Temporal Dynamics of Purinergic Receptor Expression in the Lungs of Marek’s Disease (MD) Virus-Infected Chickens Resistant or Susceptible to MD
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Approach
2.3. Sample Collection and RNA Extraction
2.4. Primers
2.5. RT-qPCR Analysis
2.6. Statistical Analysis
3. Results and Discussion
3.1. Confirmation of MDV Infection
3.2. Non-Purinergic Receptor Regulatory Gene Responses
3.2.1. DDX5
3.2.2. BCL2
3.2.3. ANGPTL4
3.2.4. STAT1A and STAT5A
3.2.5. Oxidative Stress Markers
3.2.6. Summary of Target Gene Responses
3.3. P1 PR Responses during Natural Infection
3.3.1. P1A1
3.3.2. P1A2A and P1A2B
3.3.3. P1A3
3.3.4. Summary of P1 PR Responses
3.4. P2X PR Responses during Natural Infection
3.4.1. P2X1, P2X2, and P2X3
3.4.2. P2X5
3.4.3. P2X7
3.4.4. P2X4 and P2X6
3.4.5. Summary of P2X PR Responses
3.5. P2Y PR Responses during Natural Infection
3.5.1. P2Y1
3.5.2. P2Y3/P2Y6
3.5.3. P2Y5
3.5.4. P2Y8
3.5.5. P2Y10
3.5.6. P2Y13
3.5.7. P2Y14
3.5.8. Summary of P2Y PR Responses
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jarosinski, K.W.; Tischer, B.K.; Trapp, S.; Osterrieder, N. Marek’s disease virus: Lytic replication, oncogenesis and control. Expert Rev. Vaccines 2006, 5, 761–772. [Google Scholar] [CrossRef] [PubMed]
- Calnek, B.W. Pathogenesis of Marek’s disease virus infection. In Current Topics in Microbiology and Immunology; Springer: Berlin/Heidelberg, Germany, 2001; Volume 255, pp. 25–55. [Google Scholar] [CrossRef]
- Zimmermann, H. Two novel families of ectonucleotidases: Molecular structures, catalytic properties and a search for function. Trends Pharmacol. Sci. 1999, 20, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Fields, R.D.; Burnstock, G. Purinergic signalling in neuron-glia interactions. Nat. Rev. Neurosci. 2006, 7, 423–436. [Google Scholar] [CrossRef] [PubMed]
- Burnstock, G. Purine-mediated signalling in pain and visceral perception. Trends Pharmacol. Sci. 2001, 22, 182–188. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.H.; Park, K.S.; Kong, I.D.; Kim, J.W.; Han, B.G. Expression of P2 receptors in human B cells and Epstein-Barr virus-transformed lymphoblastoid cell lines. BMC Immunol. 2006, 7, 22. [Google Scholar] [CrossRef] [PubMed]
- Ralevic, V.; Burnstock, G. Receptors for purines and pyrimidines. Pharmacol. Rev. 1998, 50, 413–492. [Google Scholar] [PubMed]
- Di Virgilio, F. Purines, purinergic receptors, and cancer. Cancer Res. 2012, 72, 5441–5447. [Google Scholar] [CrossRef]
- Akbar, H.; Fasick, J.J.; Ponnuraj, N.; Jarosinski, K.W. Purinergic signaling during Marek’s disease in chickens. Sci. Rep. 2023, 13, 2044. [Google Scholar] [CrossRef]
- Burnstock, G. Short- and long-term (trophic) purinergic signalling. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 2016, 371, 20150422. [Google Scholar] [CrossRef]
- Cekic, C.; Linden, J. Purinergic regulation of the immune system. Nat. Rev. Immunol. 2016, 16, 177–192. [Google Scholar] [CrossRef]
- Chen, S.; Shenk, T.; Nogalski, M.T. P2Y2 purinergic receptor modulates virus yield, calcium homeostasis, and cell motility in human cytomegalovirus-infected cells. Proc. Natl. Acad. Sci. USA 2019, 116, 18971–18982. [Google Scholar] [CrossRef] [PubMed]
- Awad, M.M.; Shaw, A.T. ALK inhibitors in non-small cell lung cancer: Crizotinib and beyond. Clin. Adv. Hematol. Oncol. 2014, 12, 429–439. [Google Scholar] [PubMed]
- Ohta, A.; Gorelik, E.; Prasad, S.J.; Ronchese, F.; Lukashev, D.; Wong, M.K.; Huang, X.; Caldwell, S.; Liu, K.; Smith, P.; et al. A2A adenosine receptor protects tumors from antitumor T cells. Proc. Natl. Acad. Sci. USA 2006, 103, 13132–13137. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Yan, Y.; He, H.; Wang, L.; Zhang, N.; Zhang, J.; Huang, H.; Wu, N.; Ren, H.; Qian, M.; et al. IFN-stimulated P2Y13 protects mice from viral infection by suppressing the cAMP/EPAC1 signaling pathway. J. Mol. Cell Biol. 2019, 11, 395–407. [Google Scholar] [CrossRef] [PubMed]
- Oliveira-Giacomelli, A.; Naaldijk, Y.; Sarda-Arroyo, L.; Goncalves, M.C.B.; Correa-Velloso, J.; Pillat, M.M.; de Souza, H.D.N.; Ulrich, H. Purinergic Receptors in Neurological Diseases With Motor Symptoms: Targets for Therapy. Front. Pharmacol. 2018, 9, 325. [Google Scholar] [CrossRef] [PubMed]
- Fekete, R.; Cserep, C.; Lenart, N.; Toth, K.; Orsolits, B.; Martinecz, B.; Mehes, E.; Szabo, B.; Nemeth, V.; Gonci, B.; et al. Microglia control the spread of neurotropic virus infection via P2Y12 signalling and recruit monocytes through P2Y12-independent mechanisms. Acta Neuropathol. 2018, 136, 461–482. [Google Scholar] [CrossRef] [PubMed]
