Next Article in Journal
Impact of COVID-19 on Ocular Surface Health: Infection Mechanisms, Immune Modulation, and Inflammatory Responses
Previous Article in Journal
Effect of Hepatitis E Virus on the Male Reproductive System: A Review of Current Evidence
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Verification of Differentially Expressed Genes Following DENV2 Infection in Aedes aegypti

1
The Key Laboratory of Environmental Pollution Monitoring and Disease Control, School of Public Health, Ministry of Education, Guizhou Medical University, Guiyang 550025, China
2
State Key Laboratory of Pathogen and Biosecurity, Beijing 100071, China
3
The Key and Characteristic Laboratory of Modern Pathogen Biology, College of Basic Medicine, Guizhou Medical University, Guiyang 550025, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Viruses 2025, 17(1), 67; https://doi.org/10.3390/v17010067
Submission received: 21 November 2024 / Revised: 2 January 2025 / Accepted: 3 January 2025 / Published: 6 January 2025
(This article belongs to the Section Invertebrate Viruses)

Abstract

The dengue virus (DENV) is primarily transmitted by Aedes aegypti. Investigating genes associated with mosquito susceptibility to DENV2 offers a theoretical foundation for targeted interventions to regulate or block viral replication and transmission within mosquitoes. Based on the transcriptomic analyses of the midgut and salivary glands from Aedes aegypti infected with DENV2, alongside analyses of Aag2 cell infections, 24 genes potentially related to the regulation of Aedes aegypti infection with DENV2 were selected. By establishing transient transfection and overexpression models of Aedes aegypti Aag2 cells, and mosquito target gene interference models, the difference in viral load before and after treatment was compared, and the effects of DEGs on viral replication were evaluated. After overexpressing 24 DEGs in Aag2 cells, 19 DEGs showed a significant difference in DENV2 RNA copies in the cell supernatant (p < 0.05). In adult mosquitoes, knocking down defensin-A, defensin-A-like, and SMCT1 respectively reduced the DENV2 RNA copies, while knocking down UGT2B1 and ND4 respectively increased the DENV2 RNA copies. In this study, to assess the role of genes related to DENV2 replication, and transient transfection and overexpression models in Aag2 cells and mosquito gene knockdown models were established, and five genes, defensin-A, defensin-A-like, SMCT1, UGT2B1, and ND4, were found to have an impact on the replication of DENV2, providing a reference basis for studying the complex mechanism of mosquito–virus interactions.

1. Introduction

The dengue virus (DENV) is a single-stranded, positive-sense RNA virus, which can be classified into four serotypes based on antigenic differences, with DENV2 being more prevalent and dangerous [1]. DENV causes a range of diseases, including dengue fever (DF), dengue hemorrhagic fever (DHF), and dengue shock syndrome (DSS) [2]. As one of the most significant mosquito-borne infectious diseases globally, DF predominantly affects tropical and subtropical regions, causing millions of infections annually and placing nearly half of the global population at risk due to its increasing incidence and infection rates [3,4]. DENV is primarily transmitted by Aedes aegypti. While vector-borne viruses often result in severe pathological symptoms in humans, they typically cause no or only mild pathological effects in mosquito vectors [5,6]. Nevertheless, mosquitoes infected with arboviruses activate innate immune responses, altering gene expression profiles and driving complex host–pathogen interactions.
After viral infection, mosquitoes modulate their basic physiological processes, particularly through innate immune responses and defense mechanisms [7,8,9]. These immune regulatory pathways primarily include RNA interference (RNAi), Toll, and JAK-STAT signaling [10,11,12]. Additional mechanisms involve microRNAs (miRNAs), type I lectin responses, the complement system, the PI3K/Akt pathway, autophagy, and apoptosis [13,14]. Together, these processes are essential for the replication and transmission of viruses within their natural life cycle. However, the key factors and regulatory mechanisms underlying mosquito infection remain poorly understood. Investigating genes involved in mosquito–virus interactions may offer valuable insights into how mosquitoes serve as highly efficient vectors for dengue fever. Moreover, such studies may uncover target genes capable of disrupting viral replication and transmission.
To investigate gene functions involved in mosquito–virus interactions, cell lines derived from mosquito hosts provide a valuable and simplified platform for studying insect biology and virology [15]. The Aag2 cell line, derived from Aedes aegypti embryos, has been shown to exhibit immune activity, with induced responses closely resembling those observed in individual Aedes aegypti mosquitoes [15,16,17,18,19,20]. Furthermore, the Aag2 cell line supports continuous viral replication, making it an ideal model for a variety of pathogen-related in vitro experiments [19,20,21,22,23,24]. Small interfering RNAs (siRNAs), which are double-stranded RNA molecules 20–25 nucleotides in length, play a critical role in gene silencing. Upon entering the cytoplasm of target cells, siRNAs form an RNA-induced silencing complex that degrades and silences mRNA, thereby suppressing target gene expression [25]. Techniques such as the construction of gene expression vectors, transfection methods, and RNA interference (RNAi) technology provide powerful tools for functional gene studies and target gene screening [26,27,28,29].
In this study, we analyzed the transcriptome sequencing data of the midgut and salivary glands of Aedes aegypti infected with DENV2 from the NCBI Sequence Read Archive (SRA) database (BioProject ID: PRJNA1197782) [30], as well as the transcriptome data of Aag2 cells infected with DENV2 [31], 24 genes potentially related to the regulation of Aedes aegypti infection with DENV2 were selected. By constructing transient transfection and overexpression models in Aag2 cells, along with gene knockdown models in mosquitoes, viral loads were compared before and after gene overexpression in Aag2 cells and gene knockdown in mosquitoes. This approach facilitated the screening and verification of the target gene’s replicative role in vector–virus interactions. These findings provide a theoretical foundation for the targeted regulation of mosquito-borne virus infections and transmission.

2. Materials and Methods

2.1. Virus, Cells, Plasmids and Mosquitoes

The DENV2 Guangdong strain was obtained from the Guangdong Provincial Centers for Disease Control and Prevention, China [32]. Aedes aegypti Aag2 cells were cultured in Schneider’s Drosophila Medium (SDM, Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Waltham, MA, USA), and incubated at 28 °C with 5% CO2 in a cell culture incubator. C6/36 cells were cultured in RPMI 1640 Medium (RPMI 1640, Gibco, Penrose, NZ) supplemented with 10% FBS and incubated at 27 °C with 5% CO2 in a cell culture incubator.
PSL1180polyUBdsRED was a gift from Leslie Vosshall (Addgene plasmid #49327; http://n2t.net/addgene:49327, accessed on 10 December 2024; RRID: Addgene_49327). Experimental and control plasmids were designed using SnapGene software, employing the double enzyme digestion method to avoid random cutting and reverse ligation. EGFP and puromycin sites were incorporated into the original vector, with EGFP serving as a control for the overexpression experimental vector (Figure 1a). The DsRed reporter gene was used to indicate the expression and localization of the target gene in cells. In the experimental plasmid, the EGFP sequence was replaced with the coding region of the gene of interest (Figure 1b). After designing the vector, Sangon Bio (Shanghai, China) Co., Ltd. was commissioned to synthesize it.
Figure 1. Plasmid vectors: (a) Control plasmid vector; (b) Experimental plasmid vector. In the plasmid vectors, the Pub promoter refers to the polyubiquitin promoter sequence from Aedes aegypti, which significantly enhances the long-term stability of gene expression. ZsGreen represents Enhanced Green Fluorescent Protein (EGFP), while DsRed indicates Red Fluorescent Protein. The CDS of DEGs represents the protein-coding sequences of the 24 selected differentially expressed genes (Table 1).
Figure 1. Plasmid vectors: (a) Control plasmid vector; (b) Experimental plasmid vector. In the plasmid vectors, the Pub promoter refers to the polyubiquitin promoter sequence from Aedes aegypti, which significantly enhances the long-term stability of gene expression. ZsGreen represents Enhanced Green Fluorescent Protein (EGFP), while DsRed indicates Red Fluorescent Protein. The CDS of DEGs represents the protein-coding sequences of the 24 selected differentially expressed genes (Table 1).
Viruses 17 00067 g001
The mosquitoes used in this study were Aedes aegypti of the Hainan Haikou strain, which were reared at the State Key Laboratory of Pathogen and Biosecurity. The rearing conditions were as follows: temperature 27 ± 1 °C, relative humidity 75 ± 5%, and a photoperiod of 14 h light and 10 h dark. After eclosion, adult female mosquitoes were fed a sucrose solution with concentrations ranging from 8% to 10%.

