Efficacy of Different Combinations of Direct-Acting Antivirals Against Different Hepatitis C Virus-Infected Population Groups: An Experience in Tertiary Care Hospitals in West Bengal, India
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Treatment Regimens
2.3. Patient Follow-Up
2.4. Amplification of HCV Core Gene and Genotype Determination
2.5. Definitions of SVR, Treatment Relapse, and Non-Responders
2.6. Statistical Analysis
3. Results
3.1. Baseline Characteristics
3.2. Treatment Regime
3.3. DAA Treatment Response
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, H.C.; Lo, S.Y. Hepatitis C virus: Virology, diagnosis and treatment. World J. Hepatol. 2015, 7, 1377–1389. [Google Scholar] [CrossRef] [PubMed]
- Abhinav Anand, D.M.; Shalimar, D.M. Hepatitis C virus in India: Challenges and Successes. Clin. Liver Dis. 2021, 18, 150–154. [Google Scholar] [CrossRef] [PubMed]
- Borgia, S.M.; Hedskog, C.; Parhy, B.; Hyland, R.H.; Stamm, L.M.; Brainard, D.M.; Subramanian, M.G.; McHutchison, J.G.; Mo, H.; Svarovskaia, E.; et al. Identification of a novel hepatitis C virus genotype from Punjab, India: Expanding classification of hepatitis C virus into 8 genotypes. J. Infect. Dis. 2018, 218, 1722–1729. [Google Scholar] [CrossRef]
- Tsai, S.M.; Kao, J.T.; Tsai, Y.F. How hepatitis C patients manage the treatment process of pegylated interferon and ribavirin therapy: A qualitative study. BMC Health Serv. Res. 2016, 16, 247. [Google Scholar] [CrossRef]
- Wilby, K.J.; Partovi, N.; Ford, J.A.; Greanya, E.D.; Yoshida, E.M. Review of boceprevir and telaprevir for the treatment of chronic hepatitis C. Can. J. Gastroenterol. Hepatol. 2012, 26, 205–210. [Google Scholar] [CrossRef]
- Ghany, M.G.; Morgan, T.R. Hepatitis C Guidance 2019 Update: American Association for the Study of Liver Diseases–Infectious Diseases Society of America Recommendations for Testing, Managing, and Treating Hepatitis C Virus Infection. Hepatology 2020, 71, 686–721. [Google Scholar] [CrossRef]
- Venkatesh, S.R.K.D. Diagnosis & Management of Viral Hepatitis; Ministry of Health and Family Welfare, Government of India: New Delhi, India, 2018; Volume 1, pp. 1–80. [Google Scholar]
- Chakravarti, A.; Dogra, G.; Verma, V.; Srivastava, A.P. Distribution pattern of HCV genotypes & its association with viral load. Indian J. Med. Res. 2011, 133, 326–331. [Google Scholar]
- Shahnazarian, V.; Ramai, D.; Reddy, M.; Mohanty, S. Hepatitis C virus genotype 3: Clinical features, current and emerging viral inhibitors, future challenges. Ann. Gastroenterol. 2018, 31, 541–551. [Google Scholar] [CrossRef]
- Dutta, S.; Biswas, A.; Bakshi, S.; Choudhury, P.; Das, R.; Nath, S.; Chowdhury, P.; Bhattacharyya, M.; Chakraborty, S.; Dutta, S. Molecular Epidemiology of HCV Infection among Multi-Transfused β-Thalassemia Patients in Eastern India: A Six-Year Observation. Thalass. Rep. 2023, 13, 165–178. [Google Scholar] [CrossRef]
- Saha, K.; Firdaus, R.; Biswas, A.; Mukherjee, A.; Sadhukhan, P.C. A novel nested reverse-transcriptase polymerase chain reaction method for rapid hepatitis C virus detection and genotyping. Indian J. Med. Microbiol. 2014, 32, 130–136. [Google Scholar] [CrossRef]
