Next Article in Journal
Cnidium monnieri Polysaccharides Exhibit Inhibitory Effect on Airborne Transmission of Influenza A Virus
Previous Article in Journal
Genomic Organization of the Newly Discovered Cassava Congo Cheravirus Reveals a Unique Maf/HAM1 Motif in the C-Terminal Region of the RNA1 Polyprotein and Suggests the Presence of Two Protein Domains Upstream of the Putative Helicase Domain
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 18
Issue 1
10.3390/v18010085
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity of Norovirus and Sapovirus Outbreaks in Long-Term Care Facilities in Quebec, Canada, 2011–2016

by
Émilie Larocque
1,*,
Yvan L’Homme
1,
Hugues Charest
2,3 and
Christine Martineau
2,†
1
Food Virology National Reference Centre, St. Hyacinthe Laboratory, Canadian Food Inspection Agency, St. Hyacinthe, QC J2S 8E3, Canada
2
Laboratoire de santé publique du Québec (LSPQ), Institut National de Santé Publique du Québec, Montréal, QC H9X 3R5, Canada
3
Department of Microbiology, Infectiology and Immunology, Faculty of Medicine, Montréal University, Montréal, QC H3T 1J4, Canada
*
Author to whom correspondence should be addressed.
†
Current address: Natural Resources Canada, Québec City, QC G1V 4C7, Canada.
Viruses 2026, 18(1), 85; https://doi.org/10.3390/v18010085
Submission received: 28 November 2025 / Revised: 22 December 2025 / Accepted: 5 January 2026 / Published: 8 January 2026
(This article belongs to the Section Human Virology and Viral Diseases)
Browse Figures
Versions Notes

Abstract

Norovirus (NoV) and sapovirus (SaV) are major viral pathogens causing acute gastroenteritis (AGE) in both children and adults in developed countries and are also responsible for large-scale outbreaks. However, in Quebec, Canada, there are limited and updated data with respect to the genotypes circulating and implicated in outbreaks, particularly for SaV. This study aimed to investigate the genetic diversity and genotype predominance of NoVs and SaVs associated with AGE outbreaks in Quebec, Canada. Confirmed NoV and SaV outbreaks from long-term care facilities and hospital settings between September 2011 and April 2016 were investigated (n = 252). NoVs and SaVs were genetically diverse: 21 RdRp-capsid combinations were identified, of which 10 are recombinants. NoV GII.4 New Orleans[P4 NewOrleans] was the predominant genotype from 2011 to 2013, and GII.4 Sydney[P31] was the predominant genotype from 2013 to 2015. In 2015–2016, no single genotype predominated; instead, GII.17[P17], GII.4 Sydney[P16], GII.4 Sydney[P31], and SaV GI.2 strains were co-circulating at similar frequencies. Notably, emerging global genotypes including GII.17[P17], GII.4 Sydney[P16], GII.2[P16], and GII.4 San Francisco[P31] were detected for the first time in Quebec. These findings may contribute to an enhanced understanding of NoV and SaV infection and spread, and to the development of candidate vaccines.

1. Introduction

Noroviruses (NoVs) and Sapoviruses (SaVs) are important etiological agents of acute gastroenteritis (AGE) which spread by contact with infected individuals, contaminated food, or fomites. It is estimated that 684 million people become sick every year from NoV infections: it is the most common cause of AGE across all age groups in both outbreaks and sporadic cases around the world [1]. The elderly are particularly vulnerable to NoV infection as it is associated with increased hospitalization and mortality rates [2,3]. SaV infections are less common than those attributed to NoVs and are most often associated with AGE in young children and adults >65 years of age [4,5]. There is currently no licenced vaccine available for the prevention of NoV or SaV infection or illness, but several candidates are in clinical and preclinical development [6].
NoVs and SaVs are non-enveloped viruses belonging to the family Caliciviridae. Both viruses possess a positive-sense RNA genome of approximately 7.5 kb in length, of which the 5′ end is covalently linked to a viral protein, VPg, and the 3′ end is polyadenylated. Nevertheless, their genomic organization differs slightly. The NoV genome consists of three overlapping open reading frames (ORFs) with ORF-1 encoding six non-structural proteins including the RNA-dependent RNA polymerase ([RdRp]), NS7 region). ORF-2 encodes the major capsid protein, VP1, and ORF-3 encodes the minor capsid protein, VP2. Conversely, the SaV genome usually consists of two ORFs. The polyprotein gene from ORF1 contains the coding regions for non-structural proteins such as RdRp and the VP1 capsid. ORF2 is thought to encode the minor structural protein, VP2 [7].
Complete VP1 amino acid sequences and RdRp nucleotide sequences are used for classification of noroviruses, based on a 2× standard deviation (sd) criteria, into genogroups as well as P (polymerase)-groups and further into genotypes and P-types [8,9]. Of the 10 currently recognized genogroups (GI-GX), GI, GII, GIV, GVIII, and GIX infect humans, encompassing over 30 genotypes [9]. The majority of NoV gastroenteric illness outbreaks over the last two decades have been attributed to GII.4 strains, including GII.4 DenHaag[P4 DenHaag], GII.4 New Orleans[P4 New Orleans], GII.4 Sydney[P31] (previously Pe), and GII.4 Sydney[P16] [10,11,12]. In contrast, the proportion of outbreaks associated with non-GII.4 genotypes has increased in recent years [13,14]: a wave of GII.17 norovirus outbreaks and sporadic infections of acute gastroenteritis was reported in many European countries and the United States during the 2023/24 season [15,16].
Reminiscent of NoVs, SaVs are also highly diverse [17] and classified into 19 genogroups (GI–GXX) based on complete VP1 nucleotide sequences [18,19]. Human SaVs are limited to GI, GII, GIV, and GV, each of which are further subdivided into 18 genotypes [20,21]. SaV-GI and -GII are the most two common human genogroups in low- and middle-income countries [22,23]. RdRp-VP1 recombinants have been identified, albeit less frequently than in NoVs [24]. A dual-typing system for SaVs has also been proposed but is not yet a standard practice [21,23].
Currently, genomic data on NoV and SaV genotypes circulating in Canada are sparse and focused on the western part of the country [4,25,26]. Molecular surveillance of circulating strains is crucial to understanding transmission patterns, burden of infections, population immunity, as well as the development of candidate vaccines and antivirals. Herein, we report the prevalence, genetic diversity, emerging strains, and recombination of NoV and SaV in AGE outbreaks in long-term care facilities and hospital settings in Quebec, Canada, between 2011 and 2016.

2. Materials and Methods

2.1. Stool Specimens

An investigation is launched by the Laboratoire de santé publique du Québec when an institution reports ≥2 cases of AGE to public health officials. When a viral agent is suspected, total RNA is extracted from 200 µL of 20% stool suspension using the NucliSENS EasyMAG™ (Biomérieux, Ville Saint-Laurent, QC, Canada) following the manufacturer’s recommendations and tested for NoV GI, NoV GII and SaV by real-time RT-PCR assays according to previously published methods [27,28]. RNA extracts from NoV GI-, NoV GII- or Sav-positive samples are kept at the Laboratoire de santé publique du Québec at −80 °C until further analysis. Samples representative of 252 documented NoV GI-, NoV GII-, or Sav-positive AGE outbreaks that occurred in the province of Quebec in long-term care facilities and hospital settings from 2011 to 2016 were selected for genetic analyses. Yearly data was analyzed from September 1 to August 31. Sample collection in 2016 ended in May.