2.2. Differentially Expressed Genes (DEGs) Related to DENV2 Infection and Replication

In previous research, our laboratory conducted an in-depth analysis of the transcriptome data of Aag2 cells [31], as well as the midgut and salivary glands of Aedes aegypti (BioProject ID: PRJNA1197782) [30], using bioinformatics analysis methods, and identified differentially expressed genes (DEGs). On this basis, this study further selected 24 differentially expressed genes (DEGs) related to DENV infection from the salivary glands, midgut, and Aag2 cells of Aedes aegypti, using the criteria of at least one transcriptome with Padj < 0.05 and |Fold Change| > 1. And the DEGs were further investigated using the overexpression model.

2.3. Transfection

First, Aag2 cells were subcultured in a 12-well plate (Thermo Fisher Scientific, Waltham, MA, USA) using SDM containing 2% FBS at a density of 1 × 10⁵ cells/mL, with 1 mL/well. The cells were incubated for 3 days before performing the transfection experiments. FuGENE@6 Transfection Reagent (Promega, Madison, WI, USA) was used for transfection with the original PSL1180polyUBdsRED vector. To optimize the transfection system, four different ratios of transfection reagent (μL) to plasmid vector (μg) were tested (4:1, 6:1, 8:1, and 10:1), with the 8:1 ratio being the optimal condition. The optimal transfection system for each well of a 12-well plate was as follows: 1 μg plasmid, 8 μL transfection reagent, and Opti-MEM medium to a final volume of 50 μL. For the transfection procedure, the transfection reagent was added to Opti-MEM medium and incubated at room temperature for 5 min. The plasmid was then added, followed by a 15 min incubation at room temperature. This mixture was then applied to the cells, which were incubated for 24 h. After 24 h, red fluorescence expression was observed under a fluorescence microscope, and DENV2 infection was subsequently performed.

2.4. Preparation of DENV2 Suspension Using C6/36 Cells

C6/36 cells were cultured in 1640 medium supplemented with 10% FBS. When the cell density reaches 80–90% and the cells are in good condition, preparation of the DENV2 suspension can proceed. After removing the original medium from the T75 cell culture flask and retaining a small amount of liquid, add 1 mL of DENV2 suspension to each cell flask for mixing. Gently shake the culture flask to ensure the DENV2 suspension fully contacts the C6/36 cells. After thorough mixing, immediately place the culture flask in a 27 °C, 5% CO2 cell incubator. Shake it every 15 min and allow it to adsorb for 1 h. After adsorption is complete, add 12 mL of 1640 medium containing 2% FBS along the side wall of the cell bottle. Observe the cells under the microscope daily. When a large number of vacuoles appear in the cells and they begin to rupture, add FBS to the original medium to increase the concentration to 10%, and then collect the supernatant and centrifuge it at 2000 rpm at 4 °C for 10 min. Filter the supernatant using a 0.45 µm syringe filter, followed by a 0.2 µm syringe filter for the second filtration. Aliquot the filtered supernatant into 1.5 mL cryovials to constitute the viral suspension, and store it at −80 °C for future use.

2.5. Virus Infection

Because Aag2 cells are easily suspended, the traditional cell infection procedure was modified. The DENV2 suspension was diluted to the appropriate ratio based on the DENV2 titer to achieve a multiplicity of infection (MOI) of 0.1. This suspension was then directly added to the 12-well plate, and the cells were cultured further. Antibiotics were excluded from the entire procedure to prevent interference with the transfection process, and all steps were performed gently to avoid dislodging the Aag2 cells.
The experimental design included six groups, each with four biological replicates: the no treatment group (N, only Aag2 cells); the EGFP group (E, transfected with the control EGFP plasmid); the gene group (G, transfected with the experimental plasmid); the DENV2 group (D2, DENV2 infection of the N group); the EGFP + DENV2 group (ED2, DENV2 infection of the E group); and the gene + DENV2 group (GD2, DENV2 infection of the G group).

2.6. RT-qPCR Detection of Gene Expression

Samples were collected at 2-, 4-, and 6-days post-infection (dpi). Cell density was performed using the Bio-Rad TC20 Automatic Cell Counter (Bio-Rad, Hercules, CA, USA). The cells were then centrifuged at 2000 rpm for 5 min, and the supernatant was transferred to a new EP tube for virus detection. Cell samples were stored in Trizol, followed by RNA extraction for gene expression analysis. To ensure no residual genomic or plasmid DNA carried over into the RT-qPCR reaction, DNase treatment was applied to the extracted RNA. RT-qPCR detection was performed using TransScript® Green One-Step RT-qPCR Super Mix (Transgene, Beijing, China). The reaction conditions were as follows: 45 °C for 5 min; 94 °C for 30 s; 40 cycles of 94 °C for 5 s; and 60 °C for 30 s, followed by a dissociation stage. The primers used in RT-qPCR detection are listed in Table 2. Ribosomal protein S6 (RPS6, LOC5563590) was used as the reference gene, and relative expression levels were calculated using the 2−ΔΔCT method. The EGFP-transfected group was used as the control, and the data were expressed as fold change (FC) [33].

2.7. Detection of DENV2 RNA Copies in the Supernatant of Cells After Transfection

DENV2 RNA copies in the cell supernatant were detected using the DENV2 nucleic acid extraction-free detection kit (Suneye Biotechnology, Beijing, China). The reaction system consisted of the following components: 10 μL of 2× DENV2 amplification reaction solution; 1 μL of DENV2 primer and probe mixture; 0.5 μL of RT-qPCR enzyme mixture; 4 μL of cell supernatant; and nuclease-free water to a final volume of 20 μL. The reaction conditions were 50 °C for 10 min, 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s.

2.8. Thoracic Microinjection of Adult Female Mosquitoes

Based on the results of DENV2 RNA copies in the supernatant of cells after overexpression, select the target gene and synthesize siRNA for the target gene. Establish a gene interference model in mosquitoes to further study the impact of the gene on DENV2 replication in individual mosquitoes. The siRNAs of these genes were designed and synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. The siRNA sequences are listed in Table 3.
First, prepare the injection reagent. When establishing a mosquito gene interference model, simply mix the siRNA dry powder with PBS buffer at a certain ratio to achieve a siRNA concentration of 80 μM, and then proceed to test the interference effect. When further investigating the effect of genes on DENV2 replication in mosquitoes, siRNA dry powder needs to be diluted in PBS buffer, then mixed with the DENV2 suspension at a titer of 2.5 × 108 PFU/mL to achieve a final siRNA concentration of 80 μM and a viral titer of 5 × 107 PFU/mL. The siRNA–virus mixture was then prepared. Next, a borosilicate capillary glass tube (SUTTER, BF100-50-10) was pulled using a needle puller (SUTTER, MODEL P-1000) to create a microinjection needle. The injection reagent was loaded using a microsample loading gun (Eppendorf, 20 μL), and the needle was mounted on a microinjection pump (Eppendorf, FemtoJet 4i). After 3 to 5 days post-eclosion, female mosquitoes were anesthetized with cold by placing them on a metal bath set to 4 °C. Mosquitoes were injected one by one under a microscope, with an injection volume of 300 nL per mosquito. Mosquitoes injected with target gene siRNA were designated as the treatment group, while those injected with NC siRNA served as the control group. After interference, samples were collected for two consecutive days, with 15 whole mosquitoes collected from each group each day, and RNA was extracted for subsequent analysis.