- Saha, K.; Firdaus, R.; Santra, P.; Pal, J.; Roy, A.; Bhattacharya, M.K.; Chakrabarti, S.; Sadhukhan, P.C. Recent pattern of Co-infection amongst HIV seropositive individuals in tertiary care hospital, kolkata. Virol. J. 2011, 8, 116. [Google Scholar] [CrossRef] [PubMed]
- Pessôa, M.G.; Cheinquer, H.; Almeida, P.R.L.; Silva, G.F.; Lima, M.P.J.S.; Paraná, R.; Lacerda, M.A.; Parise, E.R.; Pernambuco, J.R.B.; Pedrosa, S.S.; et al. Re-treatment of previous non-responders and relapsers to interferon plus ribavirin with peginterferon alfa-2a (40KD), ribavirin ± amantadine in patients with chronic hepatitis C: Randomized multicenter clinical trial. Ann. Hepatol. 2012, 11, 52–61. [Google Scholar] [CrossRef] [PubMed]
- Brzdęk, M.; Zarębska-Michaluk, D.; Invernizzi, F.; Cilla, M.; Dobrowolska, K.; Flisiak, R. Decade of optimizing therapy with direct-acting antiviral drugs and the changing profile of patients with chronic hepatitis C. World J. Gastroenterol. 2023, 29, 949–966. [Google Scholar] [CrossRef]
- Saif-Al-Islam, M.; Mohamed, H.S.; Younis, M.A.; Abdelhamid, M.Y.; Ali, M.M.; Khalaf, S. Impact of Gender Difference on Characteristics and Outcome of Chronic Hepatitis C. Open J. Gastroenterol. 2020, 10, 281–294. [Google Scholar] [CrossRef]
- Xia, H.; Lu, C.; Wang, Y.; Zaongo, S.D.; Hu, Y.; Wu, Y.; Yan, Z.; Ma, P. Efficacy and Safety of Direct-Acting Antiviral Therapy in Patients With Chronic Hepatitis C Virus Infection: A Real-World Single-Center Experience in Tianjin, China. Front. Pharmacol. 2020, 11, 710. [Google Scholar] [CrossRef]
- Isfordink, C.J.; Van De Laar, T.J.W.; Rebers, S.P.H.; Wessels, E.; Molenkamp, R.; Knoester, M.; Baak, B.C.; van Nieuwkoop, C.; van Hoek, B.; Brakenhoff, S.M.; et al. Direct-Acting Antiviral Treatment for Hepatitis C Genotypes Uncommon in High-Income Countries: A Dutch Nationwide Cohort Study. Open Forum Infect. Dis. 2021, 8, ofab006. [Google Scholar] [CrossRef]
- Faiz, S.; Irfan, M.; Farooq, S.; Khan, I.A.; Iqbal, H.; Wahab, A.-T.; Shakeel, M.; Gong, P.; Thomas Iftner, M.; Choudhary, I. Study of drug resistance-associated genetic mutations, and phylo-genetic analysis of HCV in the Province of Sindh, Pakistan. Sci. Rep. 2023, 13, 12213. [Google Scholar] [CrossRef]
- Hashim, A.; Almahdi, F.; Albaba, E.A.; Barkia, O.; Alkasam, R.; Almahmoud, A.; Nabil, A.; Alsulaimani, A. Efficacy of DAAs in the treatment of chronic HCV: Real-world data from the private health-care sector of the Kingdom of Saudi Arabia. J. Epidemiol. Glob. Health 2020, 10, 178–183. [Google Scholar] [CrossRef]
- Han, Q.; Fan, X.; Wang, X.; Wang, Y.; Deng, H.; Zhang, X.; Zhang, K.; Li, N.; Liu, Z. High sustained virologic response rates of sofosbuvir-based regimens in Chinese patients with HCV genotype 3a infection in a real-world setting. Virol. J. 2019, 16, 74. [Google Scholar] [CrossRef]
- Hong, C.M.; Liu, C.H.; Su, T.H.; Yang, H.-C.; Chen, P.-J.; Chen, Y.-W.; Kao, J.-H.; Liu, C.-J. Real-world effectiveness of direct-acting antiviral agents for chronic hepatitis C in Taiwan: Real-world data. J. Microbiol. Immunol. Infect. 2020, 53, 569–577. [Google Scholar] [CrossRef]
- Maekawa, S.; Enomoto, N. The “real-world” efficacy and safety of DAAs for the treatment of HCV patients throughout Japan. J. Gastroenterol. 2018, 53, 1168–1169. [Google Scholar] [CrossRef] [PubMed]
