Re-Emergence of DENV-3 in French Guiana: Retrospective Analysis of Cases That Circulated in the French Territories of the Americas from the 2000s to the 2023–2024 Outbreak
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Clinical Samples and Study Design
2.3. MinION Library Preparation and Multiplexed Nanopore Sequencing
2.4. Phylogenetic Analysis
3. Results
3.1. Circulation of Regional Strains in the Early 2000s
3.2. Multiple Introductions Are the Source of the 2019–2021 Epidemic in Martinique
3.3. New Introduction Is the Source of the 2023–2024 Epidemic in French Guiana
3.4. Amino Acid Substitution Analysis among the 97 FTA Sequences
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AA | amino acid |
BEAST | Bayesian Evolutionary Analysis Sampling Trees |
BEAUti | Bayesian Evolutionary Analysis Utility |
cDNA | complementary DNA |
CDS | coding sequence |
CLC | CLC Main Workbench |
CNIL | National Commission on Informatics and Liberty |
DENV | dengue virus |
DENV-3 | dengue virus serotype 3 |
ESS | effective sample size |
FG | French Guiana |
FPHC | French Public Health Code |
FTA | French Territory of the Americas |
GIII | Genotype III |
GTR + G + I | General Time Reversible with Gamma distribution and Invariant sites |
95% HPD | 95% high-probability densities |
MRCA | most recent common ancestor |
NGS | next-generation sequencing |
NRCA-FG | National Research Center for Arboviruses French Guiana |
NS | Nonstructural protein |
MCC | maximum clade credibility |
ONT | Oxford Nanopore Technologies |
PCR | polymerase chain reaction |
SPF | Santé Publique France |
WHO | World Health Organization |
Appendix A
Primer Name | Sequence | Amplicon Size | Pool |
---|---|---|---|
DENV3-F-1 | AGTTGTTAGTCTACGTGGACCGAC | 474 | 1 |
CDC-D3-R-1 | ATCATSCGYGGCTCTCCAT | ||
CDC-D3-F-3 | AGCRYAGACGYGAYAAGAGATC | 393 | |
CDC-D3-R-3 | GCCTCGGTCTTCTGRAGCTCTA | ||
CDC-D3-F-5 | GAGCARGACCARAACTACGT | 523 | |
DENV3-R1 | TGCATTGCTCCCTCTTGYGAT | ||
CDC-D3-F-7 | CTCAAGGGGATGAGYTATGCAA | 404 | |
CDC-D3-R-7 | AACRCCACCYACTGWTCCAAAG | ||
CDC-D3-F-9 | TGCACCAAATATTYGGAAGTGC | 402 | |
CDC-D3-R-9 | AGYTCATTRGCTATYTGCTTCCA | ||
CDC-D3-F-15 | CGTTGACTGTYGCCTGGAGAA | 390 | |
CDC-D3-R-15 | TGGGACACTCCTGTTTGCTCA | ||
CDC-D3-F-17 | ACACAGAAAGCAGAACTGGAAGA | 409 | |
CDC-D3-R-17 | AGYCCCACTACCTTTCCCTCT | ||
CDC-D3-F-21 | GTGATYGACCCAAGAAGATGTCT | 402 | |
CDC-D3-R-21 | TGATYCCTTCTGAKGCTACTTT | ||
CDC-D3-F-23 | AAYATGGAYGTGGAAATCTGGA | 391 | |
CDC-D3-R-23 | ACACARATRAGTCCTATTGARGTCTTT | ||
CDC-D3-F-33 | GGCACGGTAATGGACATYATATCT | 421 | |
CDC-D3-R-33 | CYACCAACTTTCTTCCATCTTTC | ||
CNR-D3-F-36 | CTTCYAGAGCAACCTGGGCYC | 559/581 | |
CNR-D3-R-36Bis | CCATTCCATTTTCTGGCGTTCTG | ||
DENV3-R-8 | AGAACCTGTTGATTCAACAGCACC | ||
CDC-D3-F-2 | TTGCTTTCCACTTGACYTCRCG | 414 | 2 |
CDC-D3-R-2 | GCTAGTATKGTGAAMCCTGGRT | ||
CDC-D3-F-4 | CCATGACAATGAGATGYGTGGGA | 399 | |
CDC-D3-R-4 | TGMACYRCTTTTCCCTCTAT | ||
CDC-D3-F-8 | GCWGAACCYCCTTTTGGGGAAA | 393 | |
CDC-D3-R-8 | CACAYCCCATGTCAGCTTG | ||
CDC-D3-F-10 | AAGAACTYAAATGYGGAAGTGGAAT | 413 | |
CDC-D3-R-10 | CTCTTGAGGCAYTTGGACACTC | ||
CDC-D3-F-12 | GGCTAYTGGATAGAAAGCCA | 415 | |
CDC-D3-R-12 | GGTCTRATTTCCATRCCATACCA | ||
CDC-D3-F-14 | CAGGGCARATAACATGGAGA | 424 | |
CDC-D3-R-14 | CATGCTCGAAGACTGGCACA | ||
CDC-D3-F-16 | CATAACTGGCACGTCAGCAGAC | 395 | |
CDC-D3-R-16 | ACTCCTTCTTTTTGYACTCCAAC | ||
CDC-D3-F-18 | GGGGARATAGGRGCRATTGCAC | 397 | |
CDC-D3-R-18 | GTGTGTTCAGATTTTGTTGC | ||
CDC-D3-F-20 | ACGCTCATGGAATTCAGGCAAT | 407 | |
CDC-D3-R-20 | TGGCCCGTGAATATGTAYTG | ||
CDC-D3-F-22 | CCAGAAGGAATCATACCAGCT | 394 | |
CDC-D3-R-22 | GGCACTCTTCCTATTTCTGTCACA | ||
CDC-D3-F-24 | CCAGARACAATGGAAACACT | 427 | |
CDC-D3-R-24 | TACAATGTCCARGCTGATGCT | ||
CDC-D3-F-26 | AGGTCCAGGAYTGCARGCA | 400 | |
CDC-D3-R-26 | CACCTTGWGASCCTGTTC | ||
CDC-D3-F-28 | GTGGAAGAGGAGGCTGGTCATA | 406 | |
CDC-D3-R-28 | CATTTCRTGCGTGGAGTTTCG | ||
CDC-D3-F-30 | TAAAAAGRATCAAGGAGGAGC | 415 | |
CDC-D3-R-30 | CCATTGGTTCTCCTCYGTGAA | ||
CDC-D3-F-32 | CATGTGGTTGGGAGCCA | 427 | |
CDC-D3-R-32 | CTGGGCTTCCATGTTRGTRAAT | ||
CDC-D3-F-34 | TGGCATGAYTGGCARCAGGT | 391 | |
CDC-D3-R-34 | ACTGGAGTTTTGTCYTCCATCCA | ||
CDC-D3-F-6 | TACCATGGACATCAGGRG | 308 | 3 |
CDC-D3-R-6 | GTATTGTCCCATGYTGYGT | ||
CDC-D3-F-11 | ATAGTGACAGCWGAAAYAC | 427 | |
CDC-D3-R-11 | GCCGTYTGGGTGTGRTA | ||
CDC-D3-F-13 | GAAGGAACAACRGTWGTCAT | 406 | |
CDC-D3-R-13 | GCGTTGGAYCCAATCATT | ||
CDC-D3-F-19 | TGGAAGAAGCAYTGAAAGG | 402 | |
CDC-D3-R-19 | ATGCTRGGGACAAACCAC | ||
CDC-D3-F-25 | TYGCATATGTYGTRATAGGC | 615 | |
CDC-D3-R-25 | GCCCATGATGTTCTCAT | ||
CDC-D3-F-27 | ACRATAGCYGTYTCMATG | 415 | |