2.9. Quantification of Target Gene Expression in Mosquitoes After siRNA Injection

Using the Trizol method to extract mosquito RNA. The expression levels of target genes in mosquitoes were detected using the HiScript II One Step RT-qPCR SYBR Green Kit. The reaction system consisted of the following components: 10 μL of 2× One-Step SYBR Green Mix, 1 μL of One Step SYBR Green Enzyme Mix, 0.4 μL of Forward Primer (10 μM), 0.4 μL of Reverse Primer (10 μM), 0.4 μL of ROX Reference Dye 1 (50×), 2 μL of RNA template (RNA concentration approximately 150 ng/μL), and double-distilled water to a final volume of 20 μL. The reaction conditions were as follows: 50 °C for 3 min, 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s, with a dissociation stage. Primer sequences are provided in Table 3.

2.10. Detection of DENV2 RNA Copies in Mosquitoes After siRNA Injection

The DENV2 RNA copies were detected following mosquito RNA extraction using the GoTaq® Probe 1-Step System Assay Kit (Promega, A6120). The reaction format was as follows: 10 μL of 2× GoTaq® qPCR Master Mix, 0.4 μL of Go Script™ RT Mix for 1-Step RT-qPCR (50X), 1 μL of Forward primer (5′-AAGGACTAGAGGTTAGAGGAGACCC-3′), 1 μL of Reverse primer (5′-CGTTCTGTGCCTGGAATGATG-3′), 1 μL of Hydrolysis probe (FAM-AACAGCATATTGACGCTGGGAGAGACCAGA-BHQ1), 2 μL of RNA template (RNA concentration approximately 150 ng/μL), and double-distilled water to a final volume of 20 μL. The reaction conditions were as follows: 45 °C for 15 min; 95 °C for 2 min; followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The reporter used was FAM, with no quencher.

2.11. Statistical Method

All data are presented as the means ± standard deviations (SDs). To compare mRNA expression levels, cell density, and viral copies between two groups, the Shapiro–Wilk test was first used to assess data normality, followed by the Brown–Forsythe test to evaluate the homogeneity of variances. If the data were normally distributed and variances were homogeneous, an unpaired t-test was performed. If variances were unequal, a Welch-corrected unpaired t-test was applied. For non-normally distributed data, the non-parametric Mann–Whitney test was used. A p-value of <0.05 was considered statistically significant. Data processing was performed using Microsoft Office Home and Student 2019, statistical analysis was carried out with IBM SPSS Statistics V27 software, and GraphPad Prism 8.4.2 was used for plotting.

3. Results

3.1. Constructed an Instantaneous Transfection and Overexpression Model of Aag2 Cells

In this study, based on the transcriptome analysis of the midgut and salivary glands of Aedes aegypti after infection with DENV2 (BioProject ID: PRJNA1197782) [30], as well as the transcriptome analysis of Aag2 cells infected with DENV2 [31], 24 genes potentially related to the regulation of Aedes aegypti infection by DENV2 were selected. To verify the role of DEGs in the replication of DENV2, a transient transfection and overexpression model of Aedes aegypti Aag2 cells was established.
Firstly, to determine the optimal transfection efficiency, a gradient of four transfection reagent-to-plasmid vector ratios (μL:μg) was tested: 4:1, 6:1, 8:1, and 10:1. Fluorescence analysis (Figure 2a) showed that transfection efficiency increased with the volume of transfection reagent. Although the 8:1 and 10:1 ratios yielded similar results, the 8:1 ratio was chosen as the optimal condition for subsequent experiments, as it minimized cytotoxic effects on the cells.
The experimental and control plasmids were overexpressed in Aag2 cells using transient transfection with an 8:1 transfection ratio to establish the overexpression model. To assess the success of plasmid transfection, fluorescence microscopy was used to observe the transfection effect of the control plasmid at 24 h intervals post-transfection. The results (Figure 2b) indicated that, although the transfection efficiency was slightly lower than the previous vector—PSL1180polyUBdsRED (Figure 2a), a clear transfection effect was still observed. To verify successful target gene overexpression, cell samples were collected at 2, 4, and 6 dpi for gene quantification. RPS6 was used as the internal reference gene, and relative gene expression levels were calculated using the fold change (log10FC). The results (Table 4) showed that, at 2, 4, and 6 dpi, the log10FC values of the G/E group and the GD2/ED2 group were all greater than zero, indicating successful overexpression of the target gene in Aag2 cells. (Where E denotes the EGFP group, transfected with the control EGFP plasmid; G denotes the gene group, transfected with the experimental plasmid; ED2 denotes the EGFP + DENV2 group, i.e., the DENV2-infected group E; and ED2 denotes the gene + DENV2 group, i.e., the DENV2-infected group G.)

3.2. The Change in DENV2 RNA Copies in Aag2 Cell Supernatants After Gene Overexpression

To assess the impact of target gene overexpression on viral replication, cells were transfected with the target gene for 24 h, followed by DENV2 infection. The DENV2 RNA copies in Aag2 cell supernatant were quantified at 2, 4, and 6 dpi. Statistical analysis revealed significant differences in DENV2 RNA copies between the GD2 and ED2 groups (p < 0.05) (Table 5). Specifically, 19 genes exhibited significant alterations in DENV2 RNA copies. Of these, six genes showed an increase in DENV2 RNA copies, with fold changes (FC) ranging from 1.083 to 1.574; nine genes demonstrated a decrease in DENV2 RNA copies, with FC values ranging from 0.657 to 0.919; and four genes exhibited an initial increase followed by a decrease in RNA copies, with FC values ranging from 0.551 to 1.244.
To avoid the impact of changes in cell growth rate on viral replication due to gene overexpression, DENV2 infection was conducted 24 h after overexpression of the target gene. Cell density was assessed at 2, 4, and 6 dpi. The 24 genes were divided into three experiments (Figure 3a–c). Statistical analysis comparing the GD2 group to the ED2 group revealed that the cell density of the LOC110680759, LOC5579095, LOC5574940, LOC5577084, LOC33307568, LOC5563674, LOC5577396, LOC5568698, and LOC5565694 groups decreased significantly, while the cell density of the LOC5571480 and LOC110675616 groups increased significantly. No statistically significant differences in cell density were observed for the remaining genes after overexpression.
After overexpression of the target gene in Aag2 cells, cell growth density may be affected, thereby influencing viral copy numbers. To eliminate the potential confounding effect of cell density, this study analyzed both cell density and viral copy number results together. Overexpression of LOC110680759, LOC5579095, LOC5574940, LOC5577084, LOC33307568, and LOC5563674 in cells resulted in a decrease in cell density but an increase in viral copies, indicating that the increase in viral replication is not attributable to changes in cell density. In contrast, overexpression of LOC5568698 led to a decrease in both cell density and viral copies, suggesting that the reduction in viral copies may be due to the diminished cell density, which in turn limited viral replication capacity. For LOC5565694, a decrease in cell density was observed at 4 dpi, although the change in viral copies was not statistically significant. Overexpression of LOC110675616 resulted in an increase in cell density, but no statistically significant change in viral copies was detected. LOC5571480 showed an initial increase followed by a decrease in viral copies, despite an overall increase in cell density. For the remaining genes, no significant differences in cell density were observed, though changes in viral copies were statistically significant. In summary, the overexpression of most genes did not influence viral replication through alterations in cell density, indicating that the statistically significant difference in viral copies in the cell supernatant after overexpression of the target gene in Aag2 cells is valid.

3.3. Establishment of a Gene Interference Model in Mosquitoes

To further investigate the effect of DEGs on DENV2 replication, eight genes that led to an increase in DENV2 RNA copies and six genes that resulted in a decrease in DENV2 RNA copies after overexpression were selected from the viral copy data (Table 5). These 14 genes were identified as potentially influential in viral replication. siRNA targeting each gene was designed (Table 3), and mosquito thoracic microinjection was used to introduce the siRNA into Aedes aegypti to inhibit target gene expression and establish a gene interference model. The results showed that, on days 1 and 2 post-interference, UGT2B1 was successfully knocked down, with statistically significant differences observed. Additionally, the expression levels of defensin-A, defensin-A-like, POMP, ND4, and SMCT1 were significantly reduced (Figure 4). Based on the changes in DENV2 RNA copies following target gene overexpression (Table 5), six genes—UGT2B1, defensin-A, defensin-A-like, POMP, ND4, and SMCT1—were selected. Subsequently, the siRNA of these six genes was mixed with DENV2 suspension and injected into Aedes aegypti through thoracic microinjection to further investigate their roles in DENV2 replication within the mosquito.