- Isakov, V.; Hedskog, C.; Wertheim, J.O.; Hostager, R.E.; Parhy, B.; De Bernardi Schneider, A.; Suri, V.; Mo, H.; Geivandova, N.; Morozov, V.; et al. Prevalence of resistance-associated substitutions and phylogenetic analysis of hepatitis C virus infection in Russia. Int. J. Infect. Dis. 2021, 113, 36–42. [Google Scholar] [CrossRef] [PubMed]
- Hyppolito, E.B.; Ramos, A.N.; Teixeira, L.P.; Bezerra, A.M.; Mendes, L.A.; Silva, T.L.; de Castro Lima, J.M.; de Arruda, É.A.G.; Guerra, E.J.; Tavares, M.M.S.; et al. Effectiveness and Safety of Direct-Acting Antivirals in the Treatment of Chronic Hepatitis C: A Real-life Study in Northeastern Brazil. Rev. Soc. Bras. Med. Trop. 2024, 57, e00423-2024. [Google Scholar] [CrossRef] [PubMed]
- Coyer, L.; Njoya, O.; Njouom, R.; Mossus, T.; Kowo, M.P.; Essomba, F.; Boers, A.; Coutinho, R.; Ondoa, P.; the HEP C-IMPACT Team. Achieving a high cure rate with direct-acting antivirals for chronic Hepatitis C virus infection in Cameroon: A multi-clinic demonstration project. Trop. Med. Int. Health 2020, 25, 1098–1109. [Google Scholar] [CrossRef]
- Ibrahim Mohammed Ebid, A.H.; Ashraf Ahmed, O.; Hassan Agwa, S.; Mohamed Abdel-Motaleb, S.; Mohamed Elsawy, A.; Hagag, R.S. Safety, efficacy and cost of two direct-acting antiviral regimens: A comparative study in chronic hepatitis C Egyptian patients. J. Clin. Pharm. Ther. 2020, 45, 539–546. [Google Scholar] [CrossRef]
- Saeed, S.; Moodie, E.E.M.; Strumpf, E.; Gill, J.; Wong, A.; Cooper, C.; Walmsley, S.; Hull, M.; Martel-Laferriere, V.; Klein, M.B.; et al. Real-world impact of direct acting antiviral therapy on health-related quality of life in HIV/Hepatitis C co-infected individuals. J. Viral Hepat. 2018, 25, 1507–1514. [Google Scholar] [CrossRef]
- Höner zu Siederdissen, C.; Buggisch, P.; Böker, K.; Schott, E.; Klinker, H.; Pathil, A.; Pfeiffer-Vornkahl, H.; Berg, T.; Sarrazin, C.; Hüppe, D.; et al. Treatment of hepatitis C genotype 1 infection in Germany: Effectiveness and safety of antiviral treatment in a real-world setting. United Eur. Gastroenterol. J. 2018, 6, 213–224. [Google Scholar] [CrossRef]
- Macken, L.; Gelson, W.; Priest, M.; Abouda, G.; Barclay, S.; Fraser, A.; Healy, B.; Irving, W.; Verma, S. Efficacy of direct-acting antivirals: UK real-world data from a well-characterised predominantly cirrhotic HCV cohort. J. Med. Virol. 2019, 91, 1979–1988. [Google Scholar] [CrossRef]
- De Gennaro, N.; Diella, L.; Monno, L.; Angarano, G.; Milella, M.; Saracino, A. Efficacy and tolerability of DAAs in HCV-monoinfected and HCV/HIV-coinfected patients with psychiatric disorders. BMC Infect. Dis. 2020, 20, 196. [Google Scholar] [CrossRef]
- Patel, S.V.; Jayaweera, D.T.; Althoff, K.N.; Eron, J.J.; Radtchenko, J.; Mills, A.; Moyle, G.; Santiago, S.; Sax, P.E.; Gillman, J.; et al. Real-world efficacy of direct acting antiviral therapies in patients with HIV/HCV. PLoS ONE 2020, 15, e0228847. [Google Scholar] [CrossRef]
- Verna, E.C.; Morelli, G.; Terrault, N.A.; Lok, A.S.; Lim, J.K.; Di Bisceglie, A.M.; Zeuzem, S.; Landis, C.S.; Kwo, P.; Hassan, M.; et al. DAA therapy and long-term hepatic function in advanced/decompensated cirrhosis: Real-world experience from HCV-TARGET cohort. J. Hepatol. 2020, 73, 540–548. [Google Scholar] [CrossRef] [PubMed]
- Singh, V.; Goyal, S.; Gupta, T.; Aggarwal, H.K. Prediction of Cirrhosis in Patients with Chronic Hepatitis C by Genotype 3. Euroasian J. Hepato-Gastroenterol. 2020, 10, 7–10. [Google Scholar] [CrossRef] [PubMed]
- Dietz, J.; Susser, S.; Vermehren, J.; Peiffer, K.-H.; Grammatikos, G.; Berger, A.; Ferenci, P.; Buti, M.; Müllhaupt, B.; Hunyady, B.; et al. Patterns of Resistance-Associated Substitutions in Patients With Chronic HCV Infection Following Treatment With Direct-Acting Antivirals. Gastroenterology 2018, 154, 976–988.e4. [Google Scholar] [CrossRef] [PubMed]
- Di Stefano, M.; Ismail, M.H.; Leitner, T.; Adem, S.E.; Elamin, M.; Eltreifi, O.; Alwazzeh, M.; Fiore, J.R.; Santantonio, T.A. Genetic subtypes and natural resistance mutations in hcv genotype 4 infected saudi arabian patients. Viruses 2021, 13, 1832. [Google Scholar] [CrossRef]


| Primer Name | Primer Sequences (5′ to 3′) |
|---|---|
| CoF1 | ACTGCCTGATAGGGTGCTTGC |
| CoR1 | ATGTACCCCATGAGGTCGGC |
| CoF2 | AGGTCTCGTAGACCGTGCA |
| CoR2 | CACGTTAGGGTATCGATGAC |
| Total Population (N = 398) | SVR (n = 376) | Non-Responder (n = 22) | |
|---|---|---|---|
| Age (Years) (Mean ± SD) | 37.85 ± 18.76 | 37.85 ± 18.74 | 38.01 ± 18.06 |
| Age Group | |||
| 18–28 | 76 (19.09%) | 71 (93.42%) | 5 (6.58%) |
| 29–39 | 77 (19.34%) | 75 (97.40%) | 2 (2.60%) |
| 40–50 | 105 (26.38%) | 97 (92.38%) | 8 (7.62%) |
| 51–61 | 82 (20.60%) | 77 (93.90%) | 5 (6.1%) |
| 62–72 | 58 (14.57%) | 56 (96.55%) | 2 (3.45%) |
| Gender | |||
| Male | 237 (59.55%) | 221 (93.25%) | 16 (6.75%) |
| Female | 161 (35.45%) | 155 (96.27%) | 6 (3.73%) |
| High-Risk Group (HRG) populations | |||
| β-thalassemia | 112 (28.14%) | 106 (94.65%) | 6 (5.35%) |
| Chronic Kidney Disease | 72 (18.09%) | 69 (95.83%) | 3 (4.17%) |
| General population with compensated cirrhosis and decompensated cirrhosis | |||
| Compensated cirrhosis | 187 (46.98%) | 177 (94.65%) | 10 (5.34%) |
| Decompensated cirrhosis | 27 (6.78%) | 24 (88.89%) | 3 (11.11%) |
| Genotypes | |||
| Genotype 1a | 22 | 22 (100%) | 0 (0.00%) |
| Genotype 1b | 54 | 53 (98.15%) | 1 (1.85%) |
| Genotype 1c | 43 | 39 (90.7%) | 4 (9.3%) |
| Genotype 3a | 184 | 174 (94.56%) | 10 (5.43%) |
| Genotype 3b | 84 | 77 (91.66%) | 7 (8.34%) |
| Genotype 4a | 11 | 11 (100%) | 0 (0.00%) |
| DAA Therapy | |||
| With RIB | 85 (21.35%) | 83 (97.65%) | 2 (2.35%) |
| Without RIB | 313 (78.64%) | 293 (93.61%) | 20 (6.39%) |
| Clinical Markers | Patient Category | |||
|---|---|---|---|---|
| β-Thalassemia (n = 112) | Chronic Kidney Disease (n = 72) | Compensated Cirrhosis (n = 187) | Decompensated Cirrhosis (n = 27) | |
| Albumin (g/dL) | 4.05 (3.9–4.35) | 3.9 (3.9–4.1) | 3.65 (3.2–4.05) | 2.9 (2.7–3.2) |
| Globulin | 3 (2.9–3.3) | 3.1 (2.85–3.55) | 3.6 (3.2–4) | 3.9 (2.26–5.6) |
| SGOT (U/L) | 60 (55.25–67) | 34 (21.8–58.5) | 57.5 (44–91.75) | 71 (40–98) |
| SGPT (U/L) | 59 (44–74.5) | 43 (35.3–52.5) | 53 (32.7–72.5) | 39 (27–65.75) |
| Creatinine (mg/dL) | 0.7 (0.58–0.8) | 9.13 (6.95–14.01) | 0.85 (0.7–1) | 0.75 (0.63–0.89) |