2.2. Dual Typing RT-PCR

Genotyping was conducted by the Canadian Food Inspection Agency. One positive RNA extract was selected by random draw among positive samples and subjected to genotyping unless multiple viral agents were detected by RT-qPCR. In such instances, all available samples from the outbreak (ranging from 2 to 7) were subjected to genotyping (Table A1). If the same genotype was identified in multiple samples within a single outbreak, it was reported only once for that outbreak. The samples were amplified by two-step RT-PCR using one of three sets of primers (Table 1) targeting the RdRp region of ORF1, and the complete VP1 region of ORF2. Primers were selected, modified, or newly designed based on in silico binding analyses using the reference sequences provided in Supplementary Material Table S1. Two microliters of RNA was reverse transcribed into cDNA using an oligo(dT)20 primer and SuperScript™ IV reverse transcriptase (Thermo Fisher Scientific, Asheville, NC, USA) in a 20 µL reaction volume according to the manufacturer’s instructions. After treatment with 5 U of RNase H (Thermo Fisher Scientific, Asheville, NC, USA) for 20 min at 37 °C, amplification by PCR was performed using Platinum™ Taq DNA polymerase (Thermo Fisher Scientific, Asheville, NC, USA). Reactions were carried out in a final 50 µL volume containing 1× Platinum™ Taq Buffer, 0.2 µM of forward and reverse primers (listed in Table 1), and 4 µL of cDNA. PCR cycling parameters for NoV GI and NoV GII involved an initial denaturation step of 2 min at 94 °C, and 40 cycles of 30 s at 94 °C, 55 s at 50 or 49 °C, 2 min 30 s at 72 °C, and a final extension of 10 min at 72 °C, respectively. PCR cycling parameters for SaV involved an initial denaturation step of 3 min at 94 °C, and 40 cycles of 30 s at 94 °C, 30 s at 54 °C, 3 min at 72 °C, and a final extension of 10 min at 72 °C. PCR products were analyzed by gel electrophoresis on a 1% agarose gel (Thermo Fisher Scientific, Asheville, NC, USA). Positive PCR reactions were purified using a QIAquick PCR purification kit (QIAGEN, Toronto, ON, Canada) according to instructions. The expected amplicon sizes were ~2.4 kb for NoV GI and NoV GII, and ~2.5 kb for SaV.

2.3. Sequencing

The purified PCR products were subjected to sequencing on the Illumina MiSeq instrument (Illumina, Victoria, BC, Canada). Libraries were prepared using the Nextera XT Library Preparation Kit (Illumina, Victoria, BC, Canada) according to the manufacturer’s instructions. Paired-end dual-indexed sequencing runs of 2 × 75 cycles were conducted on pooled libraries with 1% PhiX (Illumina Victoria, BC, Canada). Raw sequence reads were processed in CLC Genomics Workbench v10.0.1 (QIAGEN, Toronto, ON, Canada). First, leftover adapter sequences were removed from reads and trimmed at a quality limit of 0.001 (Q > 30) and subsequently for ambiguity. Reads were sampled (35,000 reads/sample) to obtain an overall coverage of 1000×. The resulting paired-reads were assembled de novo using an automatic bubble (50) and word (20) sizes and a minimum contig length of 200 nt after scaffolding. Contigs with an overall depth threshold of <100× were excluded from the analysis to ensure certainty of results. Consensus sequences were extracted from contigs: regions of low coverage (≤9×) were removed, and ambiguity codes were inserted to resolve conflicts above the noise threshold (0.1). Internal primer sequences listed in Table 1 were also removed. Consensus sequences obtained from outbreak samples were deposited in GenBank under the accession numbers PX720646-PX720657, PX732916-PX733095, and PX737900-PX737926.

2.4. Genotyping

Norovirus genotypes were determined by dual-typing the polymerase region (P-type) and the capsid (genotype) using the automated online norovirus genotyping tool accessed on 15–16 December 2021 (http://www.rivm.nl/mpf/norovirus/typingtool) [31]. Sapovirus sequences were genotyped based on a 420 nt typing region encoding VP1 using the Human Calicivirus Typing (HuCaT) tool accessed on 17 December 2021 (https://calicivirustypingtool.cdc.gov/) [32].

2.5. Recombination

A strain was defined as a recombinant when the ORF-1 and ORF-2 nucleotide sequences clustered into separate phylogenetic groups. Recombinant sequences were then aligned with closely related GenBank reference sequences with MUSCLE using MEGA [33]. Recombination breakpoints in the parental sequences were identified with the software Recombination Detection Program v4.96 (RDP4) [34] using default settings including primary screening using the RDP, GENECONV, MaxChi, Chimera, and 3Seq methods, and secondary screening using the BootScan and SiScan methods. A general recombination detection p-value threshold was set to 0.05.

2.6. Phylogenetic Analysis

Phylogenetic trees of the RdRp and VP1 regions were built separately using the sequences from this study, and reference sequences obtained from the GenBank database. First, sequence alignments were constructed using MUSCLE (MUltiple Sequence Comparison by Log-Expectation) as a plug-in in CLC Genomics Workbench. All aligned sequences were trimmed for the partial RdRp and complete VP1. Phylogenetic analyses were conducted using the neighbour-joining (NJ) method implemented in CLC Genomics Workbench with the most appropriate nucleotide substitution model based on the Model Testing tool. Bootstrapping values at the nodes were obtained by performing 1000 replicate analyses. The percent identity among nucleotide sequences was compared using CLC Genomics Workbench.

3. Results

From September 2011 to May 2016, real-time RT-PCR results showed that most of the 252 documented viral AGE outbreaks were caused by NoV GII (202/252 or 80.2%), followed by SaV (24/252 or 9.5%), and NoV GI (15/252 or 6.0%), while some were mixed NoV GII/SaV (7/252 or 2.8%) or NoV GI/GII (4/252 or 1.6%). Mixed outbreaks were only detected in 2014–2015 and 2015–2016.
The genotypes based on dual typing of the partial RdRp and complete VP1 gene regions are shown in Figure 1 and Table 2. A total of 218 positive outbreak samples were genotyped successfully. Most outbreak samples that could not be genotyped failed due to amplification failure. Additionally, four NoV GII outbreak samples were excluded because of technical errors and one NoV GI outbreak sample was not genotyped due to insufficient coverage based on exclusion criteria. The predominant genotype overall was NoV GII.4 New Orleans[P4NewOrleans] followed by GII.4 Sydney[P31], accounting for 31.2% (68/218) and 38.0% (61/218) of genotyped sequences, respectively.
In addition to the prevalent genotypes, diverse genotypes were identified throughout the study period, including the detection of 6 NoV GI, 12 NoV GII, and 3 SaVs. Temporal trends were also observed. From 2011 to 2013, NoV GII.4 New Orleans[P4NewOrleans] was the single predominant genotype, followed by GII.4 Sydney[P31]. Its prevalence suddenly dropped during 2013–2014. Meanwhile, GII.4 Sydney[P31], first detected in 2011–2012, increased in prevalence and became the predominant genotype from 2013 to 2015 followed by SaV-GI.2 in 2014–2015. In 2015–2016, no single predominant genotype was observed, but four genotypes were circulating at similar frequencies: GII.17[P17], GII.4 Sydney[P16], GII.4 Sydney[P31]. and SaV-GI.2. Notably, other genotypes detected during the study period included GII.4 Den Haag 2006b, which caused outbreaks from 2011 to 2013 (n = 4) before disappearing the following year, and GII.4 Sydney[P4NewOrleans], which was consistently detected throughout the study period (n = 18). GII.6[P7] was detected in 2011–2012 and then again in 2014–2015 and 2015–2016 (n = 6), while GI.6[P11] emerged during 2014–2015 (n = 7). Additionally, SaV-GIV.1 was steadily detected during the study period but disappeared in 2015–2016 (n = 8). NoV GI.2[P2], GI.3[P3], GI.5[P5], GI.9[P9], GII.1[P33], GII.8[P8], GII.13[P16], and SaV-GI.1 were also detected, albeit at frequencies below 1%, with distribution levels varying according to the year. From 2011 to 2013, little NoV diversity was observed, with 3–5 genotypes in circulation and increasing to 8–9 genotypes in circulation from 2013 to 2014 onward.
Dual typing of the RdRp and VP1 gene regions using the web-based norovirus typing tool revealed that 55.5% (106/191) of NoV sequences represented recombinant genotypes. This includes genotypes GI.3[P10], GI.6[P11], GII.1[P33], GII.2[P16], GII.4 Sydney[P4NewOrleans], GII.4 Sydney[P16], GII.4 Sydney[P31], GII.4 San Francisco[P31], GII.6[P7], and GII.13[P16]. Recombination events were confirmed using the RDP4 program and were found at or near the ORF1/ORF2 junction when compared to parental strains (Table A2). Breakpoints could not be found in two GII.6[P7] sequences (GE-61027, GE-61417). Due to the unavailability of nonrecombinant parental sequences for GI.3[P10], GI.6[P11] and GII.4 San Francisco [P31] in the database, further investigation of recombination events was not possible.
Notably, four emerging global NoV strains were detected during the last annual period of the study: GII.17[P17], GII.4 Sydney[P16], GII.2[P16], and GII.4 San Francisco[P31]. Phylogenetic trees were constructed with the RdRP and VP1 gene regions of epidemiological relevant GII.4 San Francisco [P31] and GII.17[P17] strains from our study with those previously reported worldwide to determine their relationship. The sole GII.4 San Francisco[P31] NoV (GE-67676/2016) was clustered in both gene regions, with the novel GII.4 San Francisco[P31] strain detected in Indonesia, the United Kingdom, and the United States (Figure 2). The VP1 shared 98.95% nt identity with the GII.4 San Francisco[P31] reference strain isolated from the USA in 2017 (OR262322).
The 8 GII.17[P17] NoV from this study (GE-67220, GE-67248, GE-67348, GE-67381, GE-67396, GE-68001, GE-68095, GE-68189) showed a mean nucleotide identity of 99.54% (99.3–99.9%). Phylogenetic analysis of the partial RdRp and full-length VP1 nucleotide sequences indicated that all the reported NoV with GII.17[P17] sequences were clustered with the Kawasaki 308 cluster (>99% nt identity with LC037415 reference strain) (Figure 3).
A total of 27 sapoviruses were identified in this study: 1 SaV-GI.1, 18 SaV-GI.2 and 8 SaV-GIV.1. Comparisons of the 2.5 kb-long nucleotide sequences showed that the 18 SaV-GI.2 sapoviruses shared 97.9% nucleotide identity (96.5–100%). As depicted in Figure 4, the phylogenetic trees inferred from partial RdRp and full-length VP1 sequences showed that all the present SaV sequences separated into clusters with the expected genotype in both gene regions identified by the online automatic typing tool (Figure 4a,b). The 18 SaV-GI.2 sequences formed one big cluster with SaV-GI.2 reference strains from multiple countries, including the United States, Hungary, Germany, Japan, and Brazil. The single SaV-GI.1 sequence from this study was clustered with two SaV-GI.1 reference strains from the United States. The SaV-GIV.1 sequences from this study shared 99.15% (98.02–99.96%) nucleotide identity and formed a distinct cluster with strains from the United States and Peru in the VP1 gene.