3.4. Changes in Target Gene Expression and DENV2 RNA Copies in Mosquitoes After siRNA Interference

Based on the changes in DENV2 RNA copies after the overexpression of target genes (Table 5) and the results from the mosquito interference model (Figure 4), the six genes UGT2B1, defensin-A, defensin-A-like, POMP, ND4, and SMCT1 were selected for further functional studies. The siRNAs targeting the six genes were mixed with DENV2 suspension and injected into Aedes aegypti through thoracic microinjection. Since the interference effect on day 3 post-injection was less effective than on the first two days, gene expression and viral copies were measured on days 1 and 2 post-injection using RT-qPCR.
First, RNA was extracted from mosquitoes injected with either target gene siRNA or NC siRNA, and the relative expression levels of the target genes were quantified using RT-qPCR. The results showed that, within 1–2 days post-injection, the expression of defensin-A, defensin-A-like, UGT2B1, POMP, ND4, and SMCT1 was significantly reduced, with statistically significant differences (Figure 5a–f).
Within 1–2 days post-injection, the DENV2 RNA copies in mosquitoes were detected by RT-qPCR, with results shown in Figure 5g–l. Knockdown of defensin-A, defensin-A-like, and SMCT1 led to a reduction in DENV2 RNA copies compared to the control group, with statistically significant differences (Figure 5g,h,l). Knockdown of UGT2B1 and ND4 resulted in an increase in DENV2 RNA copies compared to the control group, with statistically significant differences (Figure 5i,k). Knockdown of POMP did not result in a statistically significant difference in DENV2 RNA copies (Figure 5j).

4. Discussion

This study developed a gene overexpression model in Aag2 cells and employed thoracic microinjection techniques in female Aedes aegypti to knock down target genes, further investigating the replication roles of DENV2 susceptibility-related genes in Aedes aegypti. By conducting research at both the cellular and mosquito levels, genes that directly influence the replication of mosquito-borne viruses and modulate viral loads were identified, suggesting that these genes play a role in the regulatory mechanisms underlying mosquito-borne virus susceptibility.
This study integrates the results of viral copy measurements before and after gene overexpression in Aag2 cells with those from gene knockdown experiments in mosquitoes to facilitate the following discussion.
First, the overexpression of defensin family genes, including defensin-A and defensin-A-like, in Aag2 cells significantly increased DENV2 RNA copies, suggesting their involvement in DENV2 viral replication. Conversely, the knockdown of defensin-A and defensin-A-like in mosquitoes significantly reduced DENV2 RNA copies, further supporting their role in viral replication. These findings suggest that defensin-A and defensin-A-like may play important roles in the viral replication process. Previous research on Drosophila melanogaster provides insights into the innate immune responses of insects. Insects’ first line of defense against pathogens involves both cellular mechanisms and a series of antimicrobial peptides (AMPs), such as defensins and cecropins [34]. AMPs are key components of humoral immunity [35]. In Drosophila melanogaster, seven distinct AMP families have been identified, each showing varied specificity toward different microorganisms [36]. However, the AMPs in mosquitoes differ notably from those in fruit flies, with defensins and cecropins being predominant in mosquitoes [37]. In Aedes aegypti, defensins primarily target Gram-positive bacteria [38]. Recent studies, however, have highlighted that the defensin gene family also plays a role in the immune response to Chikungunya and Zika viruses in Aedes aegypti [39]. In contrast, our findings show that overexpression of defensin-A and defensin-A-like increases viral copies in Aag2 cells, while knockdown reduces viral copies in mosquitoes. This suggests that the defensin protein family may exhibit distinct roles in DENV2 replication.
Secondly, the overexpression of UGT2B1 in Aag2 cells resulted in a significant downregulation of DENV2 RNA copies, while knockdown of UGT2B1 in mosquitoes led to an increase in DENV2 RNA copies. Studies have shown that UGT2B1, along with esterases, is one of the most important non-P450 enzymes, playing a significant role in drug metabolism [40]. UGT is a major family of drug-metabolizing enzymes involved in glucuronidation and the subsequent elimination of drugs and small lipophilic molecules [41], making it one of the primary enzymes in drug metabolism. Glucuronidation serves as a major detoxification pathway for both endogenous and exogenous compounds and is increasingly recognized for its role in drug clearance and elimination [42].
Additionally, the overexpression of cytochrome P450 4c21 (CYP4c21) significantly downregulated DENV2 RNA copies. Cytochrome P450 enzymes are membrane-bound hemoproteins involved in the detoxification of xenobiotics, as well as cellular metabolism and homeostasis [43]. Significant progress has been made in understanding resistance mechanisms in mosquitoes based on cytochrome P450 [44]. Traditionally, it was believed that drug oxidation and conjugation mediated by UGT and P450 occurred independently. However, recent studies have shown functional cooperation between UGT and P450, facilitating drug metabolism. Increasing evidence suggests that interactions occur between UGT subtypes or between P450 and UGT, with UGT function being altered due to protein–protein interactions [45,46]. Based on the results of this study, it is hypothesized that both UGT and P450 enzymes may play roles in the metabolic processes during DENV2 replication in Aedes aegypti. However, their specific mechanisms and interactions warrant further investigation.
The overexpression of mitochondrial NADH dehydrogenase subunit 4 (ND4) in Aag2 cells significantly increased DENV2 RNA copies, while knockdown in mosquitoes resulted in a reduction in DENV2 RNA copies. NADH dehydrogenase is known to consist of subunits encoded by mitochondrial genes [47]. In fruit flies and other insects, the NADH dehydrogenase subunit gene family represents the largest family in the mitochondria. Mitochondrial DNA (mtDNA) has proven to be an effective genetic marker for determining gene flow within species and is frequently employed in population genetic studies. For instance, Paupy et al. [48] used mtDNA-ND4 to investigate genetic variation between Aedes aegypti populations from the Cameron Highlands and domesticated populations. However, no research has yet linked this gene to insect–virus interactions.
In this study, overexpression of proteasome maturation protein (POMP) in Aag2 cells significantly inhibited DENV2 replication, but no significant difference in DENV2 replication was observed in mosquitoes after knockdown. As a molecular chaperone, POMP is essential for the assembly of both standard proteasomes and immunoproteasomes. It mediates the connection between the 20S proteasome and the endoplasmic reticulum, facilitating key steps in the formation of the 20S core complex at the ER [49]. The role of POMP in the infection process of Aedes aegypti by DENV2 requires further investigation.
Studies have also identified two sodium-coupled monocarboxylate transporters (SMCT1 and SMCT2), which mediate the active transport of monocarboxylates, such as lactate and ketone bodies [50]. These metabolites play a crucial role in energy metabolism, serving not only as waste products of glucose or fatty acid metabolism but also as important energy sources [51,52,53]. SMCT1, a high-affinity transport protein, has been reported to be expressed in various tissues, including the colon, small intestine, kidneys, thyroid, and brain [54,55]. In this study, overexpression of SMCT1 in Aag2 cells significantly inhibited DENV2 replication, and knockdown of this gene in mosquitoes also reduced DENV2 replication. These results suggest that SMCT1 may play an important role in DENV2 replication in mosquitoes, although further investigation is required to confirm this hypothesis.
In summary, the findings of this study suggest that genes such as defensin-A, defensin-A-like, UGT2B1, cytochrome P450, and SMCT1 play a role in the process of DENV2 replication in Aedes aegypti. However, the precise mechanisms underlying their involvement require further investigation.