| Hemoglobin (g/dL) | 6.35 (5.63–7.35) | 9.15 (8.1–10.7) | 11.3 (8.9–13.1) | 8.95 (7.9–10.43) |
| Total Protein | 7.15 (6.8–7.75) | 7.05 (6.8–7.28) | 7.4 (7–7.75) | 6.1 (5.7–7.18) |
| Bilirubin (Total) (mg/dL) | 1.55 (1.4–2.23) | 0.65 (0.58–0.92) | 1.2 (0.8–1.7) | 2 (1.01–3.28) |
| Urea (mg/dL) | 20.5 (18.75–22) | 134.3 (93.75–155.5) | 23 (19–29) | 17.4 (14.5–29.25) |
| ALP (U/L) | 237 (197.5–298.75) | 132.2 (123.25–172) | 125 (97.36–178) | 164.5 (107.5–197.25) |
| Combination of DAAs (N = 398) | Gen-1a (n = 22) | Gen-1b (n = 54) | Gen-1c (n = 43) | Gen-3a (n = 184) | Gen-3b (n = 84) | Gen-4a (n = 11) |
|---|---|---|---|---|---|---|
| SOF + DCV | 90.90% (n = 20) | 57.41% (n = 31) | 69.77% (n = 30) | 73.36% (n = 135) | 41.66% (n = 35) | NIL |
| SOF + DCV + RIB | 4.54% (n = 1) | 14.81% (n = 8) | 27.91% (n = 12) | 8.15% (n = 15) | 25% (n = 21) | 9.09% (n = 1) |
| SOF + VEL | 4.54% (n = 1) | 20.37% (n = 11) | 2.32% (n = 1) | 10.87% (n = 20) | 26.48% (n = 22) | 63.63% (n = 7) |
| SOF + VEL + RIB | NIL | 7.41% (n = 4) | NIL | 7.61% (n = 14) | 7.14% (n = 6) | 27.27% (n = 3) |
| Combination of DAAs (N = 398) | Patient Category (n = 398) | |||
|---|---|---|---|---|
| β-Thalassemia (n = 112) | Chronic Kidney Disease (n = 72) | Compensated Cirrhosis (n = 187) | Decompensated Cirrhosis (n = 27) | |
| SOF + DCV | 92 (82.14%) | 42 (58.33%) | 110 (58.82%) | 7 (25.92%) |
| SOF + DCV + RIB | 5 (4.46%) | 18 (25%) | 38 (20.32%) | 3 (11.11%) |
| SOF + VEL | 8 (7.14%) | 12 (16.66%) | 32 (17.11%) | 4 (14.81%) |
| SOF + VEL + RIB | 7 (6.25%) | NIL | 7 (3.74%) | 13 (48.15%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bakshi, S.; Chattopadhyay, P.; Ahammed, M.; Das, R.; Majumdar, M.; Dutta, S.; Nath, S.; Ghosh, A.; Bhattacharjee, U.; Baskey, U.; et al. Efficacy of Different Combinations of Direct-Acting Antivirals Against Different Hepatitis C Virus-Infected Population Groups: An Experience in Tertiary Care Hospitals in West Bengal, India. Viruses 2025, 17, 269. https://doi.org/10.3390/v17020269
Bakshi S, Chattopadhyay P, Ahammed M, Das R, Majumdar M, Dutta S, Nath S, Ghosh A, Bhattacharjee U, Baskey U, et al. Efficacy of Different Combinations of Direct-Acting Antivirals Against Different Hepatitis C Virus-Infected Population Groups: An Experience in Tertiary Care Hospitals in West Bengal, India. Viruses. 2025; 17(2):269. https://doi.org/10.3390/v17020269
Chicago/Turabian StyleBakshi, Sagnik, Partha Chattopadhyay, Mahiuddin Ahammed, Raina Das, Moumita Majumdar, Supradip Dutta, Shreyasi Nath, Anwesha Ghosh, Uttaran Bhattacharjee, Upasana Baskey, and et al. 2025. "Efficacy of Different Combinations of Direct-Acting Antivirals Against Different Hepatitis C Virus-Infected Population Groups: An Experience in Tertiary Care Hospitals in West Bengal, India" Viruses 17, no. 2: 269. https://doi.org/10.3390/v17020269
APA StyleBakshi, S., Chattopadhyay, P., Ahammed, M., Das, R., Majumdar, M., Dutta, S., Nath, S., Ghosh, A., Bhattacharjee, U., Baskey, U., & Sadhukhan, P. C. (2025). Efficacy of Different Combinations of Direct-Acting Antivirals Against Different Hepatitis C Virus-Infected Population Groups: An Experience in Tertiary Care Hospitals in West Bengal, India. Viruses, 17(2), 269. https://doi.org/10.3390/v17020269