4. Discussion

NoV and SaV are a common cause of AGE in children and adults in developed countries. They are also responsible for major outbreaks of gastroenteritis in closed settings, especially in facilities caring for the elderly [4]. In Quebec, Canada, outbreaks of infectious viral AGE are investigated by the Laboratoire de santé publique du Québec, but detailed information on genotypes circulating in the province is lacking. This study fills this knowledge gap by providing information of both polymerase and capsid genes for NoVs and SaVs circulating in Quebec, Canada, from 2011 to 2016, through a five-year continuous surveillance of AGE outbreaks in long-term care facilities and hospital settings.
The findings from this study revealed significant shifts in the distribution of circulating NoV and SaV genotypes during outbreaks. The replacement of NoV GII.4 New Orleans[P4 NewOrleans] as the dominant genotype by GII.4 Sydney[P31] reflects the previously described temporal trends of GII.4 noroviruses, although this shift occurred in 2013–2014, happening two seasons later than the one observed in the United States [16]. Another notable shift occurred in 2015–2016 and is characterized by the absence of a single predominant genotype. The reason for the lack of a sole predominant strain is unclear, but it is tempting to speculate that it has led to the takeover by the GII.4 Sydney[P16] genotype in subsequent years. This novel recombinant emerged in late 2014 and was described around the world, including Canada (Province of Alberta), the United States, Germany, Italy, Japan, and South Korea [12,35,36,37,38,39]. By 2016, GII.4 Sydney[P16] became the predominant genotype in many western countries [12,35,38,40,41,42].
High genotypic diversity of NoV strains has previously been reported in outbreaks settings which occurred in long-term care facilities in Canada and other countries [43,44,45]. Here, the number of annual genotypes in circulation doubled in the last three years of this study. Moreover, the majority of NoVs detected were recombinant strains which is in agreement with other studies showing that most AGE outbreaks in recent years are attributed to recombinant NoV strains, with recombination occurring between ORF1 and ORF2 [46,47]. However, dual typing was not frequently performed prior to 2010, making this comparison challenging. All recombinants detected had been reported previously from patients with acute gastroenteritis [35,46,48,49,50,51].
A novel GII.4, GII.4 San Francisco, has been identified recently in the United States, Gabon, South Africa, the United Kingdom, and Indonesia, covering the period from 2017 to 2020 [51]. Here, we detected GII.4 San Francisco in February 2016 circulating as a recombinant strain with a P31-type RdRp. To our knowledge, this is the first report of GII.4 San Francisco in Canada and it further supports its global distribution. This novel GII.4 capsid shows mutations on major antigenic sites and a single amino acid insertion next to the antigenic site A [51]. It presents distinct antigenic profiles, and in terms of HBGA binding profiles, bound to porcine gastric mucin III and human saliva [52]. Since 2017, a total of three novel GII.4 clusters emerged based on amino acids changes in VP1: GII.4 San Francisco[P31], GII.4 Allegany[P31], and GII.4 Wichita[P4] [16]. Continued molecular surveillance of GII.4 is required to assess the burden and spread of these most recent variants.
In 2014–2015, a novel GII.17 norovirus variant, Kawasaki 308 (GII.17[P17]), emerged in Asia and spread globally [37,53,54,55]. It even completely replaced GII.4 Sydney 2012 in several countries in Asia in 2014 [53]. This variant is considered an immune-escape variant with a faster mutation rate than GII.4 [56]. Here, GII.17 Kawasaki 308 was first detected in Quebec in early winter 2016, causing a total of eight outbreaks in long-term care facilities that year. Thus, since its emergence, the GII.17[P17] Kawasaki 308 has caused a number of outbreaks across Canada [35,57]. During 2023–2024, an increase in GII.17 cases and outbreaks was reported in many countries, including the United States [15]. During the 2024–2025 season, 75% of the outbreaks uploaded to CaliciNet were GII.17 replacing, for the first time, GII.4 (including GII.4 Sydney, GII.4 San Francisco, and GII.4 Wichita grouped together) as the predominant norovirus outbreak strain in the United States [16]. However, phylogenetic analysis revealed most of the GII.17 from 2023 to 2024 clustered closely with the GII.17 Romania-2021 variant in both VP1 and RdRp regions [58]. Continued monitoring of GII.17 in Quebec, Canada, is essential to track the local spread and evolution of GII.17.
As for SaV, the findings from this study indicate that SaV-GI.2 was the dominant SaV genotype. Previous studies have also identified SaV-GI.2 as the most prevalent genotype in sporadic and outbreak-related SaV gastroenteritis [59,60,61,62,63,64]. There were also reports of the SaV-GI.2 genotype causing infection in the United States [45], China [65], Taiwan [66], Japan [67], and Germany [68]. In contrast, Zhuo et al. reported SaV-GI.1 as the predominant genotype in pediatric sporadic case of SaV-associated AGE in Canada (Alberta) between 2014 and 2018 (36%), followed by SaV-GI.2 (18%), SaV-GII.5 (8%), and SaV-GII.3 (6%) [25]. These findings differ from ours, where SaV GI.1 was detected only once in 2013–2014, suggesting temporal and/or geographical variations in SaV genotype patterns. Interestingly, Zhuo et al. also reported that SaV-GI.2 overtook GI.1 as the predominant strain in 2016–2017, with high detection rates persisting into April. SaV-GI.2 was also a major cause of AGE outbreaks, in Quebec between 2015 and 2016. Rare genotypes, including SaV-GII.1, SaV-GII.2, SaV-GV.1, SaV-GII.4, SaV-GIV.1, SaV-GI.3, and SaV-GI.7 were also identified in pediatric sporadic case of SaV-associated AGE between 2014 and 2018 [25]. In this study, SaV-GIV.1 was the second most common SaV genotype, accounting for nearly one third of the SaVs, but was not detected in 2015–2016. Historically, this genotype was associated with increase outbreak activity in long-term care facilities and senior lodges in Canada (2004–2007) and the United States (2002–2009) [26,45]. Overall, these results highlight differences in SaV prevalence and indicate geographical and/or temporal changes in SaV genotype distribution. Although SaV recombinant strains have been reported [23], phylogenetic analysis of partial RdRp and full-length VP1 sequences showed all SaV sequences from this study clusters with their expected genotype in both regions, as identified by the online typing tool, suggesting nonrecombinant circulation.
Although extensive, the genetic diversity of the NoVs and SaVs reported in this study is most likely underestimated. For instance, noroviruses bearing a GII.3 capsid (GII.3[P12], GII.3[P21], GII.3[P16], which are usually highly represented worldwide including in North America [69], were not detected in this study. RT-PCR amplification biases cannot be completely ruled out, and suboptimal PCR primers are the most probable cause for the lack of certain genotypes in our study. Also, stool specimens are from outbreaks that occurred in long-term care facilities and hospital setting and genetic diversity of circulating strains might be less well represented in comparison to sporadic samples.