5. Conclusions

This study combines previous transcriptome data from the midgut and salivary glands of Aedes aegypti infected with DENV2 (BioProject ID: PRJNA1197782) [30], as well as transcriptome data from Aag2 cells of Aedes aegypti infected with DENV2 [31], to selected 24 genes, and further conducts functional analysis of these genes in Aag2 cells and Aedes aegypti Tables S1 and S2. The results revealed that the overexpression of genes such as defensin-A, UGT2B1, SMCT1, POMP, CYP4c21, M1Pi, TLR7, TBX6, CBS, Tret1, SLCO2A1, SLC22A8, GNBPB6, Kibra, and Pde9a in Aag2 cells also influenced virus replication in the mosquito vector. Similarly, knockdown of defensin-A, defensin-A-like, SMCT1, UGT2B1, and ND4 in mosquitoes affected viral replication and altered viral copies. These findings suggest that the genes listed above are involved in the infection and replication processes of DENV2. They represent potential target genes for further investigation into viral infection in mosquitoes. Additionally, this study provides valuable insights for targeting the regulation of mosquito-borne viral infections and transmission, offering a foundation for exploring the complex mechanisms of mosquito–pathogen interactions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v17010067/s1, Table S1. Differentially expressed genes in salivary glands and midgut of DENV-2-infected Aedes aegypti mosquitoes compared with DENV-2-uninfected Aedes aegypti. Mosquitoes; Table S2. Differentially expressed genes of Aag2 cell line from DENV-2-infected cells compared to uninfected cell.

Author Contributions

X.C.: data curation, formal analysis, visualization, and writing—original draft. X.Z.: investigation, data curation, and formal analysis. X.X.: investigation and data curation. B.L.: investigation and validation. T.Z.: investigation. H.Y.: investigation. D.X.: investigation. J.W.: data curation, project administration, supervision, and writing— review and editing. C.L.: data curation, project administration, supervision, and writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.