- Zandberg, M.; van Son, W.J.; Harmsen, M.C.; Bakker, W.W. Infection of human endothelium in vitro by cytomegalovirus causes enhanced expression of purinergic receptors: A potential virus escape mechanism? Transplantation 2007, 84, 1343–1347. [Google Scholar] [CrossRef] [PubMed]
- Bailey, R.I.; Cheng, H.H.; Chase-Topping, M.; Mays, J.K.; Anacleto, O.; Dunn, J.R.; Doeschl-Wilson, A. Pathogen transmission from vaccinated hosts can cause dose-dependent reduction in virulence. PLoS Biol. 2020, 18, e3000619. [Google Scholar] [CrossRef] [PubMed]
- Baaten, B.J.; Staines, K.A.; Smith, L.P.; Skinner, H.; Davison, T.F.; Butter, C. Early replication in pulmonary B cells after infection with Marek’s disease herpesvirus by the respiratory route. Viral Immunol. 2009, 22, 431–444. [Google Scholar] [CrossRef]
- Krieter, A.; Xu, H.; Akbar, H.; Kim, T.; Jarosinski, K.W. The Conserved Herpesviridae Protein Kinase (CHPK) of Gallid alphaherpesvirus 3 (GaHV3) Is Required for Horizontal Spread and Natural Infection in Chickens. Viruses 2022, 14, 586. [Google Scholar] [CrossRef]
- Vega-Rodriguez, W.; Xu, H.; Ponnuraj, N.; Akbar, H.; Kim, T.; Jarosinski, K.W. The requirement of glycoprotein C (gC) for interindividual spread is a conserved function of gC for avian herpesviruses. Sci. Rep. 2021, 11, 7753. [Google Scholar] [CrossRef] [PubMed]
- Akbar, H.; Bionaz, M.; Carlson, D.B.; Rodriguez-Zas, S.L.; Everts, R.E.; Lewin, H.A.; Drackley, J.K.; Loor, J.J. Feed restriction, but not l-carnitine infusion, alters the liver transcriptome by inhibiting sterol synthesis and mitochondrial oxidative phosphorylation and increasing gluconeogenesis in mid-lactation dairy cows. J. Dairy Sci. 2013, 96, 2201–2213. [Google Scholar] [CrossRef] [PubMed]
- Ponnuraj, N.; Tien, Y.T.; Vega-Rodriguez, W.; Krieter, A.; Jarosinski, K.W. The Herpesviridae Conserved Multifunctional Infected-Cell Protein 27 (ICP27) Is Important but Not Required for Replication and Oncogenicity of Marek’s Disease Alphaherpesvirus. J. Virol. 2019, 93, e01903–e01918. [Google Scholar] [CrossRef] [PubMed]
- Boodhoo, N.; Gurung, A.; Sharif, S.; Behboudi, S. Marek’s disease in chickens: A review with focus on immunology. Vet. Res. 2016, 47, 119. [Google Scholar] [CrossRef] [PubMed]
- Esnault, E.; Bonsergent, C.; Larcher, T.; Bed’hom, B.; Vautherot, J.F.; Delaleu, B.; Guigand, L.; Soubieux, D.; Marc, D.; Quere, P. A novel chicken lung epithelial cell line: Characterization and response to low pathogenicity avian influenza virus. Virus Res. 2011, 159, 32–42. [Google Scholar] [CrossRef] [PubMed]
- Nganpiep, L.N.; Maina, J.N. Composite cellular defence stratagem in the avian respiratory system: Functional morphology of the free (surface) macrophages and specialized pulmonary epithelia. J. Anat. 2002, 200, 499–516. [Google Scholar] [CrossRef]
- Reese, S.; Dalamani, G.; Kaspers, B. The avian lung-associated immune system: A review. Vet. Res. 2006, 37, 311–324. [Google Scholar] [CrossRef] [PubMed]
- Maina, J.N. Some recent advances on the study and understanding of the functional design of the avian lung: Morphological and morphometric perspectives. Biol. Rev. Camb. Philos. Soc. 2002, 77, 97–152. [Google Scholar] [CrossRef]
- Hu, M.; Zheng, H.; Wu, J.; Sun, Y.; Wang, T.; Chen, S. DDX5: An expectable treater for viral infection- a literature review. Ann. Transl. Med. 2022, 10, 712. [Google Scholar] [CrossRef]
- Yoo, J.K.; Kim, T.S.; Hufford, M.M.; Braciale, T.J. Viral infection of the lung: Host response and sequelae. J. Allergy Clin. Immunol. 2013, 132, 1263–1276, quiz 1277. [Google Scholar] [CrossRef]
- Cui, J.; Chen, Y.; Wang, H.Y.; Wang, R.F. Mechanisms and pathways of innate immune activation and regulation in health and cancer. Hum. Vaccines Immunother. 2014, 10, 3270–3285. [Google Scholar] [CrossRef]
- Liu, S.; Cai, X.; Wu, J.; Cong, Q.; Chen, X.; Li, T.; Du, F.; Ren, J.; Wu, Y.T.; Grishin, N.V.; et al. Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation. Science 2015, 347, aaa2630. [Google Scholar] [CrossRef]
- Levy, D.E.; Garcia-Sastre, A. The virus battles: IFN induction of the antiviral state and mechanisms of viral evasion. Cytokine Growth Factor Rev. 2001, 12, 143–156. [Google Scholar] [CrossRef] [PubMed]
- Majoros, A.; Platanitis, E.; Kernbauer-Holzl, E.; Rosebrock, F.; Muller, M.; Decker, T. Canonical and Non-Canonical Aspects of JAK-STAT Signaling: Lessons from Interferons for Cytokine Responses. Front. Immunol. 2017, 8, 29. [Google Scholar] [CrossRef]
- Platanias, L.C. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat. Rev. Immunol. 2005, 5, 375–386. [Google Scholar] [CrossRef]
