Y.; Liao, Y.; Fang, S.; Tam, J.P.; Liu, D.X. Up-regulation of Mcl-1 and Bak by coronavirus infection of human, avian and animal cells modulates apoptosis and viral replication. PLoS ONE 2012, 7, e30191. [Google Scholar] [CrossRef] [PubMed]
- Ariaans, M.P.; Matthijs, M.G.; van Haarlem, D.; van de Haar, P.; van Eck, J.H.; Hensen, E.J.; Vervelde, L. The role of phagocytic cells in enhanced susceptibility of broilers to colibacillosis after infectious bronchitis virus infection. Vet. Immunol. Immunopathol. 2008, 123, 240–250. [Google Scholar] [CrossRef] [PubMed]
- Reddy, V.R.; Trus, I.; Desmarets, L.M.; Li, Y.; Theuns, S.; Nauwynck, H.J. Productive replication of nephropathogenic infectious bronchitis virus in peripheral blood monocytic cells, a strategy for viral dissemination and kidney infection in chickens. Vet. Res. 2016, 47, 70. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.; Fu, C.; Cong, Z.; Peng, L.; Peng, Z.; Chen, T.; Wang, W.; Jiang, H.; Wei, Q.; Qin, C. Galectin-3 promotes caspase-independent cell death of HIV-1-infected macrophages. FEBS J. 2017, 284, 97–113. [Google Scholar] [CrossRef] [PubMed]
- Nayak, T.K.; Mamidi, P.; Kumar, A.; Singh, L.P.; Sahoo, S.S.; Chattopadhyay, S.; Chattopadhyay, S. Regulation of viral replication, apoptosis and pro-inflammatory responses by 17-AAG during Chikungunya virus infection in macrophages. Viruses 2017, 9. [Google Scholar] [CrossRef] [PubMed]
- Herold, S.; Steinmueller, M.; von Wulffen, W.; Cakarova, L.; Pinto, R.; Pleschka, S.; Mack, M.; Kuziel, W.A.; Corazza, N.; Brunner, T.; et al. Lung epithelial apoptosis in influenza virus pneumonia: The role of macrophage-expressed TNF-related apoptosis-inducing ligand. J. Exp. Med. 2008, 205, 3065–3077. [Google Scholar] [CrossRef] [PubMed]
- Chhabra, R.; Chantrey, J.; Ganapathy, K. Immune responses to virulent and vaccine strains of infectious bronchitis viruses in chickens. Viral Immunol. 2015, 28, 478–488. [Google Scholar] [CrossRef] [PubMed]
- Ciraci, C.; Lamont, S.J. Avian-specific TLRs and downstream effector responses to CpG-induction in chicken macrophages. Dev. Comp. Immunol. 2011, 35, 392–398. [Google Scholar] [CrossRef] [PubMed]
- He, H.; Genovese, K.J.; Kogut, M.H. Modulation of chicken macrophage effector function by T(H)1/T(H)2 cytokines. Cytokine 2011, 53, 363–369. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.Q.; Guo, H.C.; Dong, H.; Wang, H.M.; Xu, J.; Sun, D.H.; Fang, S.G.; Cai, X.P.; Liu, D.X.; Sun, S.Q. Development and characterization of a recombinant infectious bronchitis virus expressing the ectodomain region of S1 gene of H120 strain. Appl. Microbiol. Biotechnol. 2014, 98, 1727–1735. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Yang, X.; Xu, P.; Zhou, L.; Zhang, Z.; Wang, H. Genome sequence and origin analyses of the recombinant novel IBV virulent isolate SAIBK2. Virus Genes 2016, 52, 509–520. [Google Scholar] [CrossRef] [PubMed]
- Tay, F.P.; Huang, M.; Wang, L.; Yamada, Y.; Liu, D.X. Characterization of cellular furin content as a potential factor determining the susceptibility of cultured human and animal cells to coronavirus infectious bronchitis virus infection. Virology 2012, 433, 421–430. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Liao, J.; Li, M.; Wang, X.; Yang, Y.; Ge, J.; Chen, R.; Chen, H. Impaired cardiac microvascular endothelial cells function induced by Coxsackievirus B3 infection and its potential role in cardiac fibrosis. Virus Res. 2012, 169, 188–194. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Wu, B.; Yu, Z.; Fang, J.; Liang, N.; Zhou, M.; Huang, C.; Peng, X. The mitochondrial and endoplasmic reticulum pathways involved in the apoptosis of bursa of Fabricius cells in broilers exposed to dietary aflatoxin B1. Oncotarget 2016, 7, 65295–65306. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Xu, X.; Huang, Y.; Li, Z.; Zhang, K.; Chen, G.; Yu, G.; Wang, Z.; Li, W.; Tong, D. Transmissible gastroenteritis virus infection induces apoptosis through FasL- and mitochondria-mediated pathways. Vet. Microbiol. 2012, 158, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Otsuki, K.; Noro, K.; Yamamoto, H.; Tsubokura, M. Studies on avian infectious bronchitis virus (IBV). II. Propagation of IBV in several cultured cells. Arch. Virol. 1979, 60, 115–122. [Google Scholar] [CrossRef] [PubMed]
- Shen, S.; Law, Y.C.; Liu, D.X. A single amino acid mutation in the spike protein of coronavirus infectious bronchitis virus hampers its maturation and incorporation into virions at the nonpermissive temperature. Virology 2004, 326, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Gurjar, R.S.; Gulley, S.L.; van Ginkel, F.W. Cell-mediated immune responses in the head-associated lymphoid tissues induced to a live attenuated avian coronavirus vaccine. Dev. Comp. Immunol. 2013, 41, 715–722. [Google Scholar] [CrossRef] [PubMed]
- Lan, Y.; Zhao, K.; Wang, G.; Dong, B.; Zhao, J.; Tang, B.; Lu, H.; Gao, W.; Chang, L.; Jin, Z.; et al. Porcine hemagglutinating encephalomyelitis virus induces apoptosis in a porcine kidney cell line via caspase-dependent pathways. Virus Res. 2013, 176, 292–297. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.; Shi, S.Q.; Yang, Y.; Peng, J.P. M and N proteins of SARS coronavirus induce apoptosis in HPF cells. Cell Biol. Toxicol. 2006, 22, 313–322. [Google Scholar] [CrossRef] [PubMed]
- Chhabra, R.; Kuchipudi, S.V.; Chantrey, J.; Ganapathy, K. Pathogenicity and tissue tropism of infectious bronchitis virus is associated with elevated apoptosis and innate immune responses. Virology 2016, 488, 232–241. [Google Scholar] [CrossRef] [PubMed]
- Marsden, V.S.; O’Connor, L.; O’Reilly, L.A.; Silke, J.; Metcalf, D.; Ekert, P.G.; Huang, D.C.; Cecconi, F.; Kuida, K.; Tomaselli, K.J.; et al. Apoptosis initiated by Bcl-2-regulated caspase activation independently of the cytochrome c/Apaf-1/caspase-9 apoptosome. Nature 2002, 419, 634–637. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Zhu, Y.; Ren, Y.; Tong, Y.; Hua, X.; Zhu, F.; Huang, L.; Liu, Y.; Luo, Y.; Lu, W.; et al. Hepatitis C virus protects human B lymphocytes from Fas-mediated apoptosis via E2-CD81 engagement. PLoS ONE 2011, 6, e18933. [Google Scholar] [CrossRef] [PubMed]
- Liao, H.; Xu, J.; Huang, J. FasL/Fas pathway is involved in dengue virus induced apoptosis of the vascular endothelial cells. J. Med. Virol. 2010, 82, 1392–1399. [Google Scholar] [CrossRef] [PubMed]
- Tan, Y.X.; Tan, T.H.; Lee, M.J.; Tham, P.Y.; Gunalan, V.; Druce, J.; Birch, C.; Catton, M.; Fu, N.Y.; Yu, V.C.; et al. Induction of apoptosis by the severe acute respiratory syndrome coronavirus 7a protein is dependent on its interaction with the Bcl-XL protein. J. Virol. 2007, 81, 6346–6355. [Google Scholar] [CrossRef] [PubMed]
- Fu, Q.; He, C.; Mao, Z.R. Epstein-Barr virus interactions with the Bcl-2 protein family and apoptosis in human tumor cells. J. Zhejiang Univ. Sci. B 2013, 14, 8–24. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Zhang, K.; Huang, Y.; Ding, L.; Chen, G.; Zhang, H.; Tong, D. Bovine herpes virus type 1 induces apoptosis through Fas-dependent and mitochondria-controlled manner in Madin-Darby bovine kidney cells. Virol. J. 2012, 9, 202. [Google Scholar] [CrossRef] [PubMed]
- Pearce, A.F.; Lyles, D.S. Vesicular stomatitis virus induces apoptosis primarily through Bak rather than Bax by inactivating Mcl-1 and Bcl-XL. J. Virology 2009, 83, 9102–9112. [Google Scholar] [CrossRef] [PubMed]
- Yates, N.L.; Yammani, R.D.; Alexander-Miller, M.A. Dose-dependent lymphocyte apoptosis following respiratory infection with Vaccinia virus. Virus Res. 2008, 137, 198–205. [Google Scholar] [CrossRef] [PubMed]
- Callus, B.A.; Vaux, D.L. Caspase inhibitors: Viral, cellular and chemical. Cell Death Differ. 2007, 14, 73–78. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Y.; Tan, Y.W.; Liu, D.X. Recent progress in studies of arterivirus-and coronavirus-host interactions. Viruses 2012, 4, 980–1010. [Google Scholar] [CrossRef] [PubMed]
- Costers, S.; Lefebvre, D.J.; Delputte, P.L.; Nauwynck, H.J. Porcine reproductive and respiratory syndrome virus modulates apoptosis during replication in alveolar macrophages. Arch. Virol. 2008, 153, 1453–1465. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
Fas | TCCACCTGCTCCTCGTCATT | GTGCAGTGTGTGTGGGAACT |
FasL | GGCATTCAGTACCGTGACCA | CCGGAAGAGCACATTGGAGT |
Bax | GGTGACAGGGATCGTCACAG | TAGGCCAGGAACAGGGTGAA |
Bcl-2 | TGTTTCTCAAACCAGACACCAA | CAGTAGGCACCTGTGAGATCG |
β-actin | TGCTGTGTTCCCATCTATCG | TTGGTGACAATACCGTGTTCA |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, X.; Tian, Y.; Guan, R.; Gao, W.; Yang, X.; Zhou, L.; Wang, H. Infectious Bronchitis Virus Infection Induces Apoptosis during Replication in Chicken Macrophage HD11 Cells. Viruses 2017, 9, 198. https://doi.org/10.3390/v9080198
Han X, Tian Y, Guan R, Gao W, Yang X, Zhou L, Wang H. Infectious Bronchitis Virus Infection Induces Apoptosis during Replication in Chicken Macrophage HD11 Cells. Viruses. 2017; 9(8):198. https://doi.org/10.3390/v9080198
Chicago/Turabian StyleHan, Xiaoxiao, Yiming Tian, Ru Guan, Wenqian Gao, Xin Yang, Long Zhou, and Hongning Wang. 2017. "Infectious Bronchitis Virus Infection Induces Apoptosis during Replication in Chicken Macrophage HD11 Cells" Viruses 9, no. 8: 198. https://doi.org/10.3390/v9080198
APA StyleHan, X., Tian, Y., Guan, R., Gao, W., Yang, X., Zhou, L., & Wang, H. (2017). Infectious Bronchitis Virus Infection Induces Apoptosis during Replication in Chicken Macrophage HD11 Cells. Viruses, 9(8), 198. https://doi.org/10.3390/v9080198