Virulence and Replicative Fitness of HIV-1 Transmitted/Founder (T/F) Viruses Harbouring Drug Resistance-Associated Mutation
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Subjects
2.2. Viral RNA Extraction and cDNA Synthesis
2.3. PCR Amplification of near Full-Length Viral Genome
2.4. LTR Amplification and Construction of Patient-Specific LTR Clone
2.5. Generation of Patient-Specific Full-Length Infectious Molecular Clones (IMCs)
2.6. Generation of Virus Stocks and Determination of Infectivity
2.7. Sequence Analysis and Drug Resistance Genotyping
2.8. Identification of Early Transmitted/Founder Viruses
2.9. Analysis of In Vitro Replication in Peripheral Blood Mononuclear Cells
2.10. Determination of Per Particle Infectivity
2.11. Determination of Co-Receptor Usage
2.12. Determination of Sensitivity to Maraviroc
2.13. Determination of Sensitivity to Broadly Neutralizing Antibodies (bNAbs)
2.14. Phenotypic NNRTI Susceptibility Testing
3. Results
3.1. Construction of Full-Length Molecular Clones of Recently Transmitted/Founder Viruses Using the In-Fusion HD Cloning Technique
3.2. Infectivity of the Constructed Full-Length T/F Clones
3.3. Sequence Analysis and Identification of Early Transmitted/Founder Viruses
3.4. In Vitro Replication Capacity of the T/F Viruses
3.5. Per Particle Infectivity of the T/F Clones
3.6. Co-Receptor Usage
3.7. Sensitivity to Maraviroc
3.8. Sensitivity to Neutralizing Antibodies
3.9. Susceptibility to NNRTIs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cherie, S.; Workie, H.; Kassie, T.; Bitew, A.; Samuel, T. Pregnant Women’s Knowledge, Attitude, and Practice Towards the Prevention of Mother to Child Transmission of HIV/AIDS in Dil Chora Referral Hospital, Dire Dawa, Eastern Ethiopia: A Cross-Sectional Study. HIVAIDS—Res. Palliat. Care 2022, 14, 45–60. [Google Scholar] [CrossRef] [PubMed]
- Volmink, J.; Marais, B. HIV: Mother-to-child transmission. BMJ Clin. Evid. 2008, 2008, 0909. [Google Scholar]
- Ciaranello, A.L.; Seage, G.R.I.; Freedberg, K.A.; Weinstein, M.C.; Lockman, S.; Walensky, R.P. Antiretroviral drugs for preventing mother-to-child transmission of HIV in sub-Saharan Africa: Balancing efficacy and infant toxicity. AIDS 2008, 22, 2359–2369. [Google Scholar] [CrossRef] [PubMed]
- Fitzgerald, F.; Penazzato, M.; Gibb, D. Development of Antiretroviral Resistance in Children With HIV in Low- and Middle-Income Countries. J. Infect. Dis. 2013, 207, S85–S92. [Google Scholar] [CrossRef] [PubMed]
- Mutabazi, J.C.; Zarowsky, C.; Trottier, H. The impact of programs for prevention of mother-to-child transmission of HIV on health care services and systems in sub-Saharan Africa—A review. Public Health Rev. 2017, 38, 28. [Google Scholar] [CrossRef]
- Singh, K.; Marchand, B.; Kirby, K.A.; Michailidis, E.; Sarafianos, S.G. Structural Aspects of Drug Resistance and Inhibition of HIV-1 Reverse Transcriptase. Viruses 2010, 2, 606–638. [Google Scholar] [CrossRef]
- Boyer, P.L.; Currens, M.J.; McMahon, J.B.; Boyd, M.R.; Hughes, S.H. Analysis of nonnucleoside drug-resistant variants of human immunodeficiency virus type 1 reverse transcriptase. J. Virol. 1993, 67, 2412–2420. [Google Scholar] [CrossRef]
- Murthy, M.; Krishnamurthy, B. Safety of single-dose nevirapine for prevention of vertical transmission of human immunodeficiency virus infection. Indian J. Pharmacol. 2011, 43, 207. [Google Scholar] [CrossRef] [PubMed]
- Micek, M.A.; Blanco, A.J.; Beck, I.A.; Dross, S.; Matunha, L.; Montoya, P.; Seidel, K.; Gantt, S.; Matediane, E.; Jamisse, L.; et al. Nevirapine Resistance by Timing of HIV Type 1 Infection in Infants Treated with Single-Dose Nevirapine. Clin. Infect. Dis. 2010, 50, 1405–1414. [Google Scholar] [CrossRef] [PubMed]
- Gonzague, J.; Ngo-Giang-Huong, N.; Le Coeur, S.; Bowonwatanuwong, C.; Kantipong, P.; Leechanachai, P.; Ariyadej, S.; Leenasirimakul, P.; Hammer, S.; Lallemant, M. Intrapartum Exposure to Nevirapine and Subsequent Maternal Responses to Nevirapine-Based Antiretroviral Therapy. N. Engl. J. Med. 2004, 351, 229–240. [Google Scholar]
- Hunt, G.M.; Coovadia, A.; Abrams, E.J.; Sherman, G.; Meyers, T.; Morris, L.; Kuhn, L. HIV-1 drug resistance at antiretroviral treatment initiation in children previously exposed to single-dose nevirapine. AIDS 2011, 25, 1461–1469. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, T.; Gannam, Z.T.; Kudalkar, S.N.; Frey, K.M.; Lee, W.-G.; Spasov, K.A.; Jorgensen, W.L.; Anderson, K.S. Molecular and cellular studies evaluating a potent 2-cyanoindolizine catechol diether NNRTI targeting wildtype and Y181C mutant HIV-1 reverse transcriptase. Bioorg. Med. Chem. Lett. 2019, 29, 2182–2188. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.-T.; Oliveira, M.; Asahchop, E.L.; McCallum, M.; Quashie, P.K.; Han, Y.; Quan, Y.; Wainberg, M.A. Molecular Mechanism of Antagonism between the Y181C and E138K Mutations in HIV-1 Reverse Transcriptase. J. Virol. 2012, 86, 12983–12990. [Google Scholar] [CrossRef]
- Basson, A.E.; Rhee, S.-Y.; Parry, C.M.; El-Khatib, Z.; Charalambous, S.; De Oliveira, T.; Pillay, D.; Hoffmann, C.; Katzenstein, D.; Shafer, R.W.; et al. Impact of Drug Resistance-Associated Amino Acid Changes in HIV-1 Subtype C on Susceptibility to Newer Nonnucleoside Reverse Transcriptase Inhibitors. Antimicrob. Agents Chemother. 2015, 59, 960–971. [Google Scholar] [CrossRef]
- Hu, Z.; Kuritzkes, D.R. Altered Viral Fitness and Drug Susceptibility in HIV-1 Carrying Mutations That Confer Resistance to Nonnucleoside Reverse Transcriptase and Integrase Strand Transfer Inhibitors. J. Virol. 2014, 88, 9268–9276. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, K.L.; Lee, T.-H.; Essex, M. Replicative Fitness Costs of Nonnucleoside Reverse Transcriptase Inhibitor Drug Resistance Mutations on HIV Subtype C. Antimicrob. Agents Chemother. 2011, 55, 2146–2153. [Google Scholar] [CrossRef] [PubMed]