CDC-D3-R-27 | CCTTTTGTGTATCCTCGYACT | ||
CDC-D3-F-29 | GGAGGAATGCTTGTGAGAAA | 361 | |
CDC-D3-R-29 | TTTATCATGGAGGAGGCTGAGC | ||
CDC-D3-F-31 | GAGAACYCTGGGAAGGAAYAAA | 395 | |
CDC-D3-R-31 | TTRTGCARTCCTTCYCCTTC | ||
CDC-D3-F-35 | GAAAGCCTAYGCYCAAATGTG | 438 | |
CDC-D3-R-35 | TTTACCAAATGGCTCCCT |
A. Number | Country | Collection Date | Genotype | |
---|---|---|---|---|
1 | OQ821545.1 | Cuba | 2022 | III |
2 | OQ821510.1 | Cuba | 2022 | III |
3 | OQ132878.1 | Niger imported from Cuba | 2022 | III |
4 | OQ706226.1 | Roraima State Brazil | 2023 | III |
5 | OQ706227.1 | Roraima State Brazil | 2023 | III |
6 | OQ706228.1 | Roraima State Brazil | 2023 | III |
7 | OQ821537.1 | Cuba | 2022 | III |
8 | OQ868517.1 | Suriname | 2023 | III |
9 | ON123669.1 | India | 2018 | III |
10 | OM865820.1 | Bhutan | 2019 | III |
11 | OM638675.1 | India | 2021 | III |
12 | ON109599.1 | India | 2021 | III |
13 | OR229981.1 | Guadeloupe | 2020 | III |
14 | OR229978.1 | Martinique | 2020 | III |
15 | MN018385.1 | India | 2016 | III |
16 | OR229982.1 | Martinique | 2020 | III |
17 | ON890789.1 | Maldives | 2019 | III |
18 | OQ339138.1 | India | 2022 | III |
19 | OR029719.1 | China | 2019 | III |
20 | OR418423.1 | Thailand | 2023 | III |
21 | OR229984.1 | Martinique | 2020 | III |
22 | ON890788.1 | Ethiopia | 2019 | III |
23 | MN964273.1 | Ethiopia | 2019 | III |
24 | MT261978.1 | Burkina Faso | 2017 | III |
25 | MW288037.1 | Senegal | 2018 | III |
26 | MT261977.1 | Burkina Faso | 2017 | III |
27 | KU509282.1 | Senegal | 2009 | III |
28 | KU509286.1 | India | 2011 | III |
29 | KU509281.1 | India | 2009 | III |
30 | GU131862.1 | Sao Paulo Brazil | 2007 | III |
31 | EF643017.1 | Brazil | 2003 | III |
32 | JX669508.1 | Brazil | 2006 | III |
33 | JF808120.1 | Brazil | 2009 | III |
34 | AY679147.1 | Rio de Janeiro Brazil | 2002 | III |
35 | OQ727062.1 | Amazonas Manaus Brazil | 2006 | III |
36 | AY099337.1 | Martinique | 1999 | III |
37 | KU509278.1 | Barbados | 2007 | III |
38 | FJ898464.1 | Guyana | 2002 | III |
39 | GQ868617.1 | Trinidad and Tobago | 2002 | III |
40 | FJ898464.1 | Saint Lucia | 2001 | III |
41 | EU529691.1 | Venezuela | 2001 | III |
42 | FJ850094.1 | Northern Brazil | 2008 | III |
43 | EU529696.1 | Puerto Rico | 1999 | III |
44 | FJ898474.1 | Venezuela | 2007 | III |
45 | FJ024470.1 | Puerto Rico | 2004 | III |
46 | KT726354.1 | Cuba | 2001 | III |
47 | EU529703.1 | Puerto Rico | 1998 | III |
48 | MH544651.1 | Colombia | 2016 | III |
49 | KJ189298.1 | Peru | 2008 | III |
50 | FJ639786.1 | Venezuela | 2003 | III |
51 | FJ639804.1 | Venezuela | 2005 | III |
52 | KF955479.1 | Venezuela | 2001 | III |
53 | HQ332171.1 | Cuba | 2006 | III |
54 | FJ898442.1 | Mexico | 2007 | III |
55 | KU509283.1 | Sri Lanka | 2006 | III |
56 | EU081210.1 | Singapore | 2005 | III |
57 | NC_001475.2 | Sri Lanka | 2000 | III |
58 | KU509280.1 | Thailand | 2011 | II |
59 | GU131906.1 | Cambodia | 2003 | II |
60 | AY923865.1 | Thailand | 1994 | II |
61 | OQ103113.1 | Sri Lanka | 2020 | I |
62 | OQ103317.1 | Sri Lanka | 2022 | I |
63 | MH823209.1 | Indonesia | 2016 | I |
64 | ON890832.1 | China | 2019 | I |
65 | ON907583.1 | Bangladesh | 2019 | I |
66 | MN018388.1 | China | 2017 | I |
67 | KC762693.1 | Indonesia | 2010 | I |
68 | MN018384.1 | China | 2016 | I |
69 | KU509285.1 | Thailand | 2010 | I |
70 | AY858047.2 | Indonesia | 2004 | I |
71 | AB214882.1 | Timor-Leste | 2005 | I |
72 | AB189128.1 | Indonesia | 1998 | I |
73 | KU509279.1 | Philippines | 2008 | I |
74 | AY744683.1 | French Polynesia | 1992 | I |
75 | JQ920486.1 | New Caledonia | 1996 | I |
76 | AY744679.1 | French Polynesia | 1990 | I |
77 | AY496879.2 | Philippines | 1997 | I |
78 | JQ922554.1 | USA | 1963 | V |
79 | OM258630.1 | Puerto Rico | 1953 | unclassified |
Sequence ID | Accession Number | Size (PB) | Territory: Municipality | Collection Date | |
---|---|---|---|---|---|
1 | 07083/DENV3/FG/2001-11-04 | PP582621 | 10 625 | French Guiana: Cayenne | 2001-11-04 |
2 | 25179/DENV3/FG/2013-01-24 | PP582622 | 10 708 | French Guiana: Cayenne | 2013-01-24 |
3 | 31054/DENV3/FG/2013-02-05 | PP582623 | 10 708 | French Guiana: Cayenne | 2013-02-05 |
4 | 04133/DENV3/MTQ/2019-10-11 | PP582624 | 10 233 | Martinique: Le Vauclin | 2019-10-11 |
5 | 04086/DENV3/MTQ/2019-11-25 | PP582625 | 10 227 | Martinique: Les Trois-Îlets | 2019-11-25 |
6 | 09088/DENV3/GLP/2019-12-20 | PP582626 | 10 227 | Guadeloupe: Baie-Mahault | 2019-12-20 |
7 | 27341/DENV3/MTQ/2020-01-09 | PP582627 | 10 708 | Martinique: Les Anses-d’Arlet | 2020-01-09 |
8 | 28089/DENV3/MTQ/2020-02-06 | PP582628 | 10 236 | Martinique: Les Trois-Îlets | 2020-02-06 |
9 | 24087/DENV3/FG/2020-08-24 | PP582629 | 10 603 | French Guiana: Rémire-Montjoly | 2020-08-24 |
10 | 15178/DENV3/FG/2020-09-15 | PP582630 | 10 227 | French Guiana: Matoury | 2020-09-15 |
11 | 20156/DENV3/GLP/2020-10-01 | PP582631 | 10 227 | Guadeloupe: Le Gosier | 2020-10-01 |
12 | 20150/DENV3/GLP/2020-10-07 | PP582632 | 10 708 | Guadeloupe: Le Gosier | 2020-10-07 |
13 | 23065/DENV3/FG/2020-10-23 | PP582633 | 10 236 | French Guiana: Rémire-Montjoly | 2020-10-23 |
14 | 20163/DENV3/GLP/2020-10-28 | PP582634 | 10 235 | Guadeloupe: Baie-Mahault | 2020-10-28 |
15 | 20157/DENV3/GLP/2020-11-03 | PP582635 | 10 708 | Guadeloupe: Les Abymes | 2020-11-03 |
16 | 09124/DENV3/FG/2020-11-09 | PP582636 | 10 227 | French Guiana: Tonate-Macouria | 2020-11-09 |
17 | 07178/DENV3/FG/2021-01-07 | PP582637 | 10 708 | French Guiana: Cayenne | 2021-01-07 |
18 | 26144/DENV3/FG/2021-01-26 | PP582638 | 10 708 | French Guiana: Cayenne | 2021-01-26 |
19 | 06017/DENV3/FG/2022-11-23 | PP582639 | 10 708 | French Guiana: Kourou | 2022-11-23 |
20 | 18013/DENV3/FG/2023-01-09 | PP582640 | 10 244 | French Guiana: Kourou | 2023-01-09 |
21 | 10005/DENV3/FG/2023-03-10 | PP582641 | 10 708 | French Guiana: Montsinery | 2023-03-10 |
22 | 26005/DENV3/FG/2023-04-23 | PP582642 | 10 708 | French Guiana: Kourou | 2023-04-23 |
23 | 15024/DENV3/FG/2023-05-15 | PP582643 | 10 475 | French Guiana: Kourou | 2023-05-15 |
24 | 02031/DENV3/FG/2023-06-01 | PP582644 | 10 227 | French Guiana: St Laurent du Maroni | 2023-06-01 |
25 | 07015/DENV3/FG/2023-06-06 | PP582645 | 10 227 | French Guiana: Kourou | 2023-06-06 |
26 | 13012/DENV3/FG/2023-06-10 | PP582646 | 10 227 | French Guiana: Kourou | 2023-06-10 |
27 | 13168/DENV3/FG/2023-06-13 | PP582647 | 10 227 | French Guiana: St Laurent du Maroni | 2023-06-13 |
28 | 16010/DENV3/FG/2023-06-15 | PP582648 | 10 227 | French Guiana: Iracoubo | 2023-06-15 |
29 | 23030/DENV3/FG/2023-06-20 | PP582649 | 10 227 | French Guiana: Maripasoula | 2023-06-20 |
30 | 22011/DENV3/FG/2023-06-21 | PP582650 | 10 227 | French Guiana: Kourou | 2023-06-21 |
31 | 23026/DENV3/FG/2023-06-21 | PP582651 | 10 227 | French Guiana: Maripasoula | 2023-06-21 |
32 | 30024/DENV3/FG/2023-06-29 | PP582652 | 10 708 | French Guiana: Mana | 2023-06-29 |
33 | 03018/DENV3/FG/2023-07-03 | PP582653 | 10 227 | French Guiana: Kourou | 2023-07-03 |
34 | 07027/DENV3/FG/2023-07-06 | PP582654 | 10 708 | French Guiana: St Laurent du Maroni | 2023-07-06 |
35 | 07026/DENV3/FG/2023-07-07 | PP582655 | 10 708 | French Guiana: Mana | 2023-07-07 |
36 | 07039/DENV3/FG/2023-07-07 | PP582656 | 10 227 | French Guiana: Kourou | 2023-07-07 |
37 | 07041/DENV3/FG/2023-07-07 | PP582657 | 10 708 | French Guiana: St Laurent du Maroni | 2023-07-07 |
38 | 17045/DENV3/FG/2023-07-13 | PP582658 | 10 708 | French Guiana: Maripasoula | 2023-07-13 |
39 | 17053/DENV3/FG/2023-07-17 | PP582659 | 10 708 | French Guiana: Cayenne | 2023-07-17 |
40 | 19028/DENV3/FG/2023-07-19 | PP582660 | 10 708 | French Guiana: Cayenne | 2023-07-19 |
41 | 20025/DENV3/FG/2023-07-19 | PP582661 | 10 708 | French Guiana: Mana | 2023-07-19 |
42 | 20003/DENV3/FG/2023-07-20 | PP582662 | 10 708 | French Guiana: Matoury | 2023-07-20 |
43 | 20026/DENV3/FG/2023-07-20 | PP582663 | 10 227 | French Guiana: Mana | 2023-07-20 |
44 | 21022/DENV3/FG/2023-07-21 | PP582664 | 10 708 | French Guiana: Kourou | 2023-07-21 |
45 | 22008/DENV3/FG/2023-07-22 | PP582665 | 10 708 | French Guiana: Kourou | 2023-07-22 |
46 | 24008/DENV3/FG/2023-07-24 | PP582666 | 10 708 | French Guiana: Cayenne | 2023-07-24 |
47 | 25006/DENV3/FG/2023-07-25 | PP582667 | 10 708 | French Guiana: Cayenne | 2023-07-25 |
48 | 25030/DENV3/FG/2023-07-25 | PP582668 | 10 708 | French Guiana: St Laurent du Maroni | 2023-07-25 |
49 | 03024/DENV3/FG/2023-07-30 | PP582669 | 10 708 | French Guiana: Maripasoula | 2023-07-30 |
50 | 03027/DENV3/FG/2023-07-30 | PP582670 | 10 708 | French Guiana: Antecum Pata | 2023-07-30 |
51 | 01044/DENV3/FG/2023-08-01 | PP582671 | 10 227 | French Guiana: Kourou | 2023-08-01 |
52 | 04035/DENV3/FG/2023-08-03 | PP582672 | 10 227 | French Guiana: St Laurent du Maroni | 2023-08-03 |
53 | 07062/DENV3/FG/2023-08-07 | PP582673 | 10 227 | French Guiana: St Laurent du Maroni | 2023-08-07 |
54 | 09024/DENV3/FG/2023-08-09 | PP582674 | 10 708 | French Guiana: Kourou | 2023-08-09 |
55 | 11020/DENV3/FG/2023-08-09 | PP582675 | 10 708 | French Guiana: Grand-Santi | 2023-08-09 |
56 | 12016/DENV3/FG/2023-08-12 | PP582676 | 10 708 | French Guiana: St Laurent du Maroni | 2023-08-12 |
57 | 15024/DENV3/FG/2023-08-15 | PP582677 | 10 708 | French Guiana: Sinnamary | 2023-08-15 |
58 | 16005/DENV3/FG/2023-08-16 | PP582678 | 10 708 | French Guiana: Saint-Georges | 2023-08-16 |
59 | 18005/DENV3/FG/2023-08-17 | PP582679 | 10 708 | French Guiana: Kourou | 2023-08-17 |
60 | 22034/DENV3/FG/2023-08-21 | PP582680 | 10 708 | French Guiana: Maripasoula | 2023-08-21 |
61 | 29015/DENV3/FG/2023-08-28 | PP582681 | 10 227 | French Guiana: Kourou | 2023-08-28 |
62 | 29017/DENV3/FG/2023-08-28 | PP582682 | 10 227 | French Guiana: Remire-Montjoly | 2023-08-28 |
63 | 01004/DENV3/FG/2023-09-01 | PP582683 | 10 708 | French Guiana: Matoury | 2023-09-01 |
64 | 25128/DENV3/MTQ/2020-11-10 | PP582684 | 10 457 | Martinique: Le Robert | 2020-11-10 |
65 | 25141/DENV3/MTQ/2020-11-10 | PP582685 | 10 227 | Martinique: Fort-de-France | 2020-11-10 |
66 | 25144/DENV3/MTQ/2020-11-10 | PP582686 | 10 227 | Martinique: Schoelcher | 2020-11-10 |
67 | 05041/DENV3/FG/2023-07-05 | PP582687 | 10 227 | French Guiana: Kourou | 2023-07-05 |
68 | 15001/DENV3/FG/2023-10-14 | PP582688 | 10 227 | French Guiana: Sinnamary | 2023-10-14 |
69 | 16026/DENV3/FG/2023-10-10 | PP582689 | 10 227 | French Guiana: Matoury | 2023-10-10 |
70 | 17023/DENV3/FG/2023-10-14 | PP582690 | 10 227 | French Guiana: Kourou | 2023-10-14 |
71 | 18016/DENV3/FG/2023-10-16 | PP582691 | 10 474 | French Guiana: Remire-Montjoly | 2023-10-16 |
72 | 24035/DENV3/FG/2023-10-23 | PP582692 | 10 472 | French Guiana: St Laurent du Maroni | 2023-10-23 |
73 | 02029/DENV3/FG/2023-10-31 | PP582693 | 10 227 | French Guiana: Apatou | 2023-10-31 |
74 | 03031/DENV3/FG/2023-10-30 | PP582694 | 10 470 | French Guiana: Papaïchton | 2023-10-30 |
75 | 08043/DENV3/FG/2023-11-06 | PP582695 | 10 474 | French Guiana: Grand-Santi | 2023-11-06 |
76 | 10006/DENV3/FG/2023-07-24 | PP582696 | 10 474 | French Guiana: Kourou | 2023-07-24 |
77 | 13035/DENV3/FG/2023-11-12 | PP582697 | 10 227 | French Guiana: Mana | 2023-11-12 |
78 | 18004/DENV3/FG/2023-11-16 | PP582698 | 10 686 | French Guiana: Cayenne | 2023-11-16 |
79 | 21053/DENV3/FG/2023-11-21 | PP582699 | 10 227 | French Guiana: St Laurent du Maroni | 2023-11-21 |
80 | 22039/DENV3/FG/2023-11-20 | PP582700 | 10 470 | French Guiana: Apatou | 2023-11-20 |
81 | 23032/DENV3/FG/2023-11-21 | PP582701 | 10 227 | French Guiana: Remire-Montjoly | 2023-11-21 |
82 | 27076/DENV3/FG/2023-11-23 | PP582702 | 10 227 | French Guiana: Matoury | 2023-11-23 |
83 | 30002/DENV3/FG/2023-11-28 | PP582703 | 10 227 | French Guiana: Maripasoula | 2023-11-28 |
84 | 06045/DENV3/FG/2023-12-04 | PP582704 | 10 227 | French Guiana: Remire-Montjoly | 2023-12-04 |
85 | 07104/DENV3/FG/2023-12-07 | PP582705 | 10 227 | French Guiana: Tonate-Macouria | 2023-12-07 |
86 | 07115/DENV3/FG/2023-12-05 | PP582706 | 10 461 | French Guiana: Grand-Santi | 2023-12-05 |
87 | 07118/DENV3/FG/2023-12-06 | PP582707 | 10 227 | French Guiana: Sinnamary | 2023-12-06 |
88 | 12075/DENV3/FG/2023-12-12 | PP582708 | 10 227 | French Guiana: Kourou | 2023-12-12 |
89 | 18049/DENV3/FG/2023-12-16 | PP582709 | 10 227 | French Guiana: St Laurent du Maroni | 2023-12-16 |
90 | 22056/DENV3/FG/2023-12-21 | PP582710 | 10 468 | French Guiana: Cayenne | 2023-12-21 |
91 | 27038/DENV3/FG/2023-12-24 | PP582711 | 10 227 | French Guiana: Matoury | 2023-12-24 |
92 | 12036/DENV3/FG/2024-01-11 | PP582712 | 10 227 | French Guiana: St Laurent du Maroni | 2024-01-11 |
93 | 16073/DENV3/FG/2024-01-14 | PP582713 | 10 227 | French Guiana: Kourou | 2024-01-14 |
94 | 18030/DENV3/FG/2024-01-16 | PP582714 | 10 227 | French Guiana: Sinnamary | 2024-01-16 |
95 | 20026/DENV3/FG/2024-01-17 | PP582715 | 10 227 | French Guiana: Tonate-Macouria | 2024-01-17 |
96 | 24011/DENV3/FG/2024-01-24 | PP582716 | 10 227 | French Guiana: Remire-Montjoly | 2024-01-24 |
97 | 23163/DENV3/FG/2024-01-22 | PP582717 | 10 471 | French Guiana: Matoury | 2024-01-22 |
Gene Coding for Protein | Nucleotide Positions 2 | Length 2 | Total Number of Nucleotide Mutations | Nucleotide Signature Mutations | Signature Mutation Rate (%) |
---|---|---|---|---|---|
AncC | 1–342 | 342 | 10 | 7 | 2.05 |
prM | 343–840 | 498 | 17 | 11 | 2.21 |
E | 841–2319 | 1479 | 65 | 38 | 2.57 |
NS1 | 2320–3375 | 1056 | 36 | 26 | 2.46 |
NS2A | 3376–4029 | 654 | 35 | 21 | 3.21 |
NS2B | 4030–4419 | 390 | 19 | 11 | 2.82 |
NS3 | 4420–6276 | 1857 | 68 | 40 | 2.15 |
NS4A | 6277–6657 | 381 | 12 | 5 | 1.31 |
2K | 6658–6726 | 69 | 2 | 1 | 1.45 |
NS4B | 6727–7470 | 744 | 28 | 20 | 2.69 |
NS5 | 7471–10,140 1 | 2670 | 125 | 82 | 3.07 |
TOTAL | 417 | 262 |
Gene Coding for Protein | Nucleotide Positions 2 | Length AA | No. of AA Substitutions | AA Substitution Rate (%) | Specific AA Substitutions Profile | Specific AA Substitution Profile Rate (%) |
---|---|---|---|---|---|---|
AncC | 1–342 | 114 | 6 | 5.26 | 1 | 0.88 |
prM | 343–840 | 166 | 4 | 2.41 | 1 | 0.60 |
E | 841–2319 | 493 | 22 | 4.46 | 5 | 1.01 |
NS1 | 2320–3375 | 352 | 13 | 3.69 | 5 | 1.42 |
NS2A | 3376–4029 | 218 | 19 | 8.72 | 9 | 4.13 |
NS2B | 4030–4419 | 130 | 8 | 6.15 | 4 | 3.08 |
NS3 | 4420–6276 | 619 | 25 | 4.04 | 6 | 0.97 |
NS4A | 6277–6657 | 127 | 5 | 3.94 | 0 | 0.00 |
2K | 6658–6726 | 23 | 2 | 8.70 | 1 | 4.35 |
NS4B | 6727–7470 | 248 | 6 | 2.42 | 2 | 0.81 |
NS5 | 7471–10,140 1 | 890 | 49 | 5.51 | 17 | 1.94 |
TOTAL | 159 | 51 |
References
- Epidemiological Update Dengue in the Region of the Americas 28 March 2023—PAHO/WHO|Pan American Health Organization. Available online: https://www.paho.org/en/documents/epidemiological-update-dengue-region-americas-28-march-2023 (accessed on 17 April 2024).
- Dengue and Severe Dengue. Available online: https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue (accessed on 15 January 2024).
- Epidemiological Update—Increase in Dengue Cases in the Region of the Americas—29 March 2024—PAHO/WHO|Pan American Health Organization. Available online: https://www.paho.org/en/documents/epidemiological-update-increase-dengue-cases-region-americas-29-march-2024 (accessed on 30 April 2024).
- Dussart, P.; Lavergne, A.; Lagathu, G.; Lacoste, V.; Martial, J.; Morvan, J.; Cesaire, R. Reemergence of Dengue Virus Type 4, French Antilles and French Guiana, 2004–2005. Emerg. Infect. Dis. 2006, 12, 1748–1751. [Google Scholar] [CrossRef] [PubMed]
- L’Azou, M.; Taurel, A.-F.; Flamand, C.; Quénel, P. Recent Epidemiological Trends of Dengue in the French Territories of the Americas (2000–2012): A Systematic Literature Review. PLoS Negl. Trop. Dis. 2014, 8, e3235. [Google Scholar] [CrossRef] [PubMed]
- Messina, J.P.; Brady, O.J.; Scott, T.W.; Zou, C.; Pigott, D.M.; Duda, K.A.; Bhatt, S.; Katzelnick, L.; Howes, R.E.; Battle, K.E.; et al. Global Spread of Dengue Virus Types: Mapping the 70 Year History. Trends Microbiol. 2014, 22, 138–146. [Google Scholar] [CrossRef] [PubMed]
- Márquez, S.; Lee, G.; Gutiérrez, B.; Bennett, S.; Coloma, J.; Eisenberg, J.N.S.; Trueba, G. Phylogenetic Analysis of Transmission Dynamics of Dengue in Large and Small Population Centers, Northern Ecuador. Emerg. Infect. Dis. 2023, 29, 888–897. [Google Scholar] [CrossRef] [PubMed]
- SPF Dengue en Guyane. Point au 28 Mars 2024. Available online: https://www.santepubliquefrance.fr/regions/guyane/documents/bulletin-regional/2024/dengue-en-guyane.-point-au-28-mars-2024 (accessed on 17 April 2024).
- Lanciotti, R.S.; Lewis, J.G.; Gubler, D.J.; Trent, D.W. Molecular Evolution and Epidemiology of Dengue-3 Viruses. J. Gen. Virol. 1994, 75, 65–75. [Google Scholar] [CrossRef] [PubMed]
- Waman, V.P.; Kale, M.M.; Kulkarni-Kale, U. Genetic Diversity and Evolution of Dengue Virus Serotype 3: A Comparative Genomics Study. Infect. Genet. Evol. 2017, 49, 234–240. [Google Scholar] [CrossRef] [PubMed]
- Quick, J.; Grubaugh, N.D.; Pullan, S.T.; Claro, I.M.; Smith, A.D.; Gangavarapu, K.; Oliveira, G.; Robles-Sikisaka, R.; Rogers, T.F.; Beutler, N.A.; et al. Multiplex PCR Method for MinION and Illumina Sequencing of Zika and Other Virus Genomes Directly from Clinical Samples. Nat. Protoc. 2017, 12, 1261–1276. [Google Scholar] [CrossRef] [PubMed]
- Santiago, G.A.; Vergne, E.; Quiles, Y.; Cosme, J.; Vazquez, J.; Medina, J.F.; Medina, F.; Colón, C.; Margolis, H.; Muñoz-Jordán, J.L. Analytical and Clinical Performance of the CDC Real Time RT-PCR Assay for Detection and Typing of Dengue Virus. PLoS Negl. Trop. Dis. 2013, 7, e2311. [Google Scholar] [CrossRef]
- Jones, F.K.; Morrison, A.M.; Santiago, G.A.; Rysava, K.; Zimler, R.A.; Heberlein, L.A.; Kopp, E.; Saunders, K.E.; Baudin, S.; Rico, E.; et al. Introduction and Spread of Dengue Virus 3, Florida, USA, May 2022–April 2023. Emerg. Infect. Dis. J. CDC 2024, 30, 376–379. [Google Scholar] [CrossRef]
- Rowe, D.; McDermott, C.; Veliz, Y.; Kerr, A.; Whiteside, M.; Coss, M.; Huff, C.; Leal, A.; Kopp, E.; LaCrue, A.; et al. Dengue Outbreak Response during COVID-19 Pandemic, Key Largo, Florida, USA, 2020. Emerg. Infect. Dis. J. CDC 2023, 29, 1643–1647. [Google Scholar] [CrossRef]
- Naveca, F.G.; Santiago, G.A.; Maito, R.M.; Ribeiro Meneses, C.A.; do Nascimento, V.A.; de Souza, V.C.; do Nascimento, F.O.; Silva, D.; Mejía, M.; Gonçalves, L.; et al. Reemergence of Dengue Virus Serotype 3, Brazil, 2023. Emerg. Infect. Dis. 2023, 29, 1482–1484. [Google Scholar] [CrossRef] [PubMed]
- Barido-Sottani, J.; Schwery, O.; Warnock, R.C.M.; Zhang, C.; Wright, A.M. Practical Guidelines for Bayesian Phylogenetic Inference Using Markov Chain Monte Carlo (MCMC). Open Res. Eur. 2023, 3, 204. [Google Scholar] [CrossRef] [PubMed]
- Suchard, M.A.; Lemey, P.; Baele, G.; Ayres, D.L.; Drummond, A.J.; Rambaut, A. Bayesian Phylogenetic and Phylodynamic Data Integration Using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef]
- Baele, G.; Lemey, P.; Bedford, T.; Rambaut, A.; Suchard, M.A.; Alekseyenko, A.V. Improving the Accuracy of Demographic and Molecular Clock Model Comparison While Accommodating Phylogenetic Uncertainty. Mol. Biol. Evol. 2012, 29, 2157–2167. [Google Scholar] [CrossRef] [PubMed]
- Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed]
- Araújo, J.M.G.; Nogueira, R.M.R.; Schatzmayr, H.G.; Zanotto, P.M.d.A.; Bello, G. Phylogeography and Evolutionary History of Dengue Virus Type 3. Infect. Genet. Evol. 2009, 9, 716–725. [Google Scholar] [CrossRef] [PubMed]
- Messer, W.B.; Gubler, D.J.; Harris, E.; Sivananthan, K.; de Silva, A.M. Emergence and Global Spread of a Dengue Serotype 3, Subtype III Virus. Emerg. Infect. Dis. 2003, 9, 800–809. [Google Scholar] [CrossRef] [PubMed]
- Liang, H.; Luo, L.; Yang, Z.; Di, B.; Bai, Z.; He, P.; Jing, Q.; Zheng, X. Re-Emergence of Dengue Virus Type 3 in Canton, China, 2009–2010, Associated with Multiple Introductions through Different Geographical Routes. PLoS ONE 2013, 8, e55353. [Google Scholar] [CrossRef] [PubMed]
- Tan, K.-K.; Zulkifle, N.-I.; Sulaiman, S.; Pang, S.-P.; NorAmdan, N.; MatRahim, N.; Abd-Jamil, J.; Shu, M.-H.; Mahadi, N.M.; AbuBakar, S. Emergence of the Asian Lineage Dengue Virus Type 3 Genotype III in Malaysia. BMC Evol. Biol. 2018, 18, 58. [Google Scholar] [CrossRef]
- Titir, S.R.; Paul, S.K.; Ahmed, S.; Haque, N.; Nasreen, S.A.; Hossain, K.S.; Ahmad, F.U.; Nila, S.S.; Khanam, J.; Nowsher, N.; et al. Nationwide Distribution of Dengue Virus Type 3 (DENV-3) Genotype I and Emergence of DENV-3 Genotype III during the 2019 Outbreak in Bangladesh. Trop. Med. Infect. Dis. 2021, 6, 58. [Google Scholar] [CrossRef]
- Eldigail, M.H.; Abubaker, H.A.; Khalid, F.A.; Abdallah, T.M.; Musa, H.H.; Ahmed, M.E.; Adam, G.K.; Elbashir, M.I.; Aradaib, I.E. Association of Genotype III of Dengue Virus Serotype 3 with Disease Outbreak in Eastern Sudan, 2019. Virol. J. 2020, 17, 118. [Google Scholar] [CrossRef] [PubMed]
- Monteil, V.; Maquart, M.; Caro, V.; Jaffar-Bandjee, M.-C.; Dosso, M.; Akoua-Koffi, C.; Grandadam, M.; Leparc-Goffart, I. Circulation of Dengue Virus Type 3 Genotype III in Africa Since 2008. J. Hum. Virol. Retrovirol. 2016, 4, 00128. [Google Scholar] [CrossRef][Green Version]
- Usme-Ciro, J.A.; Mendez, J.A.; Tenorio, A.; Rey, G.J.; Domingo, C.; Gallego-Gomez, J.C. Simultaneous Circulation of Genotypes I and III of Dengue Virus 3 in Colombia. Virol. J. 2008, 5, 101. [Google Scholar] [CrossRef] [PubMed]
- Peyrefitte, C.N.; Couissinier-Paris, P.; Mercier-Perennec, V.; Bessaud, M.; Martial, J.; Kenane, N.; Durand, J.-P.A.; Tolou, H.J. Genetic Characterization of Newly Reintroduced Dengue Virus Type 3 in Martinique (French West Indies). J. Clin. Microbiol. 2003, 41, 5195–5198. [Google Scholar] [CrossRef]
- Peyrefitte, C.N.; Pastorino, B.A.M.; Bessaud, M.; Gravier, P.; Tock, F.; Couissinier-Paris, P.; Martial, J.; Huc-Anais, P.; Césaire, R.; Grandadam, M.; et al. Dengue Type 3 Virus, Saint Martin, 2003–2004. Emerg. Infect. Dis. 2005, 11, 757–761. [Google Scholar] [CrossRef] [PubMed]
- Garcia Van Smévoorde, M.; Piorkowski, G.; Emboulé, L.; Dos Santos, G.; Loraux, C.; Guyomard-Rabenirina, S.; Joannes, M.-O.; Fagour, L.; Najioullah, F.; Cabié, A.; et al. Phylogenetic Investigations of Dengue 2019–2021 Outbreak in Guadeloupe and Martinique Caribbean Islands. Pathogens 2023, 12, 1182. [Google Scholar] [CrossRef]
- Point Epidémiologique Antilles 28 Mai 2021Dengue ARS N°05/2021 Surveillance de la dengue Guadeloupe, Martinique, Saint-Martin, Saint-Barthélemy. Available online: https://www.bing.com/search?q=Point+épidémiologique+Antilles+28+Mai+2021Dengue+ARS+N°05%2F2021+Surveillance+de+la+dengue+Guadeloupe%2C+Martinique%2C+Saint-Martin%2C+Saint-Barthélemy&qs=n&form=QBRE&sp=-1&lq=1&pq=point+épidémiologique+antilles+28+mai+2021dengue+ars+n°05%2F2021+surveillance+de+la+dengue+guadeloupe%2C+martinique%2C+saint-martin%2C+saint-barthélemy&sc=0-143&sk=&cvid=B5B94C850DFA4A0397807879E9D30C9B&ghsh=0&ghacc=0&ghpl= (accessed on 24 June 2024).
- Duan, Y.; Zeng, M.; Jiang, B.; Zhang, W.; Wang, M.; Jia, R.; Zhu, D.; Liu, M.; Zhao, X.; Yang, Q.; et al. Flavivirus RNA-Dependent RNA Polymerase Interacts with Genome UTRs and Viral Proteins to Facilitate Flavivirus RNA Replication. Viruses 2019, 11, 929. [Google Scholar] [CrossRef] [PubMed]
- Klitting, R.; Piorkowski, G.; Rousset, D.; Cabié, A.; Frumence, E.; Lagrave, A.; Lavergne, A.; Enfissi, A.; Santos, G.D.; Fagour, L.; et al. Molecular Epidemiology Identifies the Expansion of the DENV2 Epidemic Lineage from the French Caribbean Islands to French Guiana and Mainland France, 2023 to 2024. Eurosurveillance 2024, 29, 2400123. [Google Scholar] [CrossRef]
- Bonifay, T.; Le Turnier, P.; Epelboin, Y.; Carvalho, L.; De Thoisy, B.; Djossou, F.; Duchemin, J.-B.; Dussart, P.; Enfissi, A.; Lavergne, A.; et al. Review on Main Arboviruses Circulating on French Guiana, An Ultra-Peripheric European Region in South America. Viruses 2023, 15, 1268. [Google Scholar] [CrossRef]
- Santos, L.L.M.; de Aquino, E.C.; Fernandes, S.M.; Ternes, Y.M.F.; Feres, V.C.D.R. Dengue, Chikungunya, and Zika Virus Infections in Latin America and the Caribbean: A Systematic Review. Rev. Panam. Salud Publica. 2023, 47, e34. [Google Scholar] [CrossRef]
- Bailly, S.; Rousset, D.; Fritzell, C.; Hozé, N.; Ben Achour, S.; Berthelot, L.; Enfissi, A.; Vanhomwegen, J.; Salje, H.; Fernandes-Pellerin, S.; et al. Spatial Distribution and Burden of Emerging Arboviruses in French Guiana. Viruses 2021, 13, 1299. [Google Scholar] [CrossRef] [PubMed]
- Marcondes, C.B.; Contigiani, M.; Gleiser, R.M. Emergent and Reemergent Arboviruses in South America and the Caribbean: Why So Many and Why Now? J. Med. Entomol. 2017, 54, 509–532. [Google Scholar] [CrossRef] [PubMed]
- Epelboin, L.; Abboud, P.; Abdelmoumen, K.; About, F.; Adenis, A.; Blaise, T.; Blaizot, R.; Bonifay, T.; Bourne-Watrin, M.; Boutrou, M.; et al. [Overview of infectious and non-infectious diseases in French Guiana in 2022]. Med. Trop. Sante Int. 2023, 3, mtsi.v3i1.2023.308. [Google Scholar] [CrossRef]
- Mavian, C.; Dulcey, M.; Munoz, O.; Salemi, M.; Vittor, A.Y.; Capua, I. Islands as Hotspots for Emerging Mosquito-Borne Viruses: A One-Health Perspective. Viruses 2019, 11, 11. [Google Scholar] [CrossRef] [PubMed]
- Pollett, S.; Melendrez, M.C.; Maljkovic Berry, I.; Duchêne, S.; Salje, H.; Cummings, D.A.T.; Jarman, R.G. Understanding Dengue Virus Evolution to Support Epidemic Surveillance and Counter-Measure Development. Infect. Genet. Evol. 2018, 62, 279–295. [Google Scholar] [CrossRef] [PubMed]
- Torres, J.R.; Orduna, T.A.; Piña-Pozas, M.; Vázquez-Vega, D.; Sarti, E. Epidemiological Characteristics of Dengue Disease in Latin America and in the Caribbean: A Systematic Review of the Literature. J. Trop. Med. 2017, 2017, e8045435. [Google Scholar] [CrossRef] [PubMed]
- Wearing, H.J.; Robert, M.A.; Christofferson, R.C. Dengue and Chikungunya: Modelling the Expansion of Mosquito-Borne Viruses into Naïve Populations. Parasitology 2016, 143, 860–873. [Google Scholar] [CrossRef] [PubMed]
- Rezza, G. Dengue and Chikungunya: Long-Distance Spread and Outbreaks in Naïve Areas. Pathog. Glob. Health 2014, 108, 349–355. [Google Scholar] [CrossRef] [PubMed]
- Grange, L.; Simon-Loriere, E.; Sakuntabhai, A.; Gresh, L.; Paul, R.; Harris, E. Epidemiological Risk Factors Associated with High Global Frequency of Inapparent Dengue Virus Infections. Front. Immunol. 2014, 5, 280. [Google Scholar] [CrossRef]
- Adelino, T.; Lima, M.; Guimarães, N.R.; Xavier, J.; Fonseca, V.; Tomé, L.M.R.; Pereira, M.A.; Machado, V.F.; Alcantara, L.C.J.; Iani, F.C.D.M.; et al. Resurgence of Dengue Virus Serotype 3 in Minas Gerais, Brazil: A Case Report. Pathogens 2024, 13, 202. [Google Scholar] [CrossRef]
- Dias, M.; Pattabiraman, C.; Siddappa, S.; Gowda, M.; Shet, A.; Smith, D.; Muehlemann, B.; Tamma, K.; Solomon, T.; Jones, T.; et al. Complete Assembly of a Dengue Virus Type 3 Genome from a Recent Genotype III Clade by Metagenomic Sequencing of Serum. Wellcome Open Res. 2019, 3, 44. [Google Scholar] [CrossRef] [PubMed]
- Vega-Rúa, A.; Zouache, K.; Girod, R.; Failloux, A.-B.; Lourenço-de-Oliveira, R. High Level of Vector Competence of Aedes Aegypti and Aedes Albopictus from Ten American Countries as a Crucial Factor in the Spread of Chikungunya Virus. J. Virol. 2014, 88, 6294–6306. [Google Scholar] [CrossRef] [PubMed]
- Allicock, O.M.; Lemey, P.; Tatem, A.J.; Pybus, O.G.; Bennett, S.N.; Mueller, B.A.; Suchard, M.A.; Foster, J.E.; Rambaut, A.; Carrington, C.V.F. Phylogeography and Population Dynamics of Dengue Viruses in the Americas. Mol. Biol. Evol. 2012, 29, 1533–1543. [Google Scholar] [CrossRef]
- Flamand, C.; Quenel, P.; Ardillon, V.; Carvalho, L.; Bringay, S.; Teisseire, M. The Epidemiologic Surveillance of Dengue-Fever in French Guiana: When Achievements Trigger Higher Goals. In User Centred Networked Health Care; IOS Press: Amsterdam, The Netherlands, 2011; pp. 629–633. [Google Scholar]
- Guzman, M.G.; Gubler, D.J.; Izquierdo, A.; Martinez, E.; Halstead, S.B. Dengue Infection. Nat. Rev. Dis. Primers 2016, 2, 16055. [Google Scholar] [CrossRef]
- Bos, S.; Graber, A.L.; Cardona-Ospina, J.A.; Duarte, E.M.; Zambrana, J.V.; Ruíz Salinas, J.A.; Mercado-Hernandez, R.; Singh, T.; Katzelnick, L.C.; de Silva, A.; et al. Protection against Symptomatic Dengue Infection by Neutralizing Antibodies Varies by Infection History and Infecting Serotype. Nat. Commun. 2024, 15, 382. [Google Scholar] [CrossRef] [PubMed]
- Pintado Silva, J.; Fernandez-Sesma, A. Challenges on the Development of a Dengue Vaccine: A Comprehensive Review of the State of the Art. J. Gen. Virol. 2023, 104, 001831. [Google Scholar] [CrossRef]
- Palanichamy Kala, M.; St John, A.L.; Rathore, A.P.S. Dengue: Update on Clinically Relevant Therapeutic Strategies and Vaccines. Curr. Treat Options. Infect. Dis. 2023, 15, 27–52. [Google Scholar] [CrossRef]
- Malik, S.; Ahsan, O.; Mumtaz, H.; Tahir Khan, M.; Sah, R.; Waheed, Y. Tracing down the Updates on Dengue Virus—Molecular Biology, Antivirals, and Vaccine Strategies. Vaccines 2023, 11, 1328. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.B.; Yang, Z.-S.; Lin, C.-Y.; Hsu, M.-C.; Urbina, A.N.; Assavalapsakul, W.; Wang, W.-H.; Chen, Y.-H.; Wang, S.-F. Dengue Overview: An Updated Systemic Review. J. Infect. Public Health 2023, 16, 1625–1642. [Google Scholar] [CrossRef]
- Hussain, Z.; Rani, S.; Ma, F.; Li, W.; Shen, W.; Gao, T.; Wang, J.; Pei, R. Dengue Determinants: Necessities and Challenges for Universal Dengue Vaccine Development. Rev. Med. Virol. 2023, 33, e2425. [Google Scholar] [CrossRef]
Territory | Total N with Ct < 26 | Municipality | Year (s) | N Selected | Municipality | Year(s) |
---|---|---|---|---|---|---|
Guadeloupe | 10 | 5 | ||||
3 | Baie-Mahault | 2019/2020 | 2 | Baie-Mahault | 2019/2020 | |
4 | Le Gosier | 2020 | 2 | Le Gosier | 2020 | |
1 | Les Abymes | 2020 | 1 | Les Abymes | 2020 | |
2 | Other | 2020 | ||||
Martinique | 75 | 7 | ||||
14 | Le Vauclin | 2019 | 1 | Le Vauclin | 2019 | |
5 | Les Trois-Îlets | 2019/2020 | 2 | Les Trois-Îlets | 2019/2020 | |
1 | Les Anses-d’Arlet | 2019 | 1 | Les Anses-d’Arlet | 2019 | |
4 | Le Robert | 2020 | 1 | Le Robert | 2020 | |
10 | Fort-de-France | 2019/2020 | 1 | Fort-de-France | 2020 | |
11 | Schoelcher | 2019/2020 | 1 | Schoelcher | 2020 | |
30 | Other | 2019/2020 | ||||
French Guiana | 1363 | 85 | ||||
119 | Cayenne | 2001/2013/2020/2021/2023/2024 | 11 | Cayenne | 2001/2013/2021/2023 | |
678 | Kourou | 2022/2023/2024 | 20 | Kourou | 2022/2023/2024 | |
251 | St-Laurent-du-Maroni | 2023/2024 | 12 | St-Laurent-du-Maroni | 2023/2024 | |
90 | Remire-Montjoly | 2020/2023/2024 | 7 | Remire-Montjoly | 2020/2023/2024 | |
37 | Tonate-Macouria | 2020/2023/2024 | 3 | Tonate-Macouria | 2020/2023/2024 | |
10 | Sinnamary | 2023/2024 | 4 | Sinnamary | 2023/2024 | |
3 | Iracoubo | 2023 | 1 | Iracoubo | 2023 | |
16 | Mana | 2023/2024 | 5 | Mana | 2023 | |
17 | Maripasoula | 2023/2024 | 6 | Maripasoula | 2023 | |
58 | Matoury | 2013/2020/2023/2024 | 7 | Matoury | 2020/2023/2024 | |
4 | Saint-Georges | 2023 | 1 | Saint-Georges | 2023 | |
2 | Antecum Pata | 2023 | 1 | Antecum Pata | 2023 | |
1 | Montsinery | 2023 | 1 | Montsinery | 2023 | |
26 | Grand-Santi | 2023/2024 | 3 | Grand-Santi | 2023 | |
10 | Apatou | 2023/2024 | 2 | Apatou | 2023 | |
3 | Papaïchton | 2023 | 1 | Papaïchton | 2023 | |
38 | Other | 2020/2023/2024 | ||||
Total | 1448 | 97 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lagrave, A.; Enfissi, A.; Tirera, S.; Demar, M.P.; Jaonasoa, J.; Carod, J.-F.; Ramavoson, T.; Succo, T.; Carvalho, L.; Devos, S.; et al. Re-Emergence of DENV-3 in French Guiana: Retrospective Analysis of Cases That Circulated in the French Territories of the Americas from the 2000s to the 2023–2024 Outbreak. Viruses 2024, 16, 1298. https://doi.org/10.3390/v16081298
Lagrave A, Enfissi A, Tirera S, Demar MP, Jaonasoa J, Carod J-F, Ramavoson T, Succo T, Carvalho L, Devos S, et al. Re-Emergence of DENV-3 in French Guiana: Retrospective Analysis of Cases That Circulated in the French Territories of the Americas from the 2000s to the 2023–2024 Outbreak. Viruses. 2024; 16(8):1298. https://doi.org/10.3390/v16081298
Chicago/Turabian StyleLagrave, Alisé, Antoine Enfissi, Sourakhata Tirera, Magalie Pierre Demar, Jean Jaonasoa, Jean-François Carod, Tsiriniaina Ramavoson, Tiphanie Succo, Luisiane Carvalho, Sophie Devos, and et al. 2024. "Re-Emergence of DENV-3 in French Guiana: Retrospective Analysis of Cases That Circulated in the French Territories of the Americas from the 2000s to the 2023–2024 Outbreak" Viruses 16, no. 8: 1298. https://doi.org/10.3390/v16081298
APA StyleLagrave, A., Enfissi, A., Tirera, S., Demar, M. P., Jaonasoa, J., Carod, J.-F., Ramavoson, T., Succo, T., Carvalho, L., Devos, S., Dorleans, F., Leon, L., Berlioz-Arthaud, A., Musso, D., Lavergne, A., & Rousset, D. (2024). Re-Emergence of DENV-3 in French Guiana: Retrospective Analysis of Cases That Circulated in the French Territories of the Americas from the 2000s to the 2023–2024 Outbreak. Viruses, 16(8), 1298. https://doi.org/10.3390/v16081298