- Zan, J.; Xu, R.; Tang, X.; Lu, M.; Xie, S.; Cai, J.; Huang, Z.; Zhang, J. RNA helicase DDX5 suppresses IFN-I antiviral innate immune response by interacting with PP2A-Cbeta to deactivate IRF3. Exp. Cell Res. 2020, 396, 112332. [Google Scholar] [CrossRef] [PubMed]
- Wiens, M.; Belikov, S.I.; Kaluzhnaya, O.V.; Schroder, H.C.; Hamer, B.; Perovic-Ottstadt, S.; Borejko, A.; Luthringer, B.; Muller, I.M.; Muller, W.E. Axial (apical-basal) expression of pro-apoptotic and pro-survival genes in the lake baikal demosponge Lubomirskia baicalensis. DNA Cell Biol. 2006, 25, 152–164. [Google Scholar] [CrossRef]
- Polster, B.M.; Pevsner, J.; Hardwick, J.M. Viral Bcl-2 homologs and their role in virus replication and associated diseases. Biochim. Biophys. Acta 2004, 1644, 211–227. [Google Scholar] [CrossRef] [PubMed]
- Kvansakul, M.; Caria, S.; Hinds, M.G. The Bcl-2 Family in Host-Virus Interactions. Viruses 2017, 9, 290. [Google Scholar] [CrossRef]
- Liang, Q.; Chang, B.; Lee, P.; Brulois, K.F.; Ge, J.; Shi, M.; Rodgers, M.A.; Feng, P.; Oh, B.H.; Liang, C.; et al. Identification of the Essential Role of Viral Bcl-2 for Kaposi’s Sarcoma-Associated Herpesvirus Lytic Replication. J. Virol. 2015, 89, 5308–5317. [Google Scholar] [CrossRef]
- Trapp-Fragnet, L.; Schermuly, J.; Kohn, M.; Bertzbach, L.D.; Pfaff, F.; Denesvre, C.; Kaufer, B.B.; Hartle, S. Marek’s disease virus prolongs survival of primary chicken B-cells by inducing a senescence-like phenotype. PLoS Pathog. 2021, 17, e1010006. [Google Scholar] [CrossRef]
- Linnik, M.D.; Zahos, P.; Geschwind, M.D.; Federoff, H.J. Expression of bcl-2 from a defective herpes simplex virus-1 vector limits neuronal death in focal cerebral ischemia. Stroke 1995, 26, 1670–1674, discussion 1675. [Google Scholar] [CrossRef]
- Zheng, C.; Liang, Z.; Lin, Q.; Chen, M.; Chang, C.; Zhou, J.; Yang, F.; Chen, Y.; Zhao, M.; Huang, L.; et al. Pathology, viremia, apoptosis during MDV latency in vaccinated chickens. Virology 2023, 579, 169–177. [Google Scholar] [CrossRef]
- Engel, A.T.; Selvaraj, R.K.; Kamil, J.P.; Osterrieder, N.; Kaufer, B.B. Marek’s disease viral interleukin-8 promotes lymphoma formation through targeted recruitment of B cells and CD4+ CD25+ T cells. J. Virol. 2012, 86, 8536–8545. [Google Scholar] [CrossRef]
- Tan, M.J.; Teo, Z.; Sng, M.K.; Zhu, P.; Tan, N.S. Emerging roles of angiopoietin-like 4 in human cancer. Mol. Cancer Res. 2012, 10, 677–688. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Chong, H.C.; Ng, S.Y.; Kwok, K.W.; Teo, Z.; Tan, E.H.P.; Choo, C.C.; Seet, J.E.; Choi, H.W.; Buist, M.L.; et al. Angiopoietin-like 4 Increases Pulmonary Tissue Leakiness and Damage during Influenza Pneumonia. Cell Rep. 2015, 10, 654–663. [Google Scholar] [CrossRef] [PubMed]
- Tolomeo, M.; Cavalli, A.; Cascio, A. STAT1 and Its Crucial Role in the Control of Viral Infections. Int. J. Mol. Sci. 2022, 23, 4095. [Google Scholar] [CrossRef]
- Tanabe, Y.; Nishibori, T.; Su, L.; Arduini, R.M.; Baker, D.P.; David, M. Cutting edge: Role of STAT1, STAT3, and STAT5 in IFN-alpha beta responses in T lymphocytes. J. Immunol. 2005, 174, 609–613. [Google Scholar] [CrossRef] [PubMed]
- Rapp, M.; Wiedemann, G.M.; Sun, J.C. Memory responses of innate lymphocytes and parallels with T cells. Semin. Immunopathol. 2018, 40, 343–355. [Google Scholar] [CrossRef]
- Wiedemann, G.M.; Grassmann, S.; Lau, C.M.; Rapp, M.; Villarino, A.V.; Friedrich, C.; Gasteiger, G.; O’Shea, J.J.; Sun, J.C. Divergent Role for STAT5 in the Adaptive Responses of Natural Killer Cells. Cell Rep. 2020, 33, 108498. [Google Scholar] [CrossRef]
- Kelly, J.; Spolski, R.; Imada, K.; Bollenbacher, J.; Lee, S.; Leonard, W.J. A role for Stat5 in CD8+ T cell homeostasis. J. Immunol. 2003, 170, 210–217. [Google Scholar] [CrossRef] [PubMed]
- Burchill, M.A.; Goetz, C.A.; Prlic, M.; O’Neil, J.J.; Harmon, I.R.; Bensinger, S.J.; Turka, L.A.; Brennan, P.; Jameson, S.C.; Farrar, M.A. Distinct effects of STAT5 activation on CD4+ and CD8+ T cell homeostasis: Development of CD4+CD25+ regulatory T cells versus CD8+ memory T cells. J. Immunol. 2003, 171, 5853–5864. [Google Scholar] [CrossRef] [PubMed]
- Hand, T.W.; Cui, W.; Jung, Y.W.; Sefik, E.; Joshi, N.S.; Chandele, A.; Liu, Y.; Kaech, S.M. Differential effects of STAT5 and PI3K/AKT signaling on effector and memory CD8 T-cell survival. Proc. Natl. Acad. Sci. USA 2010, 107, 16601–16606. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Zong, W.; Zhang, H.; Liu, R. Kidney Toxicity and Response of Selenium Containing Protein-glutathione Peroxidase (Gpx3) to CdTe QDs on Different Levels. Toxicol. Sci. 2019, 168, 201–208. [Google Scholar] [CrossRef]