Acknowledgments

We would like to thank Manjin Li and Cejie Lan for providing transcriptomic data analysis and Xiaohui Liu for providing experimental experience.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rico-Hesse, R. Microevolution and virulence of dengue viruses. Adv. Virus Res. 2003, 59, 315–341. [Google Scholar] [PubMed]
  2. Khetarpal, N.; Khanna, I. Dengue Fever: Causes, Complications, and Vaccine Strategies. J. Immunol. Res. 2016, 2016, 6803098. [Google Scholar] [CrossRef] [Scilit]
  3. Brower, V. Vector-borne diseases and global warming: Are both on an upward swing? Scientists are still debating whether global warming will lead to a further spread of mosquitoes and the diseases they transmit. EMBO Rep. 2001, 2, 755–757. [Google Scholar] [CrossRef] [Scilit]
  4. Shepard, D.S.; Undurraga, E.A.; Halasa, Y.A.; Stanaway, J.D. The global economic burden of dengue: A systematic analysis. Lancet Infect. Dis. 2016, 16, 935–941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Weaver, S.C.; Barrett, A.D. Transmission cycles, host range, evolution and emergence of arboviral disease. Nat. Rev. Microbiol. 2004, 2, 789–801. [Google Scholar] [CrossRef] [Scilit]
  6. Patterson, J.; Sammon, M.; Garg, M. Dengue, Zika and Chikungunya: Emerging Arboviruses in the New World. West. J. Emerg. Med. 2016, 17, 671–679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Lambrechts, L.; Saleh, M.C. Manipulating Mosquito Tolerance for Arbovirus Control. Cell Host Microbe 2019, 26, 309–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Zárate, S.; Novella, I.S. Vesicular stomatitis virus evolution during alternation between persistent infection in insect cells and acute infection in mammalian cells is dominated by the persistence phase. J. Virol. 2004, 78, 12236–12242. [Google Scholar] [CrossRef] [Scilit]
  9. Sim, S.; Jupatanakul, N.; Dimopoulos, G. Mosquito immunity against arboviruses. Viruses 2014, 6, 4479–4504. [Google Scholar] [CrossRef] [Scilit]
  10. Sánchez-Vargas, I.; Scott, J.C.; Poole-Smith, B.K.; Franz, A.W.; Barbosa-Solomieu, V.; Wilusz, J.; Olson, K.E.; Blair, C.D. Dengue virus type 2 infections of Aedes aegypti are modulated by the mosquito’s RNA interference pathway. PLoS Pathog. 2009, 5, e1000299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Xi, Z.; Ramirez, J.L.; Dimopoulos, G. The Aedes aegypti toll pathway controls dengue virus infection. PLoS Pathog. 2008, 4, e1000098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Souza-Neto, J.A.; Sim, S.; Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proc. Natl. Acad. Sci. USA 2009, 106, 17841–17846. [Google Scholar] [CrossRef] [Scilit]
  13. Hillyer, J.F. Mosquito immunity. Adv. Exp. Med. Biol. 2010, 708, 218–238. [Google Scholar] [CrossRef] [Scilit]
  14. Kumar, A.; Srivastava, P.; Sirisena, P.; Dubey, S.K.; Kumar, R.; Shrinet, J.; Sunil, S. Mosquito Innate Immunity. Insects 2018, 9, 95. [Google Scholar] [CrossRef] [Scilit]
  15. Walker, T.; Jeffries, C.L.; Mansfield, K.L.; Johnson, N. Mosquito cell lines: History, isolation, availability and application to assess the threat of arboviral transmission in the United Kingdom. Parasites Vectors 2014, 7, 382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Grace, T.D. Establishment of a line of mosquito (Aedes aegypti L.) cells grown in vitro. Nature 1966, 211, 366–367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Peleg, J. Growth of arboviruses in monolayers from subcultured mosquito embryo cells. Virology 1968, 35, 617–619. [Google Scholar] [CrossRef] [Scilit]
  18. Peleg, J. Growth of arboviruses in primary tissue culture of Aedes aegypti embryos. Am. J. Trop. Med. Hyg. 1968, 17, 219–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Sim, S.; Dimopoulos, G. Dengue virus inhibits immune responses in Aedes aegypti cells. PLoS ONE 2010, 5, e10678. [Google Scholar] [CrossRef] [Scilit]
  20. Fallon, A.M.; Sun, D. Exploration of mosquito immunity using cells in culture. Insect Biochem. Mol. Biol. 2001, 31, 263–278. [Google Scholar] [CrossRef] [Scilit]
  21. Weger-Lucarelli, J.; Rückert, C.; Grubaugh, N.D.; Misencik, M.J.; Armstrong, P.M.; Stenglein, M.D.; Ebel, G.D.; Brackney, D.E. Adventitious viruses persistently infect three commonly used mosquito cell lines. Virology 2018, 521, 175–180. [Google Scholar] [CrossRef] [Scilit]
  22. Varjak, M.; Donald, C.L.; Mottram, T.J.; Sreenu, V.B.; Merits, A.; Maringer, K.; Schnettler, E.; Kohl, A. Characterization of the Zika virus induced small RNA response in Aedes aegypti cells. PLoS Neglected Trop. Dis. 2017, 11, e0006010. [Google Scholar] [CrossRef] [Scilit]
  23. Gao, Y.; Hernandez, V.P.; Fallon, A.M. Immunity proteins from mosquito cell lines include three defensin A isoforms from Aedes aegypti and a defensin D from Aedes albopictus. Insect Mol. Biol. 1999, 8, 311–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Barletta, A.B.; Silva, M.C.; Sorgine, M.H. Validation of Aedes aegypti Aag-2 cells as a model for insect immune studies. Parasites Vectors 2012, 5, 148. [Google Scholar] [CrossRef] [Scilit]
  25. Jin, J.; Zhang, H.; Lu, Q.; Tian, L.; Yao, S.; Lai, F.; Liang, Y.; Liu, C.; Lu, Y.; Tian, S.; et al. Nanocarrier-mediated siRNA delivery: A new approach for the treatment of traumatic brain injury-related Alzheimer’s disease. Neural Regen. Res. 2025, 20, 2538–2555. [Google Scholar] [CrossRef] [Scilit]
  26. Whitten, M.M. Novel RNAi delivery systems in the control of medical and veterinary pests. Curr. Opin. Insect Sci. 2019, 34, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Cao, M.; Gatehouse, J.A.; Fitches, E.C. A Systematic Study of RNAi Effects and dsRNA Stability in Tribolium castaneum and Acyrthosiphon pisum, Following Injection and Ingestion of Analogous dsRNAs. Int. J. Mol. Sci. 2018, 19, 10798. [Google Scholar] [CrossRef] [Scilit]
  28. Cruz, C.; Tayler, A.; Whyard, S. RNA Interference-Mediated Knockdown of Male Fertility Genes in the Queensland Fruit Fly Bactrocera tryoni (Diptera: Tephritidae). Insects 2018, 9, 96. [Google Scholar] [CrossRef] [Scilit]
  29. Monte, E. The sophisticated evolution of Trichoderma to control insect pests. Proc. Natl. Acad. Sci. USA 2023, 120, e2301971120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. State Key Laboratory of Pathogen and Biosecurity, Functional Verification of Related Genes Susceptible to DENV2 in Aedes Aegypti [BioProject ID: PRJNA1197782]. National Center for Biotechnology Information. 2024. Available online: https://www.ncbi.nlm.nih.gov/sra/?term=PRJNA1197782 (accessed on 31 December 2024).
  31. Li, M.J.; Lan, C.J.; Gao, H.T.; Xing, D.; Gu, Z.Y.; Su, D.; Zhao, T.Y.; Yang, H.Y.; Li, C.X. Transcriptome analysis of Aedes aegypti Aag2 cells in response to dengue virus-2 infection. Parasites Vectors 2020, 13, 421. [Google Scholar] [CrossRef] [Scilit]
  32. Oliveira, F.A.A.; Buri, M.V.; Rodriguez, B.L.; Costa-da-Silva, A.L.; Araújo, H.R.C.; Capurro, M.L.; Lu, S.; Tanaka, A.S. The first characterization of a cystatin and a cathepsin L-like peptidase from Aedes aegypti and their possible role in DENV infection by the modulation of apoptosis. Int. J. Biol. Macromol. 2020, 146, 141–149. [Google Scholar] [CrossRef] [Scilit]
  33. Bubner, B.; Gase, K.; Baldwin, I.T. Two-fold differences are the detection limit for determining transgene copy numbers in plants by real-time PCR. BMC Biotechnol. 2004, 4, 14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Dhananjeyan, K.J.; Sivaperumal, R.; Paramasivan, R.; Thenmozhi, V.; Tyagi, B.K. In-silico homology modeling of three isoforms of insect defensins from the dengue vector mosquito, Aedes aegypti (Linn., 1762). J. Mol. Model. 2009, 15, 507–514. [Google Scholar] [CrossRef] [Scilit]
  35. Kokoza, V.; Ahmed, A.; Woon Shin, S.; Okafor, N.; Zou, Z.; Raikhel, A.S. Blocking of Plasmodium transmission by cooperative action of Cecropin A and Defensin A in transgenic Aedes aegypti mosquitoes. Proc. Natl. Acad. Sci. USA 2010, 107, 8111–8116. [Google Scholar] [CrossRef] [Scilit]