- Boyce, C.L.; Sils, T.; Ko, D.; Wong-On-Wing, A.; Beck, I.A.; Styrchak, S.M.; DeMarrais, P.; Tierney, C.; Stranix-Chibanda, L.; Flynn, P.M.; et al. Maternal Human Immunodeficiency Virus (HIV) Drug Resistance Is Associated With Vertical Transmission and Is Prevalent in Infected Infants. Clin. Infect. Dis. 2022, 74, 2001–2009. [Google Scholar] [CrossRef]
- Kijak, G.H. Mother-to-child transmission of drug-resistant HIV. Drug Resist. Updat. 2001, 4, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Deymier, M.J.; Claiborne, D.T.; Ende, Z.; Ratner, H.K.; Kilembe, W.; Allen, S.; Hunter, E. Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning. Virology 2014, 468–470, 454–461. [Google Scholar] [CrossRef] [PubMed]
- Butler, D.M.; Pacold, M.E.; Jordan, P.S.; Richman, D.D.; Smith, D.M. The efficiency of single genome amplification and sequencing is improved by quantitation and use of a bioinformatics tool. J. Virol. Methods 2009, 162, 280–283. [Google Scholar] [CrossRef]
- Houzet, L.; Deleage, C.; Satie, A.P.; Merlande, L.; Mahe, D.; Dejucq-Rainsford, N. A New Method for Rapid Screening of End-Point PCR Products: Application to Single Genome Amplified HIV and SIV Envelope Amplicons. PLoS ONE 2015, 10, e0128188. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Crumpacker, C. HIV UTR, LTR, and Epigenetic Immunity. Viruses 2022, 14, 1084. [Google Scholar] [CrossRef] [PubMed]
- Ashokkumar, M.; Aralaguppe, S.G.; Tripathy, S.P.; Hanna, L.E.; Neogi, U. Unique Phenotypic Characteristics of Recently Transmitted HIV-1 Subtype C Envelope Glycoprotein gp120: Use of CXCR6 Coreceptor by Transmitted Founder Viruses. J. Virol. 2018, 92, e00063-18. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Gao, F.; Mascola, J.R.; Stamatatos, L.; Polonis, V.R.; Koutsoukos, M.; Voss, G.; Goepfert, P.; Gilbert, P.; Greene, K.M.; et al. Human Immunodeficiency Virus Type 1 env Clones from Acute and Early Subtype B Infections for Standardized Assessments of Vaccine-Elicited Neutralizing Antibodies. J. Virol. 2005, 79, 10108–10125. [Google Scholar] [CrossRef] [PubMed]
- Mielke, D.; Bandawe, G.; Pollara, J.; Abrahams, M.-R.; Nyanhete, T.; Moore, P.L.; Thebus, R.; Yates, N.L.; Kappes, J.C.; Ochsenbauer, C.; et al. Antibody-Dependent Cellular Cytotoxicity (ADCC)-Mediating Antibodies Constrain Neutralizing Antibody Escape Pathway. Front. Immunol. 2019, 10, 2875. [Google Scholar] [CrossRef] [PubMed]
- Joseph, S.B.; Swanstrom, R.; Kashuba, A.D.M.; Cohen, M.S. Bottlenecks in HIV-1 transmission: Insights from the study of founder viruses. Nat. Rev. Microbiol. 2015, 13, 414–425. [Google Scholar] [CrossRef]
- Keele, B.F.; Giorgi, E.E.; Salazar-Gonzalez, J.F.; Decker, J.M.; Pham, K.T.; Salazar, M.G.; Sun, C.; Grayson, T.; Wang, S.; Li, H.; et al. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc. Natl. Acad. Sci. USA 2008, 105, 7552–7557. [Google Scholar] [CrossRef] [PubMed]
- Macharia, G.N.; Yue, L.; Staller, E.; Dilernia, D.; Wilkins, D.; Song, H.; McGowan, E.; King, D.; Fast, P.; Imami, N.; et al. Infection with multiple HIV-1 founder variants is associated with lower viral replicative capacity, faster CD4+ T cell decline and increased immune activation during acute infection. PLOS Pathog. 2020, 16, e1008853. [Google Scholar] [CrossRef]
- Salazar-Gonzalez, J.F.; Salazar, M.G.; Keele, B.F.; Learn, G.H.; Giorgi, E.E.; Li, H.; Decker, J.M.; Wang, S.; Baalwa, J.; Kraus, M.H.; et al. Genetic identity, biological phenotype, and evolutionary pathways of transmitted/founder viruses in acute and early HIV-1 infection. J. Exp. Med. 2009, 206, 1273–1289. [Google Scholar] [CrossRef] [PubMed]
- Deymier, M.J.; Ende, Z.; Fenton-May, A.E.; Dilernia, D.A.; Kilembe, W.; Allen, S.A.; Borrow, P.; Hunter, E. Heterosexual Transmission of Subtype C HIV-1 Selects Consensus-Like Variants without Increased Replicative Capacity or Interferon-α Resistance. PLOS Pathog. 2015, 11, e1005154. [Google Scholar] [CrossRef] [PubMed]
- Balinda, S.N.; Kapaata, A.; Xu, R.; Salazar, M.G.; Mezzell, A.T.; Qin, Q.; Herard, K.; Dilernia, D.; Kamali, A.; Ruzagira, E.; et al. Characterization of Near Full-Length Transmitted/Founder HIV-1 Subtype D and A/D Recombinant Genomes in a Heterosexual Ugandan Population (2006–2011). Viruses 2022, 14, 334. [Google Scholar] [CrossRef] [PubMed]
- Maeda, Y.; Takemura, T.; Chikata, T.; Kuwata, T.; Terasawa, H.; Fujimoto, R.; Kuse, N.; Akahoshi, T.; Murakoshi, H.; Van Tran, G.; et al. Existence of Replication-Competent Minor Variants with Different Coreceptor Usage in Plasma from HIV-1-Infected Individuals. J. Virol. 2020, 94, e00193-20. [Google Scholar] [CrossRef] [PubMed]
- Judicate, G.P.; Barabona, G.; Kamori, D.; Mahiti, M.; Tan, T.S.; Ozono, S.; Mgunya, A.S.; Kuwata, T.; Matsushita, S.; Sunguya, B.; et al. Phenotypic and Genotypic Co-receptor Tropism Testing in HIV-1 Epidemic Region of Tanzania Where Multiple Non-B Subtypes Co-circulate. Front. Microbiol. 2021, 12, 703041. [Google Scholar] [CrossRef]
- Siddik, A.B.; Haas, A.; Rahman, S.; Aralaguppe, S.G.; Amogne, W.; Bader, J.; Klimkait, T.; Neogi, U. Phenotypic co-receptor tropism and Maraviroc sensitivity in HIV-1 subtype C from East Africa. Sci. Rep. 2018, 8, 2363. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.; Han, J.; Zhuang, D.; Liu, S.; Liu, Y.; Li, L.; Li, H.; Bao, Z.; Wang, F.; Li, J. Characterization of two HIV-1 infectors during initial antiretroviral treatment, and the emergence of phenotypic resistance in reverse transcriptase-associated mutation patterns. Virol. J. 2015, 12, 187. [Google Scholar] [CrossRef] [PubMed]
- Trivedi, V.; Von Lindern, J.; Montes-Walters, M.; Rojo, D.R.; Shell, E.J.; Parkin, N.; O’Brien, W.A.; Ferguson, M.R. Impact of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Inhibitor Drug Resistance Mutation Interactions on Phenotypic Susceptibility. AIDS Res. Hum. Retroviruses 2008, 24, 1291–1300. [Google Scholar] [CrossRef]
- Moorthy, A.; Kuhn, L.; Coovadia, A.; Meyers, T.; Strehlau, R.; Sherman, G.; Tsai, W.-Y.; Chen, Y.H.; Abrams, E.J.; Persaud, D. Induction Therapy with Protease-Inhibitors Modifies the Effect of Nevirapine Resistance on Virologic Response to Nevirapine-based HAART in Children. Clin. Infect. Dis. 2011, 52, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Paredes, R.; Lalama, C.M.; Ribaudo, H.J.; Schackman, B.R.; Shikuma, C.; Giguel, F.; Meyer, W.A.; Johnson, V.A.; Fiscus, S.A.; D’aquila, R.T.; et al. Pre-existing Minority Drug-Resistant HIV-1 Variants, Adherence, and Risk of Antiretroviral Treatment Failure. J. Infect. Dis. 2010, 201, 662–671. [Google Scholar] [CrossRef] [PubMed]
- Lopalco, L. CCR5: From Natural Resistance to a New Anti-HIV Strategy. Viruses 2010, 2, 574–600. [Google Scholar] [CrossRef] [PubMed]
- Jasinska, A.J.; Pandrea, I.; Apetrei, C. CCR5 as a Coreceptor for Human Immunodeficiency Virus and Simian Immunodeficiency Viruses: A Prototypic Love-Hate Affair. Front. Immunol. 2022, 13, 835994. [Google Scholar] [CrossRef] [PubMed]
- Gilliam, B.L.; Riedel, D.J.; Redfield, R.R. Clinical use of CCR5 inhibitors in HIV and beyond. J. Transl. Med. 2011, 9, S9. [Google Scholar] [CrossRef] [PubMed]
- López-Huertas, M.R.; Gutiérrez, C.; Madrid-Elena, N.; Hernández-Novoa, B.; Olalla-Sierra, J.; Plana, M.; Delgado, R.; Rubio, R.; Muñoz-Fernández, M.; Moreno, S. Prolonged administration of maraviroc reactivates latent HIV in vivo but it does not prevent antiretroviral-free viral rebound. Sci. Rep. 2020, 10, 22286. [Google Scholar] [CrossRef] [PubMed]
- De Luca, A.; Pezzotti, P.; Boucher, C.; Döring, M.; Incardon, F.; Kaiser, R.; Lengauer, T.; Pfeifer, N.; Schülter, E.; Vandamme, A.-M.; et al. Clinical use, efficacy, and durability of maraviroc for antiretroviral therapy in routine care: A European survey. PLoS ONE 2019, 14, e0225381. [Google Scholar] [CrossRef] [PubMed]
- Collins, J.A.; Thompson, M.G.; Paintsil, E.; Ricketts, M.; Gedzior, J.; Alexander, L. Competitive Fitness of Nevirapine-Resistant Human Immunodeficiency Virus Type 1 Mutants. J. Virol. 2004, 78, 603–611. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Xing, H.; Liao, L.; Wang, Z.; Su, B.; Zhao, Q.; Feng, Y.; Ma, P.; Liu, J.; Wu, J.; et al. The development of drug resistance mutations K103N Y181C and G190A in long term Nevirapine-containing antiviral therapy. AIDS Res. Ther. 2014, 11, 36. [Google Scholar] [CrossRef] [PubMed]
Infant ID | Mode of Transmission | Mode of Delivery | Sex/Age at Sample Collection (Days) | Diagnostic Method | Viral Load (Copies/mL) | CD4 T-Cell Count (no. of Cells/µL) | Subtype of Virus | # Predicted Co-Receptor Usage Determined by G2P PhenoSeq |
---|---|---|---|---|---|---|---|---|
822 | MTCT | Vaginal | M (38 days) | DNA PCR | 1,231,791 | 384 | C | CCR5 CCR5 |
JUS | MTCT | Vaginal | M (22 days) | DNA PCR | 3,783,148 | 741 | C | CCR5 CCR5 |
Primer Name | Primer Sequence | Primer Sequence Used for |
---|---|---|
FLcDNA | TTTCGCTTGTACTGGGTCTCTCTAGGTAGA | cDNA synthesis for near full-length |
Oligo dt 20 | TTTTTTTTTTTTTTTTTTVN | cDNA synthesis for near full-length |
HCFLC1F | CTTGAGTGCTCTGAGCAGTGTGTGCCCG | 1st round NFL PCR |
HCFLC2F | GCTCTGAGCAGTGTGTGCCCGTCTATTG | 2nd round NFL PCR |
HCFLC1R | AGTACAAGCGAAAAGCAGCGGCTTATAT | 1st round NFL PCR |
HCFLC2R | CGAAAAGCAGCGGCTTATATGCCGCATCTG | 2nd round NFL PCR |
LTR C F | TGGAAGGGTTAATTTACTCCAAGAA | LTR amplification |
LTR C R | TGCTAGAGATTTTCCACACTACCAA | LTR amplification |
Pvec F | GCGGCCGCCACCGCGGTGGAGCTCC | pIndie Vector backbone amplification |
Pvec R | GCGGCCGCTCTAGAACTAGTGGATC | pIndie Vector backbone amplification |
LTR Overlap vec F | TTCTAGAGCGGCCGCTGGAAGGGTTAATTTACTCCAAGAAAA | T/F LTR cloning |
LTR overlap vec R | CGCGGTGGCGGCCGCTGCTAGAGATTTTCCACACTACCAAAA | T/F LTR cloning |
NFL C clone F | GGTAACTAGAGATCCCTCAGACCCT | NFL cloning PCR |
NFL C clone R | GGCTTATATGCCGCATCTGAGGGTT | NFL cloning PCR |
5′ LTR VEC F | TTATCAAAAAGGATCTTCACCTAGATCCTT | 5′ LTR _Vec fragment PCR |
5′ LTR VEC R | GGATCTCTAGTTACCAGAGTCACACAATAG | 5′ LTR _Vec fragment PCR |
3′ LTR VEC F | TGCGGCATATAAGCCGCTGCTTTTCGCTTG | 3′ LTR _Vec fragment PCR |
3′ LTR VEC R | GTGAAGATCCTTTTTGATAATCTCATGACC | 3′ LTR _Vec fragment PCR |
Infectious Full-Length T/F Viruses | EFV IC50 (nM) | EFV FC | ETR IC50 (nM) | ETR FC | NVP IC50 (nM) | NVP FC | RPV IC50 (nM) | RPV FC |
---|---|---|---|---|---|---|---|---|
WT—non-mutant (JUS) | 31.36 ± 6.6 | - | 22.64 ± 4.0 | - | 102.92 ± 17.37 | - | 33.16 ± 7.8 | - |
Y181C Mutant (822) | 53.31 ± 12.9 | 1.7 | 110.64 ± 34.1 | 4.8 | 15,548.3 ± 2994.6 | 151 | 42.03 ± 5.2 | 1.26 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sonawane, A.; Selvam, D.; Yue, L.; Nesakumar, M.; Vivekanandan, S.; Ashokkumar, M.; Hunter, E.; Hanna, L.E. Virulence and Replicative Fitness of HIV-1 Transmitted/Founder (T/F) Viruses Harbouring Drug Resistance-Associated Mutation. Viruses 2024, 16, 1854. https://doi.org/10.3390/v16121854
Sonawane A, Selvam D, Yue L, Nesakumar M, Vivekanandan S, Ashokkumar M, Hunter E, Hanna LE. Virulence and Replicative Fitness of HIV-1 Transmitted/Founder (T/F) Viruses Harbouring Drug Resistance-Associated Mutation. Viruses. 2024; 16(12):1854. https://doi.org/10.3390/v16121854
Chicago/Turabian StyleSonawane, Aanand, Deepak Selvam, Ling Yue, Manohar Nesakumar, Sandhya Vivekanandan, Manickam Ashokkumar, Eric Hunter, and Luke Elizabeth Hanna. 2024. "Virulence and Replicative Fitness of HIV-1 Transmitted/Founder (T/F) Viruses Harbouring Drug Resistance-Associated Mutation" Viruses 16, no. 12: 1854. https://doi.org/10.3390/v16121854
APA StyleSonawane, A., Selvam, D., Yue, L., Nesakumar, M., Vivekanandan, S., Ashokkumar, M., Hunter, E., & Hanna, L. E. (2024). Virulence and Replicative Fitness of HIV-1 Transmitted/Founder (T/F) Viruses Harbouring Drug Resistance-Associated Mutation. Viruses, 16(12), 1854. https://doi.org/10.3390/v16121854