- Pei, J.; Pan, X.; Wei, G.; Hua, Y. Research progress of glutathione peroxidase family (GPX) in redoxidation. Front. Pharmacol. 2023, 14, 1147414. [Google Scholar] [CrossRef] [PubMed]
- Delgado-Roche, L.; Mesta, F. Oxidative Stress as Key Player in Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection. Arch. Med. Res. 2020, 51, 384–387. [Google Scholar] [CrossRef] [PubMed]
- Kliszczewska, E.; Strycharz-Dudziak, M.; Polz-Dacewicz, M. The role of oxidative stress in cancer associated with viral infection. J. Pre-Clin. Clin. Res. 2018, 12, 41–44. [Google Scholar] [CrossRef]
- Schwarz, K.B. Oxidative stress during viral infection: A review. Free Radic. Biol. Med. 1996, 21, 641–649. [Google Scholar] [CrossRef] [PubMed]
- Peterhans, E. Reactive oxygen species and nitric oxide in viral diseases. Biol. Trace Elem. Res. 1997, 56, 107–116. [Google Scholar] [CrossRef]
- Damle, V.G.; Wu, K.; Arouri, D.J.; Schirhagl, R. Detecting free radicals post viral infections. Free Radic. Biol. Med. 2022, 191, 8–23. [Google Scholar] [CrossRef]
- Rehman, Z.U.; Meng, C.; Sun, Y.; Safdar, A.; Pasha, R.H.; Munir, M.; Ding, C. Oxidative Stress in Poultry: Lessons from the Viral Infections. Oxid. Med. Cell. Longev. 2018, 2018, 5123147. [Google Scholar] [CrossRef]
- Keles, H.; Fidan, A.F.; Cigerci, I.H.; Kucukkurt, I.; Karadas, E.; Dundar, Y. Increased DNA damage and oxidative stress in chickens with natural Marek’s disease. Vet. Immunol. Immunopathol. 2010, 133, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Kishore, K.R.; Padmaja, K.; Prasad, P.E.; Kumari, B.P. Oxidative Stress in Liver Tissues of Marek’s Disease Affected Layer Chicken. Chem. Sci. Rev. Lett. 2017, 24, 2138–2143. [Google Scholar]
- Narayanan, A.; Popova, T.; Turell, M.; Kidd, J.; Chertow, J.; Popov, S.G.; Bailey, C.; Kashanchi, F.; Kehn-Hall, K. Alteration in superoxide dismutase 1 causes oxidative stress and p38 MAPK activation following RVFV infection. PLoS ONE 2011, 6, e20354. [Google Scholar] [CrossRef]
- Hao, Y.; Li, Q.; Qu, Q.; Xu, B.; Wei, P. Changes of activity of Se-GSH-PX and the content of LPO in chickens infected with vMDV. Chin. J. Vet. Sci. 1999, 19, 218–220. [Google Scholar]
- Bencherit, D.; Remy, S.; Le Vern, Y.; Vychodil, T.; Bertzbach, L.D.; Kaufer, B.B.; Denesvre, C.; Trapp-Fragnet, L. Induction of DNA Damages upon Marek’s Disease Virus Infection: Implication in Viral Replication and Pathogenesis. J. Virol. 2017, 91, e01658-17. [Google Scholar] [CrossRef]
- Varani, K.; Vincenzi, F.; Merighi, S.; Gessi, S.; Borea, P.A. Biochemical and Pharmacological Role of A1 Adenosine Receptors and Their Modulation as Novel Therapeutic Strategy. Adv. Exp. Med. Biol. 2017, 1051, 193–232. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Yu, J.; Du, L.; Tang, J.; Feng, W.H. Cordycepin enhances Epstein-Barr virus lytic infection and Epstein-Barr virus-positive tumor treatment efficacy by doxorubicin. Cancer Lett. 2016, 376, 240–248. [Google Scholar] [CrossRef] [PubMed]
- Ryu, E.; Son, M.; Lee, M.; Lee, K.; Cho, J.Y.; Cho, S.; Lee, S.K.; Lee, Y.M.; Cho, H.; Sung, G.H.; et al. Cordycepin is a novel chemical suppressor of Epstein-Barr virus replication. Oncoscience 2014, 1, 866–881. [Google Scholar] [CrossRef]
- Choi, S.J.; Ryu, E.; Lee, S.; Huh, S.; Shin, Y.S.; Kang, B.W.; Kim, J.G.; Cho, H.; Kang, H. Adenosine Induces EBV Lytic Reactivation through ADORA1 in EBV-Associated Gastric Carcinoma. Int. J. Mol. Sci. 2019, 20, 1286. [Google Scholar] [CrossRef]
- Lazarowski, E.R.; Boucher, R.C. Purinergic receptors in airway hydration. Biochem. Pharmacol. 2021, 187, 114387. [Google Scholar] [CrossRef] [PubMed]
- Barletta, K.E.; Cagnina, R.E.; Burdick, M.D.; Linden, J.; Mehrad, B. Adenosine A2B receptor deficiency promotes host defenses against gram-negative bacterial pneumonia. Am. J. Respir. Crit. Care Med. 2012, 186, 1044–1050. [Google Scholar] [CrossRef]
- Strickland, L.N.; Faraoni, E.Y.; Ruan, W.; Yuan, X.; Eltzschig, H.K.; Bailey-Lundberg, J.M. The resurgence of the Adora2b receptor as an immunotherapeutic target in pancreatic cancer. Front. Immunol. 2023, 14, 1163585. [Google Scholar] [CrossRef] [PubMed]
- Granja, T.F.; Kohler, D.; Schad, J.; de Oliveira, C.B.; Konrad, F.; Hoch-Gutbrod, M.; Streienberger, A.; Rosenberger, P.; Straub, A. Adenosine Receptor Adora2b Plays a Mechanistic Role in the Protective Effect of the Volatile Anesthetic Sevoflurane during Liver Ischemia/Reperfusion. Anesthesiology 2016, 125, 547–560. [Google Scholar] [CrossRef] [PubMed]
- Fishman, P.; Bar-Yehuda, S.; Liang, B.T.; Jacobson, K.A. Pharmacological and therapeutic effects of A3 adenosine receptor agonists. Drug Discov. Today 2012, 17, 359–366. [Google Scholar] [CrossRef]
- Bar-Yehuda, S.; Stemmer, S.M.; Madi, L.; Castel, D.; Ochaion, A.; Cohen, S.; Barer, F.; Zabutti, A.; Perez-Liz, G.; Del Valle, L.; et al. The A3 adenosine receptor agonist CF102 induces apoptosis of hepatocellular carcinoma via de-regulation of the Wnt and NF-kappaB signal transduction pathways. Int. J. Oncol. 2008, 33, 287–295. [Google Scholar] [PubMed]
- Fishman, P.; Bar-Yehuda, S.; Ohana, G.; Barer, F.; Ochaion, A.; Erlanger, A.; Madi, L. An agonist to the A3 adenosine receptor inhibits colon carcinoma growth in mice via modulation of GSK-3 beta and NF-kappa B. Oncogene 2004, 23, 2465–2471. [Google Scholar] [CrossRef] [PubMed]
- Sarwar, S.; Mulla, M.; Mulla, M.; Tanveer, R.; Sabir, M.; Sultan, A.; Malik, S.A. Human papillomavirus, tobacco, and poor oral hygiene can act synergetically, modulate the expression of the nuclear factor kappa B signaling pathway for the development and progression of head and neck cancer in the Pakistani population. Chin. Med. J. 2022, 135, 1829–1836. [Google Scholar] [CrossRef] [PubMed]
- Mazziotta, C.; Rotondo, J.C.; Lanzillotti, C.; Campione, G.; Martini, F.; Tognon, M. Cancer biology and molecular genetics of A3 adenosine receptor. Oncogene 2022, 41, 301–308. [Google Scholar] [CrossRef]
- Kumar, S.; Kunec, D.; Buza, J.J.; Chiang, H.I.; Zhou, H.; Subramaniam, S.; Pendarvis, K.; Cheng, H.H.; Burgess, S.C. Nuclear Factor kappa B is central to Marek’s disease herpesvirus induced neoplastic transformation of CD30 expressing lymphocytes in-vivo. BMC Syst. Biol. 2012, 6, 123. [Google Scholar] [CrossRef]
- Fishman, P.; Bar-Yehuda, S.; Madi, L.; Rath-Wolfson, L.; Ochaion, A.; Cohen, S.; Baharav, E. The PI3K-NF-kappaB signal transduction pathway is involved in mediating the anti-inflammatory effect of IB-MECA in adjuvant-induced arthritis. Arthritis Res. Ther. 2006, 8, R33. [Google Scholar] [CrossRef] [PubMed]
- Varani, K.; Vincenzi, F.; Tosi, A.; Targa, M.; Masieri, F.F.; Ongaro, A.; De Mattei, M.; Massari, L.; Borea, P.A. Expression and functional role of adenosine receptors in regulating inflammatory responses in human synoviocytes. Br. J. Pharmacol. 2010, 160, 101–115. [Google Scholar] [CrossRef] [PubMed]
- Abdul-Careem, M.F.; Haq, K.; Shanmuganathan, S.; Read, L.R.; Schat, K.A.; Heidari, M.; Sharif, S. Induction of innate host responses in the lungs of chickens following infection with a very virulent strain of Marek’s disease virus. Virology 2009, 393, 250–257. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Xia, Y. Beneficial and detrimental role of adenosine signaling in diseases and therapy. J. Appl. Physiol. 2015, 119, 1173–1182. [Google Scholar] [CrossRef] [PubMed]
- Grk, M.; Milic, V.; Dolzan, V.; Maksimovic, N.; Damnjanovic, T.; Pjevic, M.D.; Pesic, M.; Novakovic, I.; Jekic, B. Analysis of association of ADORA2A and ADORA3 polymorphisms genotypes/haplotypes with efficacy and toxicity of methotrexate in patients with Rheumatoid arthritis. Pharmacogenom. J. 2020, 20, 784–791. [Google Scholar] [CrossRef] [PubMed]
- Layhadi, J.A.; Fountain, S.J. P2X4 Receptor-Dependent Ca2+ Influx in Model Human Monocytes and Macrophages. Int. J. Mol. Sci. 2017, 18, 2261. [Google Scholar] [CrossRef]
- Radford, K.M.; Virginio, C.; Surprenant, A.; North, R.A.; Kawashima, E. Baculovirus expression provides direct evidence for heteromeric assembly of P2X2 and P2X3 receptors. J. Neurosci. Off. J. Soc. Neurosci. 1997, 17, 6529–6533. [Google Scholar] [CrossRef] [PubMed]
- Rong, W.; Gourine, A.V.; Cockayne, D.A.; Xiang, Z.; Ford, A.P.; Spyer, K.M.; Burnstock, G. Pivotal role of nucleotide P2X2 receptor subunit of the ATP-gated ion channel mediating ventilatory responses to hypoxia. J. Neurosci. Off. J. Soc. Neurosci. 2003, 23, 11315–11321. [Google Scholar] [CrossRef] [PubMed]
- Ford, A.P.; Undem, B.J. The therapeutic promise of ATP antagonism at P2X3 receptors in respiratory and urological disorders. Front. Cell. Neurosci. 2013, 7, 267. [Google Scholar] [CrossRef]
- Kwong, K.; Kollarik, M.; Nassenstein, C.; Ru, F.; Undem, B.J. P2X2 receptors differentiate placodal vs. neural crest C-fiber phenotypes innervating guinea pig lungs and esophagus. Am. J. Physiol. Lung Cell. Mol. Physiol. 2008, 295, L858–L865. [Google Scholar] [CrossRef]
- Nassenstein, C.; Taylor-Clark, T.E.; Myers, A.C.; Ru, F.; Nandigama, R.; Bettner, W.; Undem, B.J. Phenotypic distinctions between neural crest and placodal derived vagal C-fibres in mouse lungs. J. Physiol. 2010, 588, 4769–4783. [Google Scholar] [CrossRef] [PubMed]
- Jeong, Y.H.; Walsh, M.C.; Yu, J.; Shen, H.; Wherry, E.J.; Choi, Y. Mice Lacking the Purinergic Receptor P2X5 Exhibit Defective Inflammasome Activation and Early Susceptibility to Listeria monocytogenes. J. Immunol. 2020, 205, 760–766. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Walsh, M.C.; Takegahara, N.; Middleton, S.A.; Shin, H.I.; Kim, J.; Choi, Y. The purinergic receptor P2X5 regulates inflammasome activity and hyper-multinucleation of murine osteoclasts. Sci. Rep. 2017, 7, 196. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Hong, L.J.; Huang, J.Y.; Jiang, Q.; Tao, R.R.; Tan, C.; Lu, N.N.; Wang, C.K.; Ahmed, M.M.; Lu, Y.M.; et al. P2RX7 sensitizes Mac-1/ICAM-1-dependent leukocyte-endothelial adhesion and promotes neurovascular injury during septic encephalopathy. Cell Res. 2015, 25, 674–690. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhao, J.; Wang, H.; Liang, Y.; Yang, N.; Huang, Y. Blockage of P2X7 attenuates acute lung injury in mice by inhibiting NLRP3 inflammasome. Int. Immunopharmacol. 2015, 27, 38–45. [Google Scholar] [CrossRef] [PubMed]
- Mishra, A.; Guo, Y.; Zhang, L.; More, S.; Weng, T.; Chintagari, N.R.; Huang, C.; Liang, Y.; Pushparaj, S.; Gou, D.; et al. A Critical Role for P2X7 Receptor-Induced VCAM-1 Shedding and Neutrophil Infiltration during Acute Lung Injury. J. Immunol. 2016, 197, 2828–2837. [Google Scholar] [CrossRef]
- Zhao, H.; Chen, Y.; Feng, H. P2X7 Receptor-Associated Programmed Cell Death in the Pathophysiology of Hemorrhagic Stroke. Curr. Neuropharmacol. 2018, 16, 1282–1295. [Google Scholar] [CrossRef] [PubMed]
- Bian, S.; Sun, X.; Bai, A.; Zhang, C.; Li, L.; Enjyoji, K.; Junger, W.G.; Robson, S.C.; Wu, Y. P2X7 integrates PI3K/AKT and AMPK-PRAS40-mTOR signaling pathways to mediate tumor cell death. PLoS ONE 2013, 8, e60184. [Google Scholar] [CrossRef] [PubMed]
- Savio, L.E.B.; de Andrade Mello, P.; Figliuolo, V.R.; de Avelar Almeida, T.F.; Santana, P.T.; Oliveira, S.D.S.; Silva, C.L.M.; Feldbrugge, L.; Csizmadia, E.; Minshall, R.D.; et al. CD39 limits P2X7 receptor inflammatory signaling and attenuates sepsis-induced liver injury. J. Hepatol. 2017, 67, 716–726. [Google Scholar] [CrossRef]
- Savio, L.E.B.; de Andrade Mello, P.; da Silva, C.G.; Coutinho-Silva, R. The P2X7 Receptor in Inflammatory Diseases: Angel or Demon? Front. Pharmacol. 2018, 9, 52. [Google Scholar] [CrossRef]
- North, R.A. P2X receptors. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 2016, 371, 20150427. [Google Scholar] [CrossRef]
- Sellers, L.A.; Simon, J.; Lundahl, T.S.; Cousens, D.J.; Humphrey, P.P.; Barnard, E.A. Adenosine nucleotides acting at the human P2Y1 receptor stimulate mitogen-activated protein kinases and induce apoptosis. J. Biol. Chem. 2001, 276, 16379–16390. [Google Scholar] [CrossRef]
- Zerr, M.; Hechler, B.; Freund, M.; Magnenat, S.; Lanois, I.; Cazenave, J.P.; Leon, C.; Gachet, C. Major contribution of the P2Y1receptor in purinergic regulation of TNFalpha-induced vascular inflammation. Circulation 2011, 123, 2404–2413. [Google Scholar] [CrossRef]
- Ferrari, D.; la Sala, A.; Milani, D.; Celeghini, C.; Casciano, F. Purinergic Signaling in Controlling Macrophage and T Cell Functions During Atherosclerosis Development. Front. Immunol. 2020, 11, 617804. [Google Scholar] [CrossRef]
- Niethamer, T.K.; Stabler, C.T.; Leach, J.P.; Zepp, J.A.; Morley, M.P.; Babu, A.; Zhou, S.; Morrisey, E.E. Defining the role of pulmonary endothelial cell heterogeneity in the response to acute lung injury. eLife 2020, 9, e53072. [Google Scholar] [CrossRef]
- Burnstock, G. Purinergic signalling in endocrine organs. Purinergic Signal 2014, 10, 189–231. [Google Scholar] [CrossRef]
- Schuchardt, M.; Tolle, M.; van der Giet, M. P2Y purinoceptors as potential emerging therapeutical target in vascular disease. Curr. Pharm. Des. 2012, 18, 6169–6180. [Google Scholar] [CrossRef]
- Uehara, K.; Uehara, A. P2Y1, P2Y6, and P2Y12 receptors in rat splenic sinus endothelial cells: An immunohistochemical and ultrastructural study. Histochem. Cell Biol. 2011, 136, 557–567. [Google Scholar] [CrossRef]
- Geary, C.; Akinbi, H.; Korfhagen, T.; Fabre, J.E.; Boucher, R.; Rice, W. Increased susceptibility of purinergic receptor-deficient mice to lung infection with Pseudomonas aeruginosa. Am. J. Physiol. Lung Cell. Mol. Physiol. 2005, 289, L890–L895. [Google Scholar] [CrossRef]
- Li, Q.; Olesky, M.; Palmer, R.K.; Harden, T.K.; Nicholas, R.A. Evidence that the p2y3 receptor is the avian homologue of the mammalian P2Y6 receptor. Mol. Pharmacol. 1998, 54, 541–546. [Google Scholar] [CrossRef]
- Vieira, R.P.; Muller, T.; Grimm, M.; von Gernler, V.; Vetter, B.; Durk, T.; Cicko, S.; Ayata, C.K.; Sorichter, S.; Robaye, B.; et al. Purinergic receptor type 6 contributes to airway inflammation and remodeling in experimental allergic airway inflammation. Am. J. Respir. Crit. Care Med. 2011, 184, 215–223. [Google Scholar] [CrossRef]
- Huipao, N.; Borwornpinyo, S.; Wiboon-Ut, S.; Campbell, C.R.; Lee, I.H.; Hiranyachattada, S.; Sukasem, C.; Thitithanyanont, A.; Pholpramool, C.; Cook, D.I.; et al. P2Y6 receptors are involved in mediating the effect of inactivated avian influenza virus H5N1 on IL-6 & CXCL8 mRNA expression in respiratory epithelium. PLoS ONE 2017, 12, e0176974. [Google Scholar] [CrossRef]
- Li, R.; Tan, B.; Yan, Y.; Ma, X.; Zhang, N.; Zhang, Z.; Liu, M.; Qian, M.; Du, B. Extracellular UDP and P2Y6 function as a danger signal to protect mice from vesicular stomatitis virus infection through an increase in IFN-beta production. J. Immunol. 2014, 193, 4515–4526. [Google Scholar] [CrossRef]
- Lee, M.; Choi, S.; Hallden, G.; Yo, S.J.; Schichnes, D.; Aponte, G.W. P2Y5 is a Gαi, Gα12/13 G protein-coupled receptor activated by lysophosphatidic acid that reduces intestinal cell adhesion. Am. J. Physiol. Gastrointest. Liver Physiol. 2009, 297, G641–G654. [Google Scholar] [CrossRef]
- Takahashi, K.; Fukushima, K.; Onishi, Y.; Inui, K.; Node, Y.; Fukushima, N.; Honoki, K.; Tsujiuchi, T. Lysophosphatidic acid (LPA) signaling via LPA4 and LPA6 negatively regulates cell motile activities of colon cancer cells. Biochem. Biophys. Res. Commun. 2017, 483, 652–657. [Google Scholar] [CrossRef]
- Yang, Y.M.; Kuen, D.S.; Chung, Y.; Kurose, H.; Kim, S.G. Gα12/13 signaling in metabolic diseases. Exp. Mol. Med. 2020, 52, 896–910. [Google Scholar] [CrossRef]
- Richerioux, N.; Blondeau, C.; Wiedemann, A.; Remy, S.; Vautherot, J.F.; Denesvre, C. Rho-ROCK and Rac-PAK signaling pathways have opposing effects on the cell-to-cell spread of Marek’s Disease Virus. PLoS ONE 2012, 7, e44072. [Google Scholar] [CrossRef]
- Sturm, A.; Sudermann, T.; Schulte, K.M.; Goebell, H.; Dignass, A.U. Modulation of intestinal epithelial wound healing in vitro and in vivo by lysophosphatidic acid. Gastroenterology 1999, 117, 368–377. [Google Scholar] [CrossRef]
- Yanagida, K.; Ishii, S.; Hamano, F.; Noguchi, K.; Shimizu, T. LPA4/p2y9/GPR23 mediates rho-dependent morphological changes in a rat neuronal cell line. J. Biol. Chem. 2007, 282, 5814–5824. [Google Scholar] [CrossRef]
- Cantagrel, V.; Lossi, A.M.; Boulanger, S.; Depetris, D.; Mattei, M.G.; Gecz, J.; Schwartz, C.E.; Van Maldergem, L.; Villard, L. Disruption of a new X linked gene highly expressed in brain in a family with two mentally retarded males. J. Med. Genet. 2004, 41, 736–742. [Google Scholar] [CrossRef]
- Fujiwara, S.; Yamashita, Y.; Choi, Y.L.; Watanabe, H.; Kurashina, K.; Soda, M.; Enomoto, M.; Hatanaka, H.; Takada, S.; Ozawa, K.; et al. Transforming activity of purinergic receptor P2Y, G protein coupled, 8 revealed by retroviral expression screening. Leuk. Lymphoma 2007, 48, 978–986. [Google Scholar] [CrossRef]
- Hertzberg, L.; Vendramini, E.; Ganmore, I.; Cazzaniga, G.; Schmitz, M.; Chalker, J.; Shiloh, R.; Iacobucci, I.; Shochat, C.; Zeligson, S.; et al. Down syndrome acute lymphoblastic leukemia, a highly heterogeneous disease in which aberrant expression of CRLF2 is associated with mutated JAK2: A report from the International BFM Study Group. Blood 2010, 115, 1006–1017. [Google Scholar] [CrossRef]
- Morak, M.; Attarbaschi, A.; Fischer, S. Small sizes and indolent evolutionary dynamics challenge the potential role of P2RY8-CRLF2-harboring clones as main relapse-driving force in childhood ALL. Blood 2012, 120, 5134–5142, Erratum in Blood 2013, 122, 1328. [Google Scholar] [CrossRef]
- Rao, S.; Garrett-Sinha, L.A.; Yoon, J.; Simon, M.C. The Ets factors PU.1 and Spi-B regulate the transcription in vivo of P2Y10, a lymphoid restricted heptahelical receptor. J. Biol. Chem. 1999, 274, 34245–34252. [Google Scholar] [CrossRef]
- Hwang, S.M.; Kim, H.J.; Kim, S.M.; Jung, Y.; Park, S.W.; Chung, I.Y. Lysophosphatidylserine receptor P2Y10: A G protein-coupled receptor that mediates eosinophil degranulation. Clin. Exp. Allergy 2018, 48, 990–999. [Google Scholar] [CrossRef]
- Makide, K.; Uwamizu, A.; Shinjo, Y.; Ishiguro, J.; Okutani, M.; Inoue, A.; Aoki, J. Novel lysophosphoplipid receptors: Their structure and function. J. Lipid Res. 2014, 55, 1986–1995. [Google Scholar] [CrossRef]
- Murakami, M.; Shiraishi, A.; Tabata, K.; Fujita, N. Identification of the orphan GPCR, P2Y10 receptor as the sphingosine-1-phosphate and lysophosphatidic acid receptor. Biochem. Biophys. Res. Commun. 2008, 371, 707–712. [Google Scholar] [CrossRef]
- Im, D.S. Intercellular Lipid Mediators and GPCR Drug Discovery. Biomol. Ther. 2013, 21, 411–422. [Google Scholar] [CrossRef]
- Gurusamy, M.; Tischner, D.; Shao, J.; Klatt, S.; Zukunft, S.; Bonnavion, R.; Gunther, S.; Siebenbrodt, K.; Kestner, R.I.; Kuhlmann, T.; et al. G-protein-coupled receptor P2Y10 facilitates chemokine-induced CD4 T cell migration through autocrine/paracrine mediators. Nat. Commun. 2021, 12, 6798. [Google Scholar] [CrossRef]
- Thompson, R.J.; Sayers, I.; Kuokkanen, K.; Hall, I.P. Purinergic Receptors in the Airways: Potential Therapeutic Targets for Asthma? Front. Allergy 2021, 2, 677677. [Google Scholar] [CrossRef]
- Maynard, J.P.; Lee, J.S.; Sohn, B.H.; Yu, X.; Lopez-Terrada, D.; Finegold, M.J.; Goss, J.A.; Thevananther, S. P2X3 purinergic receptor overexpression is associated with poor recurrence-free survival in hepatocellular carcinoma patients. Oncotarget 2015, 6, 41162–41179. [Google Scholar] [CrossRef]
- Lu, R.; Zhang, Z.; Jiang, C. Recent progress on the discovery of P2Y14 receptor antagonists. Eur. J. Med. Chem. 2019, 175, 34–39. [Google Scholar] [CrossRef]
- Li, H.; Jiang, W.; Ye, S.; Zhou, M.; Liu, C.; Yang, X.; Hao, K.; Hu, Q. P2Y14 receptor has a critical role in acute gouty arthritis by regulating pyroptosis of macrophages. Cell Death Dis. 2020, 11, 394. [Google Scholar] [CrossRef]
- Sesma, J.I.; Weitzer, C.D.; Livraghi-Butrico, A.; Dang, H.; Donaldson, S.; Alexis, N.E.; Jacobson, K.A.; Harden, T.K.; Lazarowski, E.R. UDP-glucose promotes neutrophil recruitment in the lung. Purinergic Signal. 2016, 12, 627–635. [Google Scholar] [CrossRef]
- Liu, C.; Zhou, M.; Jiang, W.; Ye, S.; Tian, S.; Jiang, C.; Hao, K.; Li, H.; Hu, Q. GPR105-Targeted Therapy Promotes Gout Resolution as a Switch Between NETosis and Apoptosis of Neutrophils. Front. Immunol. 2022, 13, 870183. [Google Scholar] [CrossRef]
- Haq, K.; Wootton, S.K.; Barjesteh, N.; Golovan, S.; Bendall, A.; Sharif, S. Effects of interferon-gamma knockdown on vaccine-induced immunity against Marek’s disease in chickens. Can. J. Vet. Res. 2015, 79, 1–7. [Google Scholar]
- Ma, J.; Wei, K.; Liu, J.; Tang, K.; Zhang, H.; Zhu, L.; Chen, J.; Li, F.; Xu, P.; Chen, J.; et al. Glycogen metabolism regulates macrophage-mediated acute inflammatory responses. Nat. Commun. 2020, 11, 1769. [Google Scholar] [CrossRef]
- Lovaszi, M.; Branco Haas, C.; Antonioli, L.; Pacher, P.; Hasko, G. The role of P2Y receptors in regulating immunity and metabolism. Biochem. Pharmacol. 2021, 187, 114419. [Google Scholar] [CrossRef]
Gene Name | Gene ID 1 | Accession No. 2 | Primer 3 | Sequence (5′–3′) | Fragment Size 4 |
---|---|---|---|---|---|
DDX5 | 395629 | NM_204827.2 | F. 585 | AACTCGTGAACTGGCCCAAC | 228 |
R.812 | TCCGCTTCATCAAGGACGAG | ||||
BCL2 | 396282 | NM_205339.3 | F. 3227 | CACAGGTGCCTACTGTCGTT | 225 |
R. 3451 | CACACTGGGATTCTTCCGCT | ||||
ANGPTL4 | 769087 | XM_040692473.2 | F. 1134 | AGCCTACACACTCAACCTGC | 388 |
R. 1521 | ACCAACTGATGGAGCTCACG | ||||
STAT1A | 424044 | NM_001012914.2 | F. 2121 | CCCAAGGGAAACGGCTACAT | 461 |
R. 2581 | CACTGAGGACCCCTTGTTCC | ||||
STAT5A | 395556 | NM_204779.1 | F. 1303 | CAGACCAAGTTTGCAGCCAC | 356 |
R. 1658 | GACAGCGTCTTCACCTGGAA | ||||
SOD1 | 395938 | NM_205064.2 | F. 117 | TCATCCACTTCCAGCAGCAG | 333 |
R. 449 | CCCCTCTACCCAGGTCATCA | ||||
CAT | 423600 | NM_001031215.2 | F. 1338 | GCGCCCCGAACTATTATCCA | 280 |
R. 1617 | ATACGTGCGCCATAGTCAGG | ||||
GPX1 | 100857115 | NM_001277853.3 | F. 422 | GATGACCAACCCGCAGTACA | 315 |
R. 736 | AGCTTTGAAAACATCGGGCG | ||||
GPX2 | 100857454 | NM_001277854.3 | F. 31 | CGCCAAGTCCTTCTACGACC | 133 |
R. 163 | GGTGTAATCCCTCACCGTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akbar, H.; Jarosinski, K.W. Temporal Dynamics of Purinergic Receptor Expression in the Lungs of Marek’s Disease (MD) Virus-Infected Chickens Resistant or Susceptible to MD. Viruses 2024, 16, 1130. https://doi.org/10.3390/v16071130
Akbar H, Jarosinski KW. Temporal Dynamics of Purinergic Receptor Expression in the Lungs of Marek’s Disease (MD) Virus-Infected Chickens Resistant or Susceptible to MD. Viruses. 2024; 16(7):1130. https://doi.org/10.3390/v16071130
Chicago/Turabian StyleAkbar, Haji, and Keith W. Jarosinski. 2024. "Temporal Dynamics of Purinergic Receptor Expression in the Lungs of Marek’s Disease (MD) Virus-Infected Chickens Resistant or Susceptible to MD" Viruses 16, no. 7: 1130. https://doi.org/10.3390/v16071130
APA StyleAkbar, H., & Jarosinski, K. W. (2024). Temporal Dynamics of Purinergic Receptor Expression in the Lungs of Marek’s Disease (MD) Virus-Infected Chickens Resistant or Susceptible to MD. Viruses, 16(7), 1130. https://doi.org/10.3390/v16071130