5. Conclusions

In summary, five years of molecular surveillance of NoV- and SaV-associated AGE outbreaks showed that genetic diversity of circulating NoVs and SaVs in Quebec, Canada, is extensive and genotype distribution trends vary according to the year. Detection of emerging global genotypes suggests frequent and rapid spread in the province. Ultimately, these findings may contribute to enhanced understanding of norovirus and sapovirus infection, leading to greater insight into transmission patterns, population immunity, burden of disease, and supporting vaccine design.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/v18010085/s1, Table S1: NCBI Reference Genomes Used for NoV and SaV Primer Design.

Author Contributions

Conceptualization, É.L. and Y.L.; methodology, É.L. and H.C.; formal analysis, É.L.; resources, É.L., H.C., and C.M.; data curation, É.L.; writing—original draft preparation, É.L.; writing—review and editing, É.L., Y.L., H.C., and C.M.; supervision, É.L.; project administration, É.L.; funding acquisition, É.L. and Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Canadian Food Inspection Agency, grant number STH-F-1501.

Institutional Review Board Statement

This study was conducted using only anonymized human fecal specimens, in strict adherence to the privacy protection standards under Quebec’s Règlement sur l’anonymisation des renseignements personnels (A 2.1, r. 0.1) and the Canadian Tri-Council Policy Statement: Ethical Conduct for Research Involving Humans (TCPS 2). Given that the samples were irrevocably de-identified and cannot be traced back to individuals, the research was exempt from Research Ethics Board review under TCPS2 Article 5.5.

Informed Consent Statement

Informed consent for participation is not required as per local legislation, specifically the Canadian Tri-Council Policy Statement: Ethical Conduct for Research Involving Humans (TCPS 2), Article 5.5, which exempts research using anonymized biological specimens from consent requirements.

Data Availability Statement

The original data presented in the study will be openly available in GenBank under the accession numbers PX720646-PX720657, PX732916-PX733095, and PX737900-PX737926.

Acknowledgments

We thank Philippe Raymond for his critical review of the manuscript. We thank the LSPQ staff involved in initial real-time RT-PCR testing of specimens and for gathering archived RNA extracts used for this study. Use of trade names and commercial sources is for identification purposes only and does not imply endorsement by the Canadian Food Inspection Agency.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
AGEAcute Gastroenteritis
SaVSapovirus
NoVNorovirus
RNARibonucleic acid
cDNAComplementary strand deoxyribonucleic acid
ORFOpen Reading Frame
RdRpRNA dependant RNA polymerase
RT-PCRReverse transcription polymerase chain reaction
ntNucleotide

Appendix A

Table A1. Number of norovirus- and sapovirus-positive GE outbreaks and samples successfully genotyped between 2011 and 2016.
Table A1. Number of norovirus- and sapovirus-positive GE outbreaks and samples successfully genotyped between 2011 and 2016.
YearNoV GI OutbreaksNoV GI SamplesNoV GII OutbreaksNoV GII SamplesSaV OutbreaksSaV SamplesMixed GI/GII OutbreaksMixed GI/GII SamplesMixed GII/SaV OutbreaksMixed GII/SaV SamplesTotal OutbreaksTotal Samples
2011–120/00/049/6149/610/00/00/00/00/00/049/6149/61
2012–130/40/452/6752/673/43/40/00/00/00/055/7555/75
2013–144/64/617/2517/256/96/90/00/00/00/027/4027/40
2014–152/22/223/2623/267/77/73/37/9 GI
4/4 GII		4/46/6 GII
4/4 SaV		39/4253/58
2015–163/33/320/2323/264/44/41/12/3 GI
4/4 GII		3/34/5 GII
2/3 SaV		31/3441/48
Total9/159/15161/202164/20519/2420/244/417/207/716/18201/252225/282
Table A2. Recombination analysis of NoV and GenBank reference strains. Recombination events were identified using RDP4.
Table A2. Recombination analysis of NoV and GenBank reference strains. Recombination events were identified using RDP4.
NoV GenotypeNb of Strains 1Major
Parent		Minor
Parent		Breakpoint nt 2Breakpoint RegionMethods Detected 4p-Value(B)
GII.2[P16]1MK762637DQ4568245096Junction 3R, G, B, M, C, T1.245 × 10−26
GII.4 Syd[P4 NO]18GU445325.2JX4599084976ORF1G, B, M, C, S, T6.105 × 10−10
GII.4 Syd[P4 NO]1GU445325.2JX4599084961ORF1G, B, M, C, T2.286 × 10−11
GII.1[P33]2GQ845370.2U07611.25064ORF1R, G, B, M, C, S, T1.226 × 10−9
GII.4 Syd[P16]7AY772730JX4599085095Junction 3R, G, B, M, C, S, T8.942 × 10−29
GII.6[P7]4MH218692AB0397785028Junction 3G, B, M, C, S, T-
GII.13[P16]2MH218651MK7626375094Junction 3B, M, C, S, T1.489 × 10−31
GII.4Syd[P31]62KT589391.1MK7626375080Junction 3R, G, B, M, C, S, T1.986 × 10−27
1 Number of strains with evidence of same recombination event; 2 Position in major parent (Syd, Sydney 2012; NO, New Orleans 2009; SF, San Francisco); 3 ORF1/ORF2 junction; 4 Recombination detection methods (R, RDP; G, GENECONV; B, BootScan; M, MaxChi; C, Chimera; S, SiScan; T, 3 Seq).

References

  1. Ahmed, S.M.; Hall, A.J.; Robinson, A.E.; Verhoef, L.; Premkumar, P.; Parashar, U.D.; Koopmans, M.; Lopman, B.A. Global prevalence of norovirus in cases of gastroenteritis: A systematic review and meta-analysis. Lancet Infect. Dis. 2014, 14, 725–730. [Google Scholar] [CrossRef] [PubMed]
  2. Lopman, B.A.; Hall, A.J.; Curns, A.T.; Parashar, U.D. Increasing rates of gastroenteritis hospital discharges in US adults and the contribution of norovirus, 1996–2007. Clin. Infect. Dis. 2011, 52, 466–474. [Google Scholar] [CrossRef] [PubMed]
  3. Hall, A.J.; Curns, A.T.; McDonald, L.C.; Parashar, U.D.; Lopman, B.A. The roles of Clostridium difficile and norovirus among gastroenteritis-associated deaths in the United States, 1999–2007. Clin. Infect. Dis. 2012, 55, 216–223. [Google Scholar] [CrossRef] [PubMed]
  4. Leblanc, D.; Inglis, G.D.; Boras, V.F.; Brassard, J.; Houde, A. The prevalence of enteric RNA viruses in stools from diarrheic and non-diarrheic people in southwestern Alberta, Canada. Arch. Virol. 2017, 162, 117–128. [Google Scholar] [CrossRef]
  5. Becker-Dreps, S.; González, F.; Bucardo, F. Sapovirus: An emerging cause of childhood diarrhea. Curr. Opin. Infect. Dis. 2020, 33, 388–397. [Google Scholar] [CrossRef]
  6. Prasad, B.V.V.; Atmar, R.L.; Ramani, S.; Palzkill, T.; Song, Y.; Crawford, S.E.; Estes, M.K. Norovirus replication, host interactions and vaccine advances. Nat. Rev. Microbiol. 2025, 23, 385–401. [Google Scholar] [CrossRef]
  7. Chang, K.O.; Sosnovtsev, S.V.; Belliot, G.; Wang, Q.; Saif, L.J.; Green, K.Y. Reverse genetics system for porcine enteric calicivirus, a prototype sapovirus in the Caliciviridae. J. Virol. 2005, 79, 1409–1416. [Google Scholar] [CrossRef]
  8. Kroneman, A.; Vega, E.; Vennema, H.; Vinjé, J.; White, P.A.; Hansman, G.; Green, K.; Martella, V.; Katayama, K.; Koopmans, M. Proposal for a unified norovirus nomenclature and genotyping. Arch. Virol. 2013, 158, 2059–2068. [Google Scholar] [CrossRef]
  9. Chhabra, P.; de Graaf, M.; Parra, G.I.; Chan, M.C.-W.; Green, K.; Martella, V.; Wang, Q.; White, P.A.; Katayama, K.; Vennema, H.; et al. Updated classification of norovirus genogroups and genotypes. J. Gen. Virol. 2019, 100, 1393–1406. [Google Scholar] [CrossRef]
  10. Siebenga, J.J.; Vennema, H.; Zheng, D.-P.; Vinjé, J.; Lee, B.E.; Pang, X.-L.; Ho, E.C.M.; Lim, W.; Choudekar, A.; Broor, S.; et al. Norovirus Illness Is a Global Problem: Emergence and Spread of Norovirus GII.4 Variants, 2001–2007. J. Infect. Dis. 2009, 200, 802–812. [Google Scholar] [CrossRef]
  11. Eden, J.S.; Hewitt, J.; Lim, K.L.; Boni, M.F.; Merif, J.; Greening, G.; Ratcliff, R.M.; Holmes, E.C.; Tanaka, M.M.; Rawlinson, W.D.; et al. The emergence and evolution of the novel epidemic norovirus GII.4 variant Sydney 2012. Virology 2014, 450–451, 106–113. [Google Scholar] [CrossRef] [PubMed]
  12. Cannon, J.L.; Barclay, L.; Collins, N.R.; Wikswo, M.E.; Castro, C.J.; Magaña, L.C.; Gregoricus, N.; Marine, R.L.; Chhabra, P.; Vinjé, J. Genetic and Epidemiologic Trends of Norovirus Outbreaks in the United States from 2013 to 2016 Demonstrated Emergence of Novel GII.4 Recombinant Viruses. J. Clin. Microbiol. 2017, 55, 2208–2221. [Google Scholar] [CrossRef] [PubMed]
  13. Jing, H.; Yang, Y.; He, M.; Wang, Y.; Zhao, Y.; Li, Z.; Zhang, H.; Jia, N.; Gao, Y.; Liu, S.; et al. An Increasing Prevalence of Non-GII.4 Genotypes Causing Norovirus Gastroenteritis Outbreaks—Beijing Municipality, China, 2017–2024. China CDC Wkly 2025, 7, 790–795. [Google Scholar] [CrossRef] [PubMed]
  14. Chen, L.; Xu, D.; Wu, X.; Liu, G.; Ji, L. An increasing prevalence of non-GII.4 norovirus genotypes in acute gastroenteritis outbreaks in Huzhou, China, 2014–2018. Arch. Virol. 2020, 165, 1121–1128. [Google Scholar] [CrossRef]
  15. Chhabra, P.; Wong, S.; Niendorf, S.; Lederer, I.; Vennema, H.; Faber, M.; Nisavanh, A.; Jacobsen, S.; Williams, R.; Colgan, A.; et al. Increased circulation of GII.17 noroviruses, six European countries and the United States, 2023 to 2024. Eurosurveillance 2024, 29, 2400625. [Google Scholar] [CrossRef]
  16. Barclay, L.; Vinjé, J. Increasing Predominance of Norovirus GII.17 over GII.4, United States, 2022–2025. Emerg. Infect. Dis. 2025, 31, 1471–1473. [Google Scholar] [CrossRef]
  17. Hansman, G.S.; Oka, T.; Katayama, K.; Takeda, N. Human sapoviruses: Genetic diversity, recombination, and classification. Rev. Med. Virol. 2007, 17, 133–141. [Google Scholar] [CrossRef]
  18. Oka, T.; Lu, Z.; Phan, T.; Delwart, E.L.; Saif, L.J.; Wang, Q. Genetic Characterization and Classification of Human and Animal Sapoviruses. PLoS ONE 2016, 11, e0156373. [Google Scholar] [CrossRef]
  19. Yinda, C.K.; Conceição-Neto, N.; Zeller, M.; Heylen, E.; Maes, P.; Ghogomu, S.M.; Van Ranst, M.; Matthijnssens, J. Novel highly divergent sapoviruses detected by metagenomics analysis in straw-colored fruit bats in Cameroon. Emerg. Microbes Infect. 2017, 6, e38. [Google Scholar] [CrossRef]
  20. Diez-Valcarce, M.; Castro, C.J.; Marine, R.L.; Halasa, N.; Mayta, H.; Saito, M.; Tsaknaridis, L.; Pan, C.Y.; Bucardo, F.; Becker-Dreps, S.; et al. Genetic diversity of human sapovirus across the Americas. J. Clin. Virol. 2018, 104, 65–72. [Google Scholar] [CrossRef]
  21. Oka, T.; Mori, K.; Iritani, N.; Harada, S.; Ueki, Y.; Iizuka, S.; Mise, K.; Murakami, K.; Wakita, T.; Katayama, K. Human sapovirus classification based on complete capsid nucleotide sequences. Arch. Virol. 2012, 157, 349–352. [Google Scholar] [CrossRef]
  22. Magwalivha, M.; Kabue, J.-P.; Traore, A.N.; Potgieter, N. Prevalence of Human Sapovirus in Low and Middle Income Countries. Adv. Virol. 2018, 2018, 5986549. [Google Scholar] [CrossRef] [PubMed]
  23. Zhao, W.; Gao, Z.; Guo, C.; Zhang, Y.; Zhang, Y.; Wang, Q.; Yu, J. A dual typing system establishment and global diversity analysis for sapoviruses. BMC Genom. 2024, 25, 1131. [Google Scholar] [CrossRef] [PubMed]
  24. Tohma, K.; Kulka, M.; Coughlan, S.; Green, K.Y.; Parra, G.I. Genomic Analyses of Human Sapoviruses Detected over a 40-Year Period Reveal Disparate Patterns of Evolution among Genotypes and Genome Regions. Viruses 2020, 12, 516. [Google Scholar] [CrossRef] [PubMed]
  25. Zhuo, R.; Ding, X.; Freedman, S.B.; Lee, B.E.; Ali, S.; Luong, J.; Xie, J.; Chui, L.; Wu, Y.; Pang, X. Molecular Epidemiology of Human Sapovirus among Children with Acute Gastroenteritis in Western Canada. J. Clin. Microbiol. 2021, 59, e0098621. [Google Scholar] [CrossRef]
  26. Pang, X.L.; Lee, B.E.; Tyrrell, G.J.; Preiksaitis, J.K. Epidemiology and genotype analysis of sapovirus associated with gastroenteritis outbreaks in Alberta, Canada: 2004–2007. J. Infect. Dis. 2009, 199, 547–551. [Google Scholar] [CrossRef]
  27. Kageyama, T.; Kojima, S.; Shinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F.B.; Takeda, N.; Katayama, K. Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J. Clin. Microbiol. 2003, 41, 1548–1557. [Google Scholar] [CrossRef]
  28. Oka, T.; Katayama, K.; Hansman, G.S.; Kageyama, T.; Ogawa, S.; Wu, F.T.; White, P.A.; Takeda, N. Detection of human sapovirus by real-time reverse transcription-polymerase chain reaction. J. Med. Virol. 2006, 78, 1347–1353. [Google Scholar] [CrossRef]
  29. Puustinen, L.; Blazevic, V.; Huhti, L.; Szakal, E.D.; Halkosalo, A.; Salminen, M.; Vesikari, T. Norovirus genotypes in endemic acute gastroenteritis of infants and children in Finland between 1994 and 2007. Epidemiol. Infect. 2012, 140, 268–275. [Google Scholar] [CrossRef]
  30. Jiang, X.; Huang, P.W.; Zhong, W.M.; Farkas, T.; Cubitt, D.W.; Matson, D.O. Design and evaluation of a primer pair that detects both Norwalk- and Sapporo-like caliciviruses by RT-PCR. J. Virol. Methods 1999, 83, 145–154. [Google Scholar] [CrossRef]
  31. Kroneman, A.; Vennema, H.; Deforche, K.; v d Avoort, H.; Peñaranda, S.; Oberste, M.S.; Vinjé, J.; Koopmans, M. An automated genotyping tool for enteroviruses and noroviruses. J. Clin. Virol. 2011, 51, 121–125. [Google Scholar] [CrossRef] [PubMed]
  32. Tatusov, R.L.; Chhabra, P.; Diez-Valcarce, M.; Barclay, L.; Cannon, J.L.; Vinjé, J. Human Calicivirus Typing tool: A web-based tool for genotyping human norovirus and sapovirus sequences. J. Clin. Virol. 2021, 134, 104718. [Google Scholar]
  33. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  34. Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [PubMed]
  35. Hasing, M.E.; Lee, B.E.; Qiu, Y.; Xia, M.; Pabbaraju, K.; Wong, A.; Tipples, G.; Jiang, X.; Pang, X.L. Changes in norovirus genotype diversity in gastroenteritis outbreaks in Alberta, Canada: 2012–2018. BMC Infect. Dis. 2019, 19, 177. [Google Scholar] [CrossRef]
  36. Choi, Y.S.; Koo, E.S.; Kim, M.S.; Choi, J.D.; Shin, Y.; Jeong, Y.S. Re-emergence of a GII.4 Norovirus Sydney 2012 Variant Equipped with GII.P16 RdRp and Its Predominance over Novel Variants of GII.17 in South Korea in 2016. Food Env. Virol. 2017, 9, 168–178. [Google Scholar]
  37. Matsushima, Y.; Shimizu, T.; Ishikawa, M.; Komane, A.; Okabe, N.; Ryo, A.; Kimura, H.; Katayama, K.; Shimizu, H. Complete Genome Sequence of a Recombinant GII.P16-GII.4 Norovirus Detected in Kawasaki City, Japan, in 2016. Genome Announc. 2016, 4, e01099-16. [Google Scholar]
  38. Niendorf, S.; Jacobsen, S.; Faber, M.; Eis-Hübinger, A.M.; Hofmann, J.; Zimmermann, O.; Höhne, M.; Bock, C.T. Steep rise in norovirus cases and emergence of a new recombinant strain GII.P16-GII.2, Germany, winter 2016. Eurosurveillance 2017, 22, 30447. [Google Scholar] [CrossRef]
  39. Medici, M.C.; Tummolo, F.; Martella, V.; De Conto, F.; Arcangeletti, M.C.; Pinardi, F.; Ferraglia, F.; Chezzi, C.; Calderaro, A. Emergence of novel recombinant GII.P16_GII.2 and GII. P16_GII.4 Sydney 2012 norovirus strains in Italy, winter 2016/2017. New Microbiol. 2018, 41, 71–72. [Google Scholar]
  40. Barclay, L.; Cannon, J.L.; Wikswo, M.E.; Phillips, A.R.; Browne, H.; Montmayeur, A.M.; Tatusov, R.L.; Burke, R.M.; Hall, A.J.; Vinjé, J. Emerging Novel GII.P16 Noroviruses Associated with Multiple Capsid Genotypes. Viruses 2019, 11, 535. [Google Scholar] [CrossRef]
  41. Bidalot, M.; Théry, L.; Kaplon, J.; De Rougemont, A.; Ambert-Balay, K. Emergence of new recombinant noroviruses GII.p16-GII.4 and GII.p16-GII.2, France, winter 2016 to 2017. Eurosurveillance 2017, 22, 30508. [Google Scholar]
  42. de Graaf, M.; van Beek, J.; Vennema, H.; Podkolzin, A.T.; Hewitt, J.; Bucardo, F.; Templeton, K.; Mans, J.; Nordgren, J.; Reuter, G.; et al. Emergence of a novel GII.17 norovirus—End of the GII.4 era? Eurosurveillance 2015, 20, 21178. [Google Scholar]
  43. Calderwood, L.E.; Wikswo, M.E.; Mattison, C.P.; Kambhampati, A.K.; Balachandran, N.; Vinjé, J.; Barclay, L.; Hall, A.J.; Parashar, U.; Mirza, S.A. Norovirus Outbreaks in Long-term Care Facilities in the United States, 2009–2018: A Decade of Surveillance. Clin. Infect. Dis. 2022, 74, 113–119. [Google Scholar] [PubMed]
  44. Parrón, I.; Barrabeig, I.; Alseda, M.; Rius, C.; Cornejo-Sánchez, T.; Jané, M.; Pérez, C.; Guix, S.; Domínguez, À. Norovirus outbreaks in long-term care facilities in Catalonia from 2017 to 2018. Sci. Rep. 2021, 11, 23218. [Google Scholar] [CrossRef]
  45. Lee, L.E.; Cebelinski, E.A.; Fuller, C.; Keene, W.E.; Smith, K.; Vinjé, J.; Besser, J.M. Sapovirus outbreaks in long-term care facilities, Oregon and Minnesota, USA, 2002–2009. Emerg. Infect. Dis. 2012, 18, 873–876. [Google Scholar] [CrossRef]
  46. Portela, A.R.; Hernandez, J.M.; Bandeira, R.S.; Junior, E.C.S.; de Melo, T.C.; Lucena, M.S.S.; Teixeira, D.M.; Siqueira, J.A.M.; Gabbay, Y.B.; Silva, L.D. Retrospective molecular analysis of norovirus recombinant strains in the amazon region, Brazil. Infect. Genet. Evol. 2021, 96, 105130. [Google Scholar] [CrossRef]
  47. Fu, J.; Bao, C.; Huo, X.; Hu, J.; Shi, C.; Lin, Q.; Zhang, J.; Ai, J.; Xing, Z. Increasing Recombinant Strains Emerged in Norovirus Outbreaks in Jiangsu, China: 2015–2018. Sci. Rep. 2019, 9, 20012. [Google Scholar] [CrossRef]
  48. Navarro-Lleó, N.; Santiso-Bellón, C.; Vila-Vicent, S.; Carmona-Vicente, N.; Gozalbo-Rovira, R.; Cárcamo-Calvo, R.; Rodríguez-Díaz, J.; Buesa, J. Recombinant Noroviruses Circulating in Spain from 2016 to 2020, Proposal of Two Novel Genotypes within Genogroup, I. Microbiol. Spectr. 2022, 10, e0250521. [Google Scholar] [CrossRef]
  49. Khamrin, P.; Kumthip, K.; Yodmeeklin, A.; Okitsu, S.; Motomura, K.; Sato, S.; Ushijima, H.; Maneekarn, N. Genetic recombination and genotype diversity of norovirus GI in children with acute gastroenteritis in Thailand, 2015–2021. J. Infect. Public Health 2024, 17, 379–385. [Google Scholar]
  50. Han, J.; Wu, X.; Chen, L.; Fu, Y.; Xu, D.; Zhang, P.; Ji, L. Emergence of norovirus GII.P16-GII.2 strains in patients with acute gastroenteritis in Huzhou, China, 2016–2017. BMC Infect. Dis. 2018, 18, 342. [Google Scholar]
  51. Chhabra, P.; Tully, D.C.; Mans, J.; Niendorf, S.; Barclay, L.; Cannon, J.L.; Montmayeur, A.M.; Pan, C.Y.; Page, N.; Williams, R.; et al. Emergence of Novel Norovirus GII.4 Variant. Emerg. Infect. Dis. 2024, 30, 163–167. [Google Scholar] [CrossRef] [PubMed]
  52. Tohma, K.; Landivar, M.; Ford-Siltz, L.A.; Pilewski, K.A.; Kendra, J.A.; Niendorf, S.; Parra, G.I. Antigenic Characterization of Novel Human Norovirus GII.4 Variants San Francisco 2017 and Hong Kong 2019. Emerg. Infect. Dis. 2024, 30, 1026–1029. [Google Scholar] [CrossRef] [PubMed]
  53. Chan, M.C.W.; Hu, Y.; Chen, H.; Podkolzin, A.; Zaytseva, E.; Komano, J.; Sakon, N.; Poovorawan, Y.; Vongpunsawad, S.; Thanusuwannasak, T.; et al. Global Spread of Norovirus GII.17 Kawasaki 308, 2014–2016. Emerg. Infect. Dis. J. 2017, 23, 1359. [Google Scholar] [CrossRef] [PubMed]
  54. Han, J.; Ji, L.; Shen, Y.; Wu, X.; Xu, D.; Chen, L. Emergence and predominance of norovirus GII.17 in Huzhou, China, 2014–2015. Virol. J. 2015, 12, 139. [Google Scholar] [CrossRef]
  55. Matsushima, Y.; Ishikawa, M.; Shimizu, T.; Komane, A.; Kasuo, S.; Shinohara, M.; Nagasawa, K.; Kimura, H.; Ryo, A.; Okabe, N.; et al. Genetic analyses of GII.17 norovirus strains in diarrheal disease outbreaks from December 2014 to March 2015 in Japan reveal a novel polymerase sequence and amino acid substitutions in the capsid region. Eurosurveillance 2015, 20, 21173. [Google Scholar] [CrossRef]
  56. Chan, M.C.; Lee, N.; Hung, T.N.; Kwok, K.; Cheung, K.; Tin, E.K.; Lai, R.W.; Nelson, E.A.; Leung, T.F.; Chan, P.K. Rapid emergence and predominance of a broadly recognizing and fast-evolving norovirus GII.17 variant in late 2014. Nat. Commun. 2015, 6, 10061. [Google Scholar] [CrossRef]
  57. LeBlanc, J.J.; Pettipas, J.; Gaston, D.; Taylor, R.; Hatchette, T.F.; Booth, T.F.; Mandes, R.; McDermid, A.; Grudeski, E. Outbreak of Norovirus GII.P17-GII.17 in the Canadian Province of Nova Scotia. Can. J. Infect. Dis. Med. Microbiol. 2016, 2016, 1280247. [Google Scholar] [CrossRef]
  58. Dinu, S.; Oprea, M.; Iordache, R.-I.; Rusu, L.-C.; Usein, C.-R. Genome characterisation of norovirus GII.P17-GII.17 detected during a large gastroenteritis outbreak in Romania in 2021. Arch. Virol. 2023, 168, 116. [Google Scholar] [CrossRef]
  59. Wang, G.; Shen, Z.; Qian, F.; Li, Y.; Yuan, Z.; Zhang, J. Genetic diversity of sapovirus in non-hospitalized adults with sporadic cases of acute gastroenteritis in Shanghai, China. J. Clin. Virol. 2014, 59, 250–254. [Google Scholar] [CrossRef]
  60. Iritani, N.; Yamamoto, S.P.; Abe, N.; Kubo, H.; Oka, T.; Kaida, A. Epidemics of GI.2 sapovirus in gastroenteritis outbreaks during 2012–2013 in Osaka City, Japan. J. Med. Virol. 2016, 88, 1187–1193. [Google Scholar]
  61. Svraka, S.; Vennema, H.; van der Veer, B.; Hedlund, K.O.; Thorhagen, M.; Siebenga, J.; Duizer, E.; Koopmans, M. Epidemiology and genotype analysis of emerging sapovirus-associated infections across Europe. J. Clin. Microbiol. 2010, 48, 2191–2198. [Google Scholar] [CrossRef] [PubMed]
  62. Medici, M.C.; Tummolo, F.; Albonetti, V.; Abelli, L.A.; Chezzi, C.; Calderaro, A. Molecular detection and epidemiology of astrovirus, bocavirus, and sapovirus in Italian children admitted to hospital with acute gastroenteritis, 2008–2009. J. Med. Virol. 2012, 84, 643–650. [Google Scholar] [PubMed]
  63. Chhabra, P.; Samoilovich, E.; Yermalovich, M.; Chernyshova, L.; Gheorghita, S.; Cojocaru, R.; Shugayev, N.; Sahakyan, G.; Lashkarashvili, M.; Chubinidze, M.; et al. Viral gastroenteritis in rotavirus negative hospitalized children <5 years of age from the independent states of the former Soviet Union. Infect. Genet. Evol. 2014, 28, 283–288. [Google Scholar] [CrossRef] [PubMed]
  64. Bucardo, F.; Reyes, Y.; Svensson, L.; Nordgren, J. Predominance of norovirus and sapovirus in Nicaragua after implementation of universal rotavirus vaccination. PLoS ONE 2014, 9, e98201. [Google Scholar]
  65. Jiao, Y.; Han, T.; Qi, X.; Gao, Y.; Zhao, J.; Zhang, Y.; Li, B.; Zhang, Z.; Du, J.; Sun, L. Genotypes Diversity of Acute Gastroenteritis Outbreaks Caused by Human Sapovirus—Beijing Municipality, China, 2015–2021. China CDC Wkly 2023, 5, 625–631. [Google Scholar] [CrossRef]
  66. Wu, F.T.; Oka, T.; Takeda, N.; Katayama, K.; Hansman, G.S.; Muo, C.H.; Liang, S.Y.; Hung, C.H.; Dah-Shyong Jiang, D.; Hsin Chang, J.; et al. Acute gastroenteritis caused by GI/2 sapovirus, Taiwan, 2007. Emerg. Infect. Dis. 2008, 14, 1169–1171. [Google Scholar]
  67. Harada, S.; Oka, T.; Tokuoka, E.; Kiyota, N.; Nishimura, K.; Shimada, Y.; Ueno, T.; Ikezawa, S.; Wakita, T.; Wang, Q.; et al. A confirmation of sapovirus re-infection gastroenteritis cases with different genogroups and genetic shifts in the evolving sapovirus genotypes, 2002–2011. Arch. Virol. 2012, 157, 1999–2003. [Google Scholar] [CrossRef]
  68. Mann, P.; Pietsch, C.; Liebert, U.G. Genetic Diversity of Sapoviruses among Inpatients in Germany, 2008–2018. Viruses 2019, 11, 726. [Google Scholar]
  69. Kendra, J.A.; Tohma, K.; Parra, G.I. Global and regional circulation trends of norovirus genotypes and recombinants, 1995–2019: A comprehensive review of sequences from public databases. Rev. Med. Virol. 2022, 32, e2354. [Google Scholar]
Viruses 18 00085 g001
Figure 1. Yearly distribution of NoV (a) and SaV (b) genotypes from AGE outbreaks in Quebec, Canada, 2011–2016. Different NoV and SaV genotypes are represented by different colours. Genotypes with overall frequencies ≤ 1% were grouped under “others”. Syd, Sydney 2012; NO, New Orleans 2009; DH, Den Haag 2006.
Figure 1. Yearly distribution of NoV (a) and SaV (b) genotypes from AGE outbreaks in Quebec, Canada, 2011–2016. Different NoV and SaV genotypes are represented by different colours. Genotypes with overall frequencies ≤ 1% were grouped under “others”. Syd, Sydney 2012; NO, New Orleans 2009; DH, Den Haag 2006.
Viruses 18 00085 g001
Viruses 18 00085 g002
Figure 2. Phylogenetic trees of NoV GII.4 San Francisco[P31] RdRp (a) and VP1 (b) gene regions. The trees were constructed by the neighbour-joining method with the K80 + G + T (RdRP) and GTR + G + T (VP1) parameter model nucleotide substitution model, respectively, with 1000 bootstrap replicates. Bootstrap values are shown at the branch nodes. All reference sequence names are formatted as GenBank accession number/sample name/genotype(strain)/year/country (JPN, Japan; CHN, China; USA, United States; KOR, Korea; AUS, Australia; RUS, Russia; CAN, Canada; BEL, Belgium; HKG, Hong Kong; KHM, Cambodia; IND, India; NL, Netherlands; BGD, Bangladesh; TW, Taiwan; BRA, Brazil; UK, United Kingdom; THA, Thailand; PA, Panama). Strains obtained from our study are labelled as sample name/year with a black circle.
Figure 2. Phylogenetic trees of NoV GII.4 San Francisco[P31] RdRp (a) and VP1 (b) gene regions. The trees were constructed by the neighbour-joining method with the K80 + G + T (RdRP) and GTR + G + T (VP1) parameter model nucleotide substitution model, respectively, with 1000 bootstrap replicates. Bootstrap values are shown at the branch nodes. All reference sequence names are formatted as GenBank accession number/sample name/genotype(strain)/year/country (JPN, Japan; CHN, China; USA, United States; KOR, Korea; AUS, Australia; RUS, Russia; CAN, Canada; BEL, Belgium; HKG, Hong Kong; KHM, Cambodia; IND, India; NL, Netherlands; BGD, Bangladesh; TW, Taiwan; BRA, Brazil; UK, United Kingdom; THA, Thailand; PA, Panama). Strains obtained from our study are labelled as sample name/year with a black circle.
Viruses 18 00085 g002
Viruses 18 00085 g003
Figure 3. Phylogenetic trees of NoV GII.17[P17] RdRp (a) and VP1 (b) gene regions. The trees were constructed by the neighbour-joining method with the GTR + G + T parameter model nucleotide substitution model, respectively, with 1000 bootstrap replicates. Bootstrap values are shown at the branch nodes. All reference sequence names are formatted as GenBank accession number/sample name/genotype(strain)/year/country (JPN, Japan; Hong Kong, HKG; CHE, Switzerland; USA, United States; KOR, Korea; AUS, Australia; CAN, Canada; BRA, Brazil; FR, France; ROM, Romania; GF, French Guiana; RUS, Russia). Strains obtained from our study are labelled as sample name/year with a black circle.
Figure 3. Phylogenetic trees of NoV GII.17[P17] RdRp (a) and VP1 (b) gene regions. The trees were constructed by the neighbour-joining method with the GTR + G + T parameter model nucleotide substitution model, respectively, with 1000 bootstrap replicates. Bootstrap values are shown at the branch nodes. All reference sequence names are formatted as GenBank accession number/sample name/genotype(strain)/year/country (JPN, Japan; Hong Kong, HKG; CHE, Switzerland; USA, United States; KOR, Korea; AUS, Australia; CAN, Canada; BRA, Brazil; FR, France; ROM, Romania; GF, French Guiana; RUS, Russia). Strains obtained from our study are labelled as sample name/year with a black circle.
Viruses 18 00085 g003
Viruses 18 00085 g004
Figure 4. Phylogenetic trees of SaV RdRp (a) and VP1 (b) gene regions. The trees were constructed by the neighbour-joining method with the K80 + G + T (RdRP) and GTR + G +T (VP1) parameter model nucleotide substitution model, respectively, with 1000 bootstrap replicates. Bootstrap values are shown at the branch nodes. All reference sequence names are formatted as GenBank accession number/sample name/genotype(strain)/year/country (BRA, Brazil; HUN, Hungary; GER, Garmany; UK, United Kingdom; PE, Peru; FR, France; NI, Nicaragua; GUAT, Guatemala; JPN, Japan; CHN, China; USA, United States; THA, Thailand; KOR, Korea; RUS, Russia; CAN, Canada; SE, Sweden; AUS, Australia). Strains obtained from our study are labelled as sample name/year with a black circle.
Figure 4. Phylogenetic trees of SaV RdRp (a) and VP1 (b) gene regions. The trees were constructed by the neighbour-joining method with the K80 + G + T (RdRP) and GTR + G +T (VP1) parameter model nucleotide substitution model, respectively, with 1000 bootstrap replicates. Bootstrap values are shown at the branch nodes. All reference sequence names are formatted as GenBank accession number/sample name/genotype(strain)/year/country (BRA, Brazil; HUN, Hungary; GER, Garmany; UK, United Kingdom; PE, Peru; FR, France; NI, Nicaragua; GUAT, Guatemala; JPN, Japan; CHN, China; USA, United States; THA, Thailand; KOR, Korea; RUS, Russia; CAN, Canada; SE, Sweden; AUS, Australia). Strains obtained from our study are labelled as sample name/year with a black circle.
Viruses 18 00085 g004
Table 1. Primers used for genotyping NoV and SaV.
Table 1. Primers used for genotyping NoV and SaV.
TargetPrimer NameSequence 5′ to 3′PositionReference
NoV GI-IIp290IUBGATTACTCCARGTGGGAYTCMAC4568 a[29]
NoV GINoVGI-R3CTCCAAWDATDGCTTGRGCCAT6971 aThis study
NoV GIImGV132GCDAHRAAAGCTCCNGCCATTA6723 bThis study
SaVp290GATTACTCCAAGTGGGACTCCAC4354 c[30]
SaVSav1RAATGAGTTGGTTNGTTGG6868 cThis study
a–c Position of the 5′ end of the primer in the nucleotide sequence of Norwalk strain (M87661) [a], Lordsdale strain (X86557) [b], and Manchester strain (X86560) [c].
Table 2. Yearly distribution of genotypes of NoV- and SaV-associated outbreaks in Quebec, Canada, August 2011–May 2016.
Table 2. Yearly distribution of genotypes of NoV- and SaV-associated outbreaks in Quebec, Canada, August 2011–May 2016.
VirusCapsid TypeP-Type2011–122012–132013–142014–152015–16Total
NoVGI.2GI.2002002
GI.3GI.P3000101
GI.3GI.P10001001
GI.5GI.P5000101
GI.6GI.P11000347
GI.9GI.P9001001
GII.1GII.P33 (GII.Pg)100102
GII.2GII.P16000011
GII.4 DHGII.P4 DH400004
GII.4 NOGII.P4 NO382711168
GII.4 SydGII.P4 NO0815418
GII.4 SydGII.P16000077
GII.4 SydGII.P314171221761
GII.4 SFGII.P31000011
GII.6GII.P7200316
GII.8GII.P8001001
GII.13GII.P16002002
GII.17GII.P17000088
SaVGI.1--01001
GI.2--237618
GIV.1--12508
Total4955274740218
SF, San Francisco; Syd, Sydney 2012; NO, New Orleans 2009; DH, Den Haag 2006.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Larocque, É.; L’Homme, Y.; Charest, H.; Martineau, C. Genetic Diversity of Norovirus and Sapovirus Outbreaks in Long-Term Care Facilities in Quebec, Canada, 2011–2016. Viruses 2026, 18, 85. https://doi.org/10.3390/v18010085

AMA Style

Larocque É, L’Homme Y, Charest H, Martineau C. Genetic Diversity of Norovirus and Sapovirus Outbreaks in Long-Term Care Facilities in Quebec, Canada, 2011–2016. Viruses. 2026; 18(1):85. https://doi.org/10.3390/v18010085

Chicago/Turabian Style

Larocque, Émilie, Yvan L’Homme, Hugues Charest, and Christine Martineau. 2026. "Genetic Diversity of Norovirus and Sapovirus Outbreaks in Long-Term Care Facilities in Quebec, Canada, 2011–2016" Viruses 18, no. 1: 85. https://doi.org/10.3390/v18010085

APA Style

Larocque, É., L’Homme, Y., Charest, H., & Martineau, C. (2026). Genetic Diversity of Norovirus and Sapovirus Outbreaks in Long-Term Care Facilities in Quebec, Canada, 2011–2016. Viruses, 18(1), 85. https://doi.org/10.3390/v18010085

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop