The Involvement of MGF505 Genes in the Long-Term Persistence of the African Swine Fever Virus in Gastropods
Abstract
1. Introduction
2. Methods
2.1. Virus
2.2. Sampling
2.3. Experimental ASFV Infection in Freshwater Gastropods
2.4. Quantitative Real-Time Polymerase Chain Reaction
2.5. Evaluation of IFN-like Activity in Snail Faeces
2.6. Study of Double-Stranded RNA in Physella Acuta Snail
2.7. Statistical Analysis
3. Results
3.1. Survival of ASFV After Coincubation in Gastropods
3.2. ASFV Surviving in Gastropods and Activity of MGF505
3.3. Transcription Pattern of MGF505 Genes
3.4. ASFV Evasion of Antiviral Responses in Gastropods
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- European Food Safety Authority (EFSA); Desmecht, D.; Gerbier, G.; Gortázar Schmidt, C.; Grigaliuniene, V.; Helyes, G.; Kantere, M.; Korytarova, D.; Linden, A.; Miteva, A.; et al. Epidemiological analysis of African swine fever in the European Union (September 2019 to August 2020). EFSA J. Eur. Food Saf. Auth. 2021, 19, e06572. [Google Scholar]
- Zheng, W.; Xi, J.; Zi, Y.; Wang, J.; Chi, Y.; Chen, M.; Zou, Q.; Tang, C.; Zhou, X. Stability of African swine fever virus genome under different environmental conditions. Vet. World 2023, 16, 2374–2381. [Google Scholar] [CrossRef] [Scilit]
- Arzumanyan, H.; Hakobyan, S.; Avagyan, H.; Izmailyan, R.; Nersisyan, N.; Karalyan, Z. Possibility of long-term survival of African swine fever virus in natural conditions. Vet. World 2021, 14, 854–859. [Google Scholar] [CrossRef] [Scilit]
- Karalyan, Z.; Avetisyan, A.; Avagyan, H.; Ghazaryan, H.; Vardanyan, T.; Manukyan, A.; Semerjyan, A.; Voskanyan, H. Presence and survival of African swine fever virus in leeches. Vet. Microbiol. 2019, 237, 108421. [Google Scholar] [CrossRef] [Scilit]
- Nuanualsuwan, S.; Songkasupa, T.; Boonpornprasert, P.; Suwankitwat, N.; Lohlamoh, W.; Nuengjamnong, C. Persistence of African swine fever virus on porous and non-porous fomites at environmental temperatures. Porc. Health Manag. 2022, 28, 34. [Google Scholar] [CrossRef] [Scilit]
- Hakobyan, S.A.; Ross, P.A.; Bayramyan, N.V.; Poghosyan, A.A.; Avetisyan, A.S.; Avagyan, H.R.; Hakobyan, L.H.; Abroyan, L.O.; Harutyunova, L.J.; Karalyan, Z.A. Experimental models of ecological niches for African swine fever virus. Vet. Microbiol. 2022, 266, 109365. [Google Scholar] [CrossRef] [Scilit]
- Poghosyan, A.; Hakobyan, S.; Avagyan, H.; Avetisyan, A.; Bayramyan, N.; Hakobyan, L.; Abroyan, L.; Davtyan, A.; Poghosyan, D.; Baghdasaryan, B.; et al. The role of gastropods in African swine fever virus ecology. Virol. J. 2024, 21, 180. [Google Scholar] [CrossRef] [Scilit]
- Qiao, X.; Wang, L.; Song, L. The primitive interferon-like system and its antiviral function in molluscs. Dev. Comp. Immunol. 2021, 118, 103997. [Google Scholar] [CrossRef] [Scilit]
- Green, T.J.; Montagnani, C. Poly I:C induces a protective antiviral immune response in the Pacific oyster (Crassostrea gigas) against subsequent challenge with Ostreid herpesvirus (OsHV-1 μvar). Fish. Shellfish. Immunol. 2013, 35, 382–388. [Google Scholar] [CrossRef] [Scilit]
- Green, T.J.; Raftos, D.; Speck, P.; Montagnani, C. Antiviral immunity in marine molluscs. J. Gen. Virol. 2015, 96, 2471–2482. [Google Scholar] [CrossRef] [Scilit]
- Agius, J.R.; Corbeil, S.; Helbig, K.J. Immune Control of Herpesvirus Infection in Molluscs. Pathogens 2020, 29, 618. [Google Scholar] [CrossRef] [Scilit]
- Owens, L.; Malham, S. Review of the RNA Interference Pathway in Molluscs Including Some Possibilities for Use in Bivalves in Aquaculture. J. Mar. Sci. Eng. 2015, 3, 87–99. [Google Scholar] [CrossRef] [Scilit]
- Rey-Campos, M.; Saco, A.; Novoa, B.; Figueras, A. Transcriptomic and functional analysis of the antiviral response of mussels after a poly I:C stimulation. Fish. Shellfish. Immunol. 2024, 153, 109867. [Google Scholar] [CrossRef] [Scilit]
- Vogeler, S.; Carboni, S.; Li, X.; Joyce, A. Phylogenetic analysis of the caspase family in bivalves: Implications for programmed cell death, immune response and development. BMC Genom. 2021, 22, 80. [Google Scholar] [CrossRef] [Scilit]
- Dixon, L.K.; Islam, M.; Nash, R.; Reis, A.L. African swine fever virus evasion of host defences. Virus Res. 2019, 266, 25–33. [Google Scholar] [CrossRef] [Scilit]
- de Villiers, E.P.; Gallardo, C.; Arias, M.; da Silva, M.; Upton, C.; Martin, R.; Bishop, R.P. Phylogenomic analysis of 11 complete African swine fever virus genome sequences. Virology 2010, 400, 128–136. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, V.; Holinka, L.G.; Gladue, D.P.; Sanford, B.; Krug, P.W.; Lu, X.; Arzt, J.; Reese, B.; Carrillo, C.; Risatti, G.R.; et al. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus. J. Virol. 2015, 89, 6048–6056. [Google Scholar] [CrossRef] [Scilit]
- O’Donnell, V.; Holinka, L.G.; Sanford, B.; Krug, P.W.; Carlson, J.; Pacheco, J.M.; Reese, B.; Risatti, G.R.; Gladue, D.P.; Borca, M.V. African Swine Fever Virus Georgia Isolate Harboring Deletions of 9GL and MGF360/505 Genes Is Highly Attenuated in Swine but Does Not Confer Protection against Parental Virus Challenge. Virus Res. 2016, 221, 8–14. [Google Scholar] [CrossRef] [Scilit]
- Brodie, R.; Smith, A.J.; Roper, R.L.; Tcherepanov, V.; Upton, C. Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments. BMC Bioinform. 2004, 5, 96. [Google Scholar] [CrossRef] [Scilit]
- Huang, H.; Dang, W.; Shi, Z.; Ding, M.; Xu, F.; Li, T.; Feng, T.; Zheng, H.; Xiao, S. Identification of African swine fever virus MGF505-2R as a potent inhibitor of innate immunity in vitro. Virol. Sin. 2023, 38, 84–95. [Google Scholar] [CrossRef] [Scilit]
- Dupré, J.; Le Dimna, M.; Hutet, E.; Dujardin, P.; Fablet, A.; Leroy, A.; Fleurot, I.; Karadjian, G.; Roesch, F.; Caballero, I.; et al. Exploring type I interferon pathway: Virulent vs. attenuated strain of African swine fever virus revealing a novel function carried by MGF505-4R. Front. Immunol. 2024, 15, 1358219. [Google Scholar] [CrossRef] [Scilit]
- Huang, Z.; Cao, H.; Zeng, F.; Lin, S.; Chen, J.; Luo, Y.; You, J.; Kong, C.; Mai, Z.; Deng, J.; et al. African Swine Fever Virus MGF505-7R Interacts with Interferon Regulatory Factor 9 to Evade the Type I Interferon Signaling Pathway and Promote Viral Replication. J. Virol. 2023, 97, e0197722. [Google Scholar] [CrossRef] [Scilit]
- Yang, K.; Huang, Q.; Wang, R.; Zeng, Y.; Cheng, M.; Xue, Y.; Shi, C.; Ye, L.; Yang, W.; Jiang, Y.; et al. African swine fever virus MGF505-11R inhibits type I interferon production by negatively regulating the cGAS-STING-mediated signaling pathway. Vet. Microbiol. 2021, 263, 109265. [Google Scholar] [CrossRef] [Scilit]
- Rowlands, R.J.; Michaud, V.; Heath, L.; Hutchings, G.; Oura, C.; Vosloo, W.; Dwarka, R.; Onashvili, T.; Albina, E.; Dixon, L.K. African swine fever virus isolate, Georgia, 2007. Emerg. Infect. Dis. 2008, 14, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Enjuanes, L.; Cubero, I.; Viñuela, E. Sensitivity of macrophages from different species to African swine fever (ASF) virus. J. Gen. Virol. 1977, 34, 455–463. [Google Scholar] [CrossRef] [Scilit]
- Carrascosa, A.L.; Santarén, J.F.; Viñuela, E. Production and titration of African swine fever virus in porcine alveolar macrophages. J. Virol. Methods 1982, 3, 303–310. [Google Scholar] [CrossRef] [Scilit]
- Enjuanes, L.; Carrascosa, A.L.; Moreno, M.A.; Viñuela, E. Titration of African Swine Fever (ASF) Virus. J. Gen. Virol. 1976, 32, 471–477h. [Google Scholar] [CrossRef] [Scilit]
- Ginzinger, D.G. Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Exp. Hematol. 2002, 30, 503–512. [Google Scholar] [CrossRef] [Scilit]
- Norman, O.; Koivunen, J.; Mäki, J.M.; Pihlajaniemi, T.; Heikkinen, A. Identification of suitable reference genes for normalization of reverse transcription quantitative real-time PCR (RT-qPCR) in the fibrotic phase of the bleomycin mouse model of pulmonary fibrosis. PLoS ONE 2022, 17, e0276215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Integrated DNA Technologies|IDT. Available online: https://sg.idtdna.com/page (accessed on 11 May 2022).
- Izmailyan, R.; Matevosyan, M.; Khachatryan, H.; Shavina, A.; Gevorgyan, S.; Ghazaryan, A.; Tirosyan, I.; Gabrielyan, Y.; Ayvazyan, M.; Martirosyan, B.; et al. Discovery of new antiviral agents through artificial intelligence: In vitro and in vivo results. Antivir. Res. 2024, 222, 105818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robalino, J.; Browdy, C.L.; Prior, S.; Metz, A.; Parnell, P.; Gross, P.; Warr, G. Induction of antiviral immunity by double-stranded RNA in a marine invertebrate. J. Virol. 2004, 78, 10442–10448. [Google Scholar] [CrossRef] [Scilit]
- Keita, D.; Heath, L.; Albina, E. Control of African swine fever virus replication by small interfering RNA targeting the A151R and VP72 genes. Antivir. Ther. 2010, 15, 727–736. [Google Scholar] [CrossRef] [Scilit]
- McClellan, K.; Perry, C.M. Oseltamivir. Drugs 2001, 61, 263–283. [Google Scholar] [CrossRef] [Scilit]
- Avagyan, H.R.; Hakobyan, S.A.; Avetisyan, A.S.; Bayramyan, N.V.; Hakobyan, L.H.; Poghosyan, A.A.; Abroyan, L.O.; Baghdasaryan, B.V.; Tsakanova, G.V.; Sahakyan, L.V.; et al. The pattern of stability of African swine fever virus in leeches. Vet. Microbiol. 2023, 284, 109835. [Google Scholar] [CrossRef] [Scilit]
- Herm, R.; Tummeleht, L.; Jürison, M.; Vilem, A.; Viltrop, A. Trace amounts of African swine fever virus DNA detected in insects collected from an infected pig farm in Estonia. Vet. Med. Sci. 2020, 6, 100–104. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Lu, G.; Cui, Y.; Wei, S.; An, T.; Shen, G.; Chen, Z. An insight into the transmission role of insect vectors based on the examination of gene characteristics of African swine fever virus originated from non-blood sucking flies in pig farm environments. BMC Vet. Res. 2020, 16, 227. [Google Scholar] [CrossRef] [Scilit]
- Olesen, A.S.; Lohse, L.; Hansen, M.F.; Boklund, A.; Halasa, T.; Belsham, G.J.; Rasmussen, T.B.; Bøtner, A.; Bødker, R. Infection of pigs with African swine fever virus via ingestion of stable flies (Stomoxys calcitrans). Transbound. Emerg. Dis. 2018, 65, 1152–1157. [Google Scholar] [CrossRef] [Scilit]
- Ståhl, K.; Sternberg-Lewerin, S.; Blome, S.; Viltrop, A.; Penrith, M.L.; Chenais, E. Lack of evidence for long term carriers of African swine fever virus—A systematic review. Virus Res. 2019, 15, 197725. [Google Scholar] [CrossRef] [Scilit]
- Bisht, K.; Te Velthuis, A.J.W. Decoding the Role of Temperature in RNA Virus Infections. mBio 2022, 13, 26. [Google Scholar] [CrossRef] [Scilit]
- Hine, P.M.; Wesney, B.; Besant, P.J. Replication of a herpes-like virus in larvae of the flat oyster Tiostrea chilensis at ambient temperatures. Dis. Aquat. Org. 1998, 32, 161–171. [Google Scholar] [CrossRef] [Scilit]
- Samuel, G.H.; Adelman, Z.N.; Myles, K.M. Temperature-dependent effects on the replication and transmission of arthropod-borne viruses in their insect hosts. Curr. Opin. Insect Sci. 2016, 16, 108–113. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Zhang, J.; Yang, W.; Li, P.; Ru, Y.; Kang, W.; Li, L.; Ran, Y.; Zheng, H. African swine fever virus protein MGF-505-7R promotes virulence and pathogenesis by inhibiting JAK1- and JAK2-mediated signaling. J. Biol. Chem. 2021, 297, 101190. [Google Scholar] [CrossRef] [Scilit]
- Golding, J.P.; Goatley, L.; Goodbourn, S.; Dixon, L.K.; Taylor, G.; Netherton, C.L. Sensitivity of African swine fever virus to type I interferon is linked to genes within multigene families 360 and 505. Virology 2016, 493, 154–161. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Yang, W.; Li, L.; Li, P.; Ma, Z.; Zhang, J.; Qi, X.; Ren, J.; Ru, Y.; Niu, Q.; et al. African Swine Fever Virus MGF-505-7R Negatively Regulates cGAS-STING-Mediated Signaling Pathway. J. Immunol. 2021, 206, 1844–1857. [Google Scholar] [CrossRef] [Scilit]
- Hang, K.; Yang, B.; Shen, C.; Zhang, T.; Hao, Y.; Zhang, D.; Liu, H.; Shi, X.; Li, G.; Yang, J.; et al. MGF360-9L Is a Major Virulence Factor Associated with the African Swine Fever Virus by Antagonizing the JAK/STAT Signaling Pathway. mBio 2022, 13, e0233021. [Google Scholar]






| Gene | Sequence |
|---|---|
| K196R | F:GCAGTTGTCGTAGATGAAG R: 5′-CGAAGGAAGCATTGAGTC |
| R298L | F: 5′-TCTGAAATGTTCTCGGGAAT-3′ R: 5′-GTGTGGACGATAGGTATGG-3 |
| MGF505-1R | F: ACGCACAGATAGAACAAT R: TGGCAACATAATGGCTTA |
| MGF505-2R | F: AGAGTGAACCTGATAGAT R: TAAGAAGTATGGATTACGATA |
| MGF505-3R | F: GGCTACTCAATTATCCTT R: GCTTCCACCATATTCTAT |
| MGF505-4R | F:AATATGGCAGTCTTATCTAA R:ATGGCGGTTAATAATAGGv |
| MGF505-5R | F:TGGAGAGGATATTCAAGT R:TAGATAATAAGGACACATTCA |
| MGF505-6R | F:GGATGTAACGATAATAGTCT R: CCAACAATAATAGTTCTTCAA |
| MGF505-7R | F:GAGGACTGAGAACTATAAC R: ATCACATTCAAGGCTTAA |
| MGF505-9R | F:TGCTATCAATCCATAAGG R:TGAATCAGTGGTAGAATC |
| MGF505-10R | F:AGGAGGTCTTCTTAACTT R:CACAGCATAGAGTAACAG |
| MGF505-11R | F:GCCAATAATCATCACAGA R: GTAATACACCGAATCAATG |
| B646L | F: CCGATCACATTACCTCTTATTAAAAACATTTCC R: GTGTCCCAACTAATATAAAATTCTCTTGCTC |
| tyrosine-protein kinase JAK1-like | F-GTTGCTAAGGTGTCAGATT R-CAGGTAATGTAGATTCAGGTT |
| signal transducer and activator of transcription STAT1-like | F-CCAAGTCATTCCAATAAGTAAT R-CTCTACATCAGCAATATCCA |
| Physella acuta IFN-induced, double-stranded RNA-activated kinase-like protein | F-AAGCAGAAGCCAGAGATG, R-ACCGATGTATATGAAGATAGTGTA |
| Long-Term Survival | MGF505 2R 11R Activation | B656L Expression | AV Activity | ||
|---|---|---|---|---|---|
| Long-term survival | Correlation Coefficient | 1 | 0.791 (**) | 1.000 (**) | −0.5 |
| Sig. (1-tailed) | . | 0.006 | . | 0.085 | |
| MGF505 2R 11R activation | Correlation Coefficient | 0.791 (**) | 1 | 0.791 (**) | −0.632 (*) |
| Sig. (1-tailed) | 0.006 | . | 0.006 | 0.034 | |
| B656L expression | Correlation Coefficient | 1.000 (**) | 0.791 (**) | 1 | −0.5 |
| Sig. (1-tailed) | . | 0.006 | . | 0.085 | |
| AV activity | Correlation Coefficient | −0.5 | −0.632 (*) | −0,5 | 1 |
| Sig. (1-tailed) | 0.085 | 0.034 | 0.085 | . |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hakobyan, S.; Bayramyan, N.; Karalyan, Z.; Izmailyan, R.; Avetisyan, A.; Poghosyan, A.; Arakelova, E.; Vardanyan, T.; Avagyan, H. The Involvement of MGF505 Genes in the Long-Term Persistence of the African Swine Fever Virus in Gastropods. Viruses 2025, 17, 824. https://doi.org/10.3390/v17060824
Hakobyan S, Bayramyan N, Karalyan Z, Izmailyan R, Avetisyan A, Poghosyan A, Arakelova E, Vardanyan T, Avagyan H. The Involvement of MGF505 Genes in the Long-Term Persistence of the African Swine Fever Virus in Gastropods. Viruses. 2025; 17(6):824. https://doi.org/10.3390/v17060824
Chicago/Turabian StyleHakobyan, Sona, Nane Bayramyan, Zaven Karalyan, Roza Izmailyan, Aida Avetisyan, Arpine Poghosyan, Elina Arakelova, Tigranuhi Vardanyan, and Hranush Avagyan. 2025. "The Involvement of MGF505 Genes in the Long-Term Persistence of the African Swine Fever Virus in Gastropods" Viruses 17, no. 6: 824. https://doi.org/10.3390/v17060824
APA StyleHakobyan, S., Bayramyan, N., Karalyan, Z., Izmailyan, R., Avetisyan, A., Poghosyan, A., Arakelova, E., Vardanyan, T., & Avagyan, H. (2025). The Involvement of MGF505 Genes in the Long-Term Persistence of the African Swine Fever Virus in Gastropods. Viruses, 17(6), 824. https://doi.org/10.3390/v17060824