  36. Lemaitre, B.; Hoffmann, J. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 2007, 25, 697–743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Waterhouse, R.M.; Kriventseva, E.V.; Meister, S.; Xi, Z.; Alvarez, K.S.; Bartholomay, L.C.; Barillas-Mury, C.; Bian, G.; Blandin, S.; Christensen, B.M.; et al. Evolutionary dynamics of immune-related genes and pathways in disease-vector mosquitoes. Science 2007, 316, 1738–1743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Lowenberger, C.; Bulet, P.; Charlet, M.; Hetru, C.; Hodgeman, B.; Christensen, B.M.; Hoffmann, J.A. Insect immunity: Isolation of three novel inducible antibacterial defensins from the vector mosquito, Aedes aegypti. Insect Biochem. Mol. Biol. 1995, 25, 867–873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Zhao, L.; Alto, B.W.; Smartt, C.T.; Shin, D. Transcription Profiling for Defensins of Aedes aegypti (Diptera: Culicidae) During Development and in Response to Infection with Chikungunya and Zika Viruses. J. Med. Entomol. 2018, 55, 78–89. [Google Scholar] [CrossRef] [Scilit]
  40. Oda, S.; Fukami, T.; Yokoi, T.; Nakajima, M. A comprehensive review of UDP-glucuronosyltransferase and esterases for drug development. Drug Metab. Pharmacokinet. 2015, 30, 30–51. [Google Scholar] [CrossRef] [Scilit]
  41. Miyauchi, Y.; Kurita, A.; Yamashita, R.; Takamatsu, T.; Ikushiro, S.; Mackenzie, P.I.; Tanaka, Y.; Ishii, Y. Hetero-oligomer formation of mouse UDP-glucuronosyltransferase (UGT) 2b1 and 1a1 results in the gain of glucuronidation activity towards morphine, an activity which is absent in homo-oligomers of either UGT. Biochem. Biophys. Res. Commun. 2020, 525, 348–353. [Google Scholar] [CrossRef] [Scilit]
  42. Williams, J.A.; Hyland, R.; Jones, B.C.; Smith, D.A.; Hurst, S.; Goosen, T.C.; Peterkin, V.; Koup, J.R.; Ball, S.E. Drug-drug interactions for UDP-glucuronosyltransferase substrates: A pharmacokinetic explanation for typically observed low exposure (AUCi/AUC) ratios. Drug Metab. Dispos. Biol. Fate Chem. 2004, 32, 1201–1208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Manikandan, P.; Nagini, S. Cytochrome P450 Structure, Function and Clinical Significance: A Review. Curr. Drug Targets 2018, 19, 38–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Vontas, J.; Katsavou, E.; Mavridis, K. Cytochrome P450-based metabolic insecticide resistance in Anopheles and Aedes mosquito vectors: Muddying the waters. Pestic. Biochem. Physiol. 2020, 170, 104666. [Google Scholar] [CrossRef] [Scilit]
  45. Ishii, Y.; Takeda, S.; Yamada, H. Modulation of UDP-glucuronosyltransferase activity by protein-protein association. Drug Metab. Rev. 2010, 42, 145–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Baumgartner, R.; Poernbacher, I.; Buser, N.; Hafen, E.; Stocker, H. The WW domain protein Kibra acts upstream of Hippo in Drosophila. Dev. Cell 2010, 18, 309–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Hatefi, Y.; Ragan, C.I.; Galante, Y.M. The Enzymes and the Enzyme Complexes of the Mitochondrial Oxidative Phosphorylation System. In The Enzymes of Biological Membranes: Volume 4 Bioenergetics of Electron and Proton Transport; Martonosi, A.N., Ed.; Springer: Boston, MA, USA, 1985; pp. 1–70. [Google Scholar]
  48. Paupy, C.; Brengues, C.; Kamgang, B.; Hervé, J.P.; Fontenille, D.; Simard, F. Gene flow between domestic and sylvan populations of Aedes aegypti (Diptera: Culicidae) in North Cameroon. J. Med. Entomol. 2008, 45, 391–400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Fricke, B.; Heink, S.; Steffen, J.; Kloetzel, P.M.; Krüger, E. The proteasome maturation protein POMP facilitates major steps of 20S proteasome formation at the endoplasmic reticulum. EMBO Rep. 2007, 8, 1170–1175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Martin, P.M.; Dun, Y.; Mysona, B.; Ananth, S.; Roon, P.; Smith, S.B.; Ganapathy, V. Expression of the sodium-coupled monocarboxylate transporters SMCT1 (SLC5A8) and SMCT2 (SLC5A12) in retina. Investig. Ophthalmol. Vis. Sci. 2007, 48, 3356–3363. [Google Scholar] [CrossRef] [Scilit]
  51. Guder, W.G.; Wagner, S.; Wirthensohn, G. Metabolic fuels along the nephron: Pathways and intracellular mechanisms of interaction. Kidney Int. 1986, 29, 41–45. [Google Scholar] [CrossRef] [Scilit]
  52. Gerich, J.E.; Meyer, C.; Woerle, H.J.; Stumvoll, M. Renal gluconeogenesis: Its importance in human glucose homeostasis. Diabetes Care 2001, 24, 382–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Ross, B.D.; Espinal, J.; Silva, P. Glucose metabolism in renal tubular function. Kidney Int. 1986, 29, 54–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Ganapathy, V.; Gopal, E.; Miyauchi, S.; Prasad, P.D. Biological functions of SLC5A8, a candidate tumour suppressor. Biochem. Soc. Trans. 2005, 33, 237–240. [Google Scholar] [CrossRef] [Scilit]
  55. Gupta, N.; Martin, P.M.; Prasad, P.D.; Ganapathy, V. SLC5A8 (SMCT1)-mediated transport of butyrate forms the basis for the tumor suppressive function of the transporter. Life Sci. 2006, 78, 2419–2425. [Google Scholar] [CrossRef] [Scilit]
Figure 2. Schematic of fluorescence detection: (a) Schematic of fluorescence detection for the optimized transfection ratio. DsRed represents the Red Fluorescent Protein on the plasmid. Observing red fluorescence indicates that the plasmid has been successfully transfected into the cells; (b) Schematic of fluorescence detection for control plasmid overexpression. EGFP represents the Enhanced Green Fluorescent Protein, and DsRed represents the Red Fluorescent Protein on the plasmid. Observing red and green fluorescence indicates that the plasmid has been successfully transfected into the cells.
Figure 2. Schematic of fluorescence detection: (a) Schematic of fluorescence detection for the optimized transfection ratio. DsRed represents the Red Fluorescent Protein on the plasmid. Observing red fluorescence indicates that the plasmid has been successfully transfected into the cells; (b) Schematic of fluorescence detection for control plasmid overexpression. EGFP represents the Enhanced Green Fluorescent Protein, and DsRed represents the Red Fluorescent Protein on the plasmid. Observing red and green fluorescence indicates that the plasmid has been successfully transfected into the cells.
Viruses 17 00067 g002
Figure 3. Aag2 cell density: (a) Cell density of the first experiment; (b) Cell density of the second experiment; (c) Cell density of the third experiment. p values are indicated as follows: p < 0.05 (∗).
Figure 3. Aag2 cell density: (a) Cell density of the first experiment; (b) Cell density of the second experiment; (c) Cell density of the third experiment. p values are indicated as follows: p < 0.05 (∗).
Viruses 17 00067 g003
Figure 4. Assessment of the knockdown efficiency of genes in Aedes aegypti: (a) The knockdown effect of 14 genes was assessed on day 1 post-interference. (b) The knockdown effect of 12 genes was assessed on day 1 post-interference. Columns of the same color indicate the experimental group, and the other, the negative control group. NC denotes the negative control. p values are indicated as follows: p < 0.05 (∗).
Figure 4. Assessment of the knockdown efficiency of genes in Aedes aegypti: (a) The knockdown effect of 14 genes was assessed on day 1 post-interference. (b) The knockdown effect of 12 genes was assessed on day 1 post-interference. Columns of the same color indicate the experimental group, and the other, the negative control group. NC denotes the negative control. p values are indicated as follows: p < 0.05 (∗).
Viruses 17 00067 g004
Figure 5. Assessment of the knockdown efficiency of genes (left) and comparison of DENV2 RNA copies (right) in Aedes aegypti: (af) Knockdown efficiency of six genes associated with DENV2 infection and replication in Aedes aegypti (left); (gl) DENV2 RNA copies in Aedes aegypti before and after six genes knockdown (right). p values are indicated as follows: p < 0.05 (∗), p < 0.01 (∗∗), p < 0.001 (∗∗∗), p < 0.0001 (∗∗∗∗).
Figure 5. Assessment of the knockdown efficiency of genes (left) and comparison of DENV2 RNA copies (right) in Aedes aegypti: (af) Knockdown efficiency of six genes associated with DENV2 infection and replication in Aedes aegypti (left); (gl) DENV2 RNA copies in Aedes aegypti before and after six genes knockdown (right). p values are indicated as follows: p < 0.05 (∗), p < 0.01 (∗∗), p < 0.001 (∗∗∗), p < 0.0001 (∗∗∗∗).
Viruses 17 00067 g005
Table 1. Information on the 24 DENV2-infected DEGs for further overexpressed.
Table 1. Information on the 24 DENV2-infected DEGs for further overexpressed.
No.Vectorbase IDGene IDGene DescriptionMosquito
Salivary Glands
Mosquito
Midgut
Aag2 Cell
log2FCpadjlog2FCpadjlog2FCpadj
1AAEL003841LOC110680759defensin-A0.4020.8712.9920.003--
2AAEL003857LOC5579095defensin-A-like1.4200.0072.3480.000--
3AAEL007268LOC5568968protein kibra2.4790.0133.2990.000--
4AAEL011559LOC5574940zinc metalloproteinase nas-143.9510.0305.9690.000--
5AAEL009630LOC5572215Pde9a/high affinity cGMP-specific 3′,5′-cyclic phosphodiesterase 9A2.2760.0002.4850.000--
6AAEL021099LOC5571480SLCO2A1/solute carrier organic anion transporter family member 2A10.7000.8582.5010.004--
7AAEL012981LOC5577084SLC22A8/solute carrier family 22 member 81.5160.6412.4420.003--
8AAEL018680LOC33307568ND4/NADH dehydrogenase subunit 41.1370.0862.0060.021--
9AAEL000556LOC5563674perlucin7.3100.045−1.2211.000--
10AAEL003163LOC5577396protein fork head3.4240.0003.9820.008--
11AAEL011900LOC5575526beta-1,4-glucuronyltransferase2.8210.0022.2170.001--
12AAEL023898LOC110675616mucin-5AC-like2.2950.0012.4580.000--
13AAEL007064LOC5568698GNBPB6/beta-1,3-glucan-binding protein4.0590.0151.3580.542--
14AAEL004923LOC5565694neuronal acetylcholine receptor subunit beta-32.4990.000−0.4551.000--
15AAEL017136LOC23687556CYP4c21/cytochrome P450 4c212.0340.0013.4041.000--
16AAEL001835LOC5572450SMCT1/sodium-coupled monocarboxylate transporter 11.0320.6862.5440.000--
17AAEL014246LOC5563937UGT2B1/UDP-glucuronosyltransferase 2B1----2.1640.000
18AAEL008467LOC5570649CBS/cystathionine beta-synthase----2.1030.000
19AAEL004174LOC5564263TBX6 T-box transcription factor----1.6900.000
20AAEL014555LOC5564671POMP proteasome maturation protein----1.3890.009
21AAEL002721LOC5575760PEM/protein extra macrochaetae----1.2530.000
22AAEL013828LOC5578712M1PI/ethylthioribose-1-phosphate isomerase----1.1980.000
23AAEL014972LOC5565788Tret1/facilitated trehalose transporter Tret1----1.1820.000
24AAEL002583LOC5575353TLR7 toll-like receptor 7----1.1750.000
Note: VectorBase ID is the number used to identify a gene in the VectorBase database; Gene ID originates from NCBI’s Entrez Gene database, which is the unique numerical identifier assigned by NCBI for each gene. In the adjusted p-value column, a value of 0.000 indicates p < 0.001, and the difference is statistically significant.
Table 2. Primers for the 24 overexpressed genes related to DENV2 infection and replication.
Table 2. Primers for the 24 overexpressed genes related to DENV2 infection and replication.
No.Gene IDForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Length (bp)
1LOC110680759CGCACTTTACGCTTTCGAGAGAGCCAGGAAACAAATGACA138
2LOC5579095GAAGCTCGCCCTTTTGCCCACAAGCACTATCACCAACGC136
3LOC5568968TGATCATATTAACAAGAAGACCACCGATCTGAGGGTCATAGC128
4LOC5574940CCACGCCAAACTGATTCGAGAAAGACCTCGATTACGACCT148
5LOC5572215CCGGTGTAATACTGAATCAACCATACGTCCAAGCTGTAGGCTC116
6LOC5571480TCGACGAAAAGGATAAAACCGTTTTACCCCACACCAAGCA126
7LOC5577084TTGATCAACGTTTTCGAGCTGTCATTATAACGCCTCCCGCTGT91
8LOC33307568AGGCTTTAATTGCTTATTCTTCGAGCCAAACAAAATAACCCAG143
9LOC5563674TGTGGTCAACAGCGAAGCAACGGTTTTCCATTGGCGAT148
10LOC5577396TTCTGGACTTTGCATCCCGACTCCGGACTCGTTGCATCCAT146
11LOC5575526TACCAGAGAGTCATTTAGTTCGTCCTCGACACGTTGAAGTACGG148
12LOC110675616TGAATCGAAACCCAATCGGACATCGGAAGTCCAACGAAGCAC148
13LOC5568698GTCACGTGGCAATCGAAACCCACATTCGGGTTGTCTCCGA94
14LOC5565694ATATTGACGGTTTTCATCAAGCAGGCTCAACTTCCAAACCAGT146
15LOC23687556TGGATATCAACAATAATCCGAATTCCGATAATCGCTGGTCA136
16LOC5572450CATGACTGTGATCCCGTCTCACAAACAATCCCGGTAGGC111
17LOC5563937ACTTCCCGAACATCACCGAGACTCCACCACCAGAGCCACCATATCTA249
18LOC5570649CGGAGAAGATGTCCAACGAGAAGGCGCCAAAGGATTGCCCGAGTT185
19LOC5564263GGACGAAAACTACTGCGTGCGGTACATCCGTTGGGGACTC122
20LOC5564671CGGAACTGAACTACGAACAACACCTGGACGGCAGGAACGGCATA141
21LOC5575760GTTCATGCCGAAGAACCGCAGGCCTGAACGGGATCAAAA128
22LOC5578712GCAATACTGGATCACTGGCGACTGCTCCAACAACTACTGCCGCTACTC237
23LOC5565788GAGGTACGAGGAACACTTGGACTGAGGAACATCAGCAACAGGAATGGT149
24LOC5575353CCGTACCGAGGCAACAACTATACCGCTGCGGAAGCTCCACCATT190
25RPS6CGTCGTCAGGAACGTATCCTTCTTGGCAGCCTTAGCAG119
Table 3. siRNA sequence.
Table 3. siRNA sequence.
No.Gene IDSense Strand (5′-3′)Antisense Strand (5′-3′)
1LOC33307568GCUACUUGUUUAUUUAUAATTUUAUAAAUAAACAAGUAGCTT
2LOC110680759CGAUUAUCACAUCAUUCAATTUUGAAUGAUGUGAUAAUCGTT
3LOC5564671CGGUCAUGUUGCUCCACUATTUAGUGGAGCAACAUGACCGTT
4LOC5572450GACAGACUAUGGUUCAAUATTUAUUGAACCAUAGUCUGUCTT
5LOC5579095GCUACUGCAACUCCAAGAATTUUCUUGGAGUUGCAGUAGCTT
6LOC5563937CGAGUAACGUACUGAUCAATTUUGAUCAGUACGUUACUCGTT
7LOC5575353GAUCCUGUUCGAAAGUCAATTUUGACUUUCGAACAGGAUCTT
8LOC5564263AGUUGAAGAUCGACCACAATTUUGUGGUCGAUCUUCAACUTT
9LOC5571480GCGGAGAUCUCAAGAUCUATTUAGAUCUUGAGAUCUCCGCTT
10LOC5574940GGAUCAUGUUAGACCGGAATTUUCCGGUCUAACAUGAUCCTT
11LOC5572215GGAAGAAAGAGAAGAUUAATTUUAAUCUUCUCUUUCUUCCTT
12LOC5570649CGAAGAAUCUCCAGAUGAATTUUCAUCUGGAGAUUCUUCGTT
13LOC5578712CCAAGUACAUAGAUGUUAATTUUAACAUCUAUGUACUUGGTT
14LOC5565788GGAAGAUGCUGUUGUACAUTTAUGUACAACAGCAUCUUCCTT
15NCUUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT
Note: NC denotes the negative control.
Table 4. The relative expression levels of 24 genes (log10FC).
Table 4. The relative expression levels of 24 genes (log10FC).
No.Gene ID2 dpi4 dpi6 dpi
G/EGD2/ED2G/EGD2/ED2G/EGD2/ED2
1LOC1106807596.275.924.725.254.704.04
2LOC55790954.013.813.703.685.682.79
3LOC55689683.493.492.412.312.212.11
4LOC55749404.434.414.873.775.172.63
5LOC55722154.624.534.353.275.642.80
6LOC55714804.314.044.793.405.112.85
7LOC55770844.444.644.463.684.813.25
8LOC333075682.612.551.211.281.650.97
9LOC55636744.053.593.163.333.142.46
10LOC55773962.141.292.101.071.190.67
11LOC55755263.972.033.774.063.172.35
12LOC1106756163.922.634.133.903.673.22
13LOC55686985.045.593.953.494.603.27
14LOC55656944.055.543.613.383.943.05
15LOC236875565.195.103.443.884.413.80
16LOC55724503.636.323.652.824.742.28
17LOC55639371.871.891.391.191.030.96
18LOC55706491.230.990.730.520.290.34
19LOC55642633.443.052.492.622.852.38
20LOC55646712.772.752.362.082.001.95
21LOC55757602.892.812.412.342.382.16
22LOC55787122.452.382.052.051.881.70
23LOC55657883.353.303.032.983.312.40
24LOC55753534.273.883.083.383.662.96
Note: G/E represents the relative expression of Group G compared to Group E; GD2/ED2 represents the relative expression of Group GD2 compared to Group ED2.
Table 5. Statistical analysis of DENV2 RNA copies after the target gene is overexpressed.
Table 5. Statistical analysis of DENV2 RNA copies after the target gene is overexpressed.
Gene ID2 dpi4 dpi6 dpi
p ValueFCp ValueFCp ValueFC
LOC1106807590.0531.1980.0181.4280.1121.072
LOC55790950.0021.3150.0121.5520.4451.032
LOC55689680.0061.2040.3231.1830.0070.724
LOC55749400.0071.2270.0391.4450.7721.017
LOC55722150.0401.0830.0281.3890.2090.916
LOC55714800.0141.2440.9780.9950.0010.551
LOC55770840.0001.3240.1381.3680.6720.979
LOC333075680.0001.3450.0051.5740.8921.006
LOC55636740.9590.9990.5960.9440.3031.095
LOC55773960.8010.9910.1261.1400.4451.046
LOC55755260.8891.0040.5241.092--
LOC1106756160.3410.9710.2650.9080.8950.991
LOC55686980.3770.9770.0150.7900.1090.852
LOC55656940.9021.0060.4651.0420.4091.053
LOC236875560.8550.9950.0060.6570.1861.045
LOC55724500.4191.0430.0180.6680.5411.071
LOC55639370.8130.9910.7750.9860.0080.893
LOC55706490.6211.0210.6721.0160.0330.884
LOC55642630.0481.1260.5051.0230.0010.837
LOC55646710.2601.0790.0140.8870.0950.942
LOC55757600.1781.0570.0860.9290.0030.915
LOC55787120.2481.0590.0070.8590.0190.919
LOC55657880.1751.0720.4350.9670.0000.907
LOC55753530.0051.1710.8141.0100.0010.880
Note: 0.000 stands for less than 0.001 with a significant difference.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, X.; Zhou, X.; Xie, X.; Li, B.; Zhao, T.; Yu, H.; Xing, D.; Wu, J.; Li, C. Functional Verification of Differentially Expressed Genes Following DENV2 Infection in Aedes aegypti. Viruses 2025, 17, 67. https://doi.org/10.3390/v17010067

AMA Style

Chen X, Zhou X, Xie X, Li B, Zhao T, Yu H, Xing D, Wu J, Li C. Functional Verification of Differentially Expressed Genes Following DENV2 Infection in Aedes aegypti. Viruses. 2025; 17(1):67. https://doi.org/10.3390/v17010067

Chicago/Turabian Style

Chen, Xiaoli, Xinyu Zhou, Xiaoxue Xie, Bo Li, Teng Zhao, Haotian Yu, Dan Xing, Jiahong Wu, and Chunxiao Li. 2025. "Functional Verification of Differentially Expressed Genes Following DENV2 Infection in Aedes aegypti" Viruses 17, no. 1: 67. https://doi.org/10.3390/v17010067

APA Style

Chen, X., Zhou, X., Xie, X., Li, B., Zhao, T., Yu, H., Xing, D., Wu, J., & Li, C. (2025). Functional Verification of Differentially Expressed Genes Following DENV2 Infection in Aedes aegypti. Viruses, 17(1), 67. https://doi.org/10.3390/v17010067

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop