IPEC-J2 Autophagy Induced by TLR4 and NSP6 Interactions Facilitate Porcine Epidemic Diarrhea Virus Replication
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Virus Stock
2.2. Antibodies, Plasmids and Reagents
2.3. Viral Infection and Cell Treatment
2.4. Relative Expression Analysis of PEDV-N Gene
2.5. Transfection and Gene Silencing with siRNAs
2.6. Western Blotting Analysis
2.7. TEM Sample Preparation and Analysis
2.8. Immunofluorescence Microscopy
2.9. Statistical Analysis
3. Results
3.1. PEDV-Induced Autophagy Marker Production in IPEC-J2 Cells
3.2. Observation of the Autophagosomes in IPEC-J2 Cells Using Transmission Electron Microscopy (TEM)
3.3. The Role of Autophagy in PEDV Replication
3.4. Transcriptome Sequencing of PEDV-Infected IPEC-J2 Cells
3.5. Analysis of Gene Ontology (GO) Enrichment
3.6. Analysis of Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment
3.7. TLR4 Knockdown Inhibited the Early Replication of PEDV
3.8. TLR4 Plays a Critical Role in PEDV Infection-Induced Autophagy
3.9. Effect of TLR4 on AKT-mTOR Signaling Pathway
3.10. Identification of Truncated Proteins That Induce Autophagy
3.11. Analysis of Autophagic Flow Induced by Truncated NSP6 Proteins
3.12. Identification of Functional Domains of NSP6 in Autophagy Induction
3.13. Analysis of Autophagic Flow Induced by NSP61-2 Truncated Proteins
3.14. Effect of NSP61-2C on the AKT-mTOR Signaling Pathway
3.15. TLR4 and NSP61-2C Show Colocalization in Immunofluorescence Assays
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Wood, E.N. An apparently new syndrome of porcine epidemic diarrhoea. Vet. Rec. 1977, 100, 243–244. [Google Scholar] [CrossRef] [PubMed]
- Song, D.; Park, B. Porcine epidemic diarrhoea virus: A comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes 2012, 44, 167–175. [Google Scholar] [CrossRef]
- Jantraphakorn, Y.; Viriyakitkosol, R.; Jongkaewwattana, A.; Kaewborisuth, C. Interaction Between PEDV and Its Hosts: A Closer Look at the ORF3 Accessory Protein. Front. Vet. Sci. 2021, 8, 744276. [Google Scholar] [CrossRef]
- Vlasova, A.N.; Marthaler, D.; Wang, Q.; Culhane, M.R.; Rossow, K.D.; Rovira, A.; Collins, J.; Saif, L.J. Distinct characteristics and complex evolution of PEDV strains, North America, May 2013–February 2014. Emerg. Infect. Dis. 2014, 20, 1620–1628. [Google Scholar] [CrossRef] [PubMed]
- Jang, G.; Won, H.; Lee, D.U.; Noh, Y.H.; Lee, S.C.; Choi, H.W.; Yoon, I.J.; Lee, Y.J.; Sang Yoo, H.; Lee, C. Assessment of the safety and efficacy of an attenuated live vaccine based on highly virulent genotype 2b porcine epidemic diarrhea virus in nursing piglets. Vet. Microbiol. 2019, 231, 120–128. [Google Scholar] [CrossRef]
- Pyo, H.M.; Kim, I.J.; Kim, S.H.; Kim, H.S.; Cho, S.D.; Cho, I.S.; Hyun, B.H. Escherichia coli expressing single-chain Fv on the cell surface as a potential prophylactic of porcine epidemic diarrhea virus. Vaccine 2009, 27, 2030–2036. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Lee, C. Ribavirin efficiently suppresses porcine nidovirus replication. Virus Res. 2013, 171, 44–53. [Google Scholar] [CrossRef]
- Cottam, E.M.; Maier, H.J.; Manifava, M.; Vaux, L.C.; Chandra-Schoenfelder, P.; Gerner, W.; Britton, P.; Ktistakis, N.T.; Wileman, T. Coronavirus nsp6 proteins generate autophagosomes from the endoplasmic reticulum via an omegasome intermediate. Autophagy 2011, 7, 1335–1347. [Google Scholar] [CrossRef]
- Maier, H.J.; Cottam, E.M.; Stevenson-Leggett, P.; Wilkinson, J.A.; Harte, C.J.; Wileman, T.; Britton, P. Visualizing the autophagy pathway in avian cells and its application to studying infectious bronchitis virus. Autophagy 2013, 9, 496–509. [Google Scholar] [CrossRef]
- Guo, X.; Zhang, M.; Zhang, X.; Tan, X.; Guo, H.; Zeng, W.; Yan, G.; Memon, A.M.; Li, Z.; Zhu, Y.; et al. Porcine Epidemic Diarrhea Virus Induces Autophagy to Benefit Its Replication. Viruses 2017, 9, 53. [Google Scholar] [CrossRef]
- Ko, S.; Gu, M.J.; Kim, C.G.; Kye, Y.C.; Lim, Y.; Lee, J.E.; Park, B.C.; Chu, H.; Han, S.H.; Yun, C.H. Rapamycin-induced autophagy restricts porcine epidemic diarrhea virus infectivity in porcine intestinal epithelial cells. Antivir. Res. 2017, 146, 86–95. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Li, B.; Liu, M.; Zhou, H.; He, K.; Fan, H. Nonstructural protein 6 of porcine epidemic diarrhea virus induces autophagy to promote viral replication via the PI3K/Akt/mTOR axis. Vet. Microbiol. 2020, 244, 108684. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.; Wang, Q.; Scheuer, K.A.; Lu, Z.; Zhang, Y.; Saif, L.J. Pathology of US porcine epidemic diarrhea virus strain PC21A in gnotobiotic pigs. Emerg. Infect. Dis. 2014, 20, 662–665. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.; Saif, L.J.; Wang, Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Cao, Y.; Yang, Q. Transferrin receptor 1 levels at the cell surface influence the susceptibility of newborn piglets to PEDV infection. PLoS Pathog. 2020, 16, e1008682. [Google Scholar] [CrossRef]
- Jung, K.; Miyazaki, A.; Saif, L.J. Immunohistochemical detection of the vomiting-inducing monoamine neurotransmitter serotonin and enterochromaffin cells in the intestines of conventional or gnotobiotic (Gn) pigs infected with porcine epidemic diarrhea virus (PEDV) and serum cytokine responses of Gn pigs to acute PEDV infection. Res. Vet. Sci. 2018, 119, 99–108. [Google Scholar] [CrossRef]
- Gu, Y.; Zhou, Y.; Shi, X.; Xin, Y.; Shan, Y.; Chen, C.; Cao, T.; Fang, W.; Li, X. Porcine teschovirus 2 induces an incomplete autophagic response in PK-15 cells. Arch. Virol. 2018, 163, 623–632. [Google Scholar] [CrossRef]
- Yang, B.; Xue, Q.; Guo, J.; Wang, X.; Zhang, Y.; Guo, K.; Li, W.; Chen, S.; Xue, T.; Qi, X.; et al. Autophagy induction by the pathogen receptor NECTIN4 and sustained autophagy contribute to peste des petits ruminants virus infectivity. Autophagy 2020, 16, 842–861. [Google Scholar] [CrossRef]
- Joubert, P.E.; Meiffren, G.; Grégoire, I.P.; Pontini, G.; Richetta, C.; Flacher, M.; Azocar, O.; Vidalain, P.O.; Vidal, M.; Lotteau, V.; et al. Autophagy induction by the pathogen receptor CD46. Cell Host Microbe 2009, 6, 354–366. [Google Scholar] [CrossRef]
- Hou, P.; Yang, K.; Jia, P.; Liu, L.; Lin, Y.; Li, Z.; Li, J.; Chen, S.; Guo, S.; Pan, J.; et al. A novel selective autophagy receptor, CCDC50, delivers K63 polyubiquitination-activated RIG-I/MDA5 for degradation during viral infection. Cell Res. 2021, 31, 62–79. [Google Scholar] [CrossRef]
- Zhai, X.; Sun, J.; Yan, Z.; Zhang, J.; Zhao, J.; Zhao, Z.; Gao, Q.; He, W.T.; Veit, M.; Su, S. Comparison of Severe Acute Respiratory Syndrome Coronavirus 2 Spike Protein Binding to ACE2 Receptors from Human, Pets, Farm Animals, and Putative Intermediate Hosts. J. Virol. 2020, 94, e00831-20. [Google Scholar] [CrossRef]
- Son, J.; Kim, M.J.; Lee, J.S.; Kim, J.Y.; Chun, E.; Lee, K.Y. Hepatitis B virus X Protein Promotes Liver Cancer Progression through Autophagy Induction in Response to TLR4 Stimulation. Immune Netw. 2021, 21, e37. [Google Scholar] [CrossRef] [PubMed]
- Leitão, E.; Ger, K.A.; Panosso, R. Selective Grazing by a Tropical Copepod (Notodiaptomus iheringi) Facilitates Microcystis Dominance. Front. Microbiol. 2018, 9, 301. [Google Scholar] [CrossRef]
- Zhang, K.; Huang, Q.; Deng, S.; Yang, Y.; Li, J.; Wang, S. Mechanisms of TLR4-Mediated Autophagy and Nitroxidative Stress. Front. Cell. Infect. Microbiol. 2021, 11, 766590. [Google Scholar] [CrossRef] [PubMed]
- Levine, B.; Mizushima, N.; Virgin, H.W. Autophagy in immunity and inflammation. Nature 2011, 469, 323–335. [Google Scholar] [CrossRef] [PubMed]
- Levine, B.; Kroemer, G. Biological Functions of Autophagy Genes: A Disease Perspective. Cell 2019, 176, 11–42. [Google Scholar] [CrossRef]
- Deretic, V.; Saitoh, T.; Akira, S. Autophagy in infection, inflammation and immunity. Nat. Rev. Immunol. 2013, 13, 722–737. [Google Scholar] [CrossRef]
- Orvedahl, A.; Levine, B. Eating the enemy within: Autophagy in infectious diseases. Cell Death Differ. 2009, 16, 57–69. [Google Scholar] [CrossRef]
- Heaton, N.S.; Randall, G. Dengue virus-induced autophagy regulates lipid metabolism. Cell Host Microbe 2010, 8, 422–432. [Google Scholar] [CrossRef]
- Miller, K.; Mcgrath, M.E.; Hu, Z.; Ariannejad, S.; Weston, S.; Frieman, M.; Jackson, W.T. Coronavirus interactions with the cellular autophagy machinery. Autophagy 2020, 16, 2131–2139. [Google Scholar] [CrossRef]
- He, C.; Klionsky, D.J. Regulation mechanisms and signaling pathways of autophagy. Annu. Rev. Genet. 2009, 43, 67–93. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Zhang, Y.; Jia, L.; Wu, H.; Fan, C.; Sun, Y.; Ye, C.; Liao, M.; Zhou, J. Binding of the pathogen receptor HSP90AA1 to avibirnavirus VP2 induces autophagy by inactivating the AKT-MTOR pathway. Autophagy 2015, 11, 503–515. [Google Scholar] [CrossRef]
- Chang, H.; Li, X.; Cai, Q.; Li, C.; Tian, L.; Chen, J.; Xing, X.; Gan, Y.; Ouyang, W.; Yang, Z. The PI3K/Akt/mTOR pathway is involved in CVB3-induced autophagy of HeLa cells. Int. J. Mol. Med. 2017, 40, 182–192. [Google Scholar] [CrossRef]
- Sun, P.; Zhang, S.; Qin, X.; Chang, X.; Cui, X.; Li, H.; Zhang, S.; Gao, H.; Wang, P.; Zhang, Z.; et al. Foot-and-mouth disease virus capsid protein VP2 activates the cellular EIF2S1-ATF4 pathway and induces autophagy via HSPB1. Autophagy 2018, 14, 336–346. [Google Scholar] [CrossRef] [PubMed]
- Biacchesi, S.; Skiadopoulos, M.H.; Yang, L.; Murphy, B.R.; Collins, P.L.; Buchholz, U.J. Rapid human metapneumovirus microneutralization assay based on green fluorescent protein expression. J. Virol. Methods 2005, 128, 192–197. [Google Scholar] [CrossRef] [PubMed]
- Pei, D.; Ge, J.; Ma, G.; Jiang, Y.; Li, Y. Preparation and Partial Characterization of Monoclonal Antibody against N Protein of Porcine Epidemic Diarrhea Virus. J. Northeast Agric. Univ. 2008, 39, 84–89. [Google Scholar] [CrossRef]
- Kim, J.; Kundu, M.; Viollet, B.; Guan, K.L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 2011, 13, 132–141. [Google Scholar] [CrossRef]
- Mauthe, M.; Orhon, I.; Rocchi, C.; Zhou, X.; Luhr, M.; Hijlkema, K.J.; Coppes, R.P.; Engedal, N.; Mari, M.; Reggiori, F. Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy 2018, 14, 1435–1455. [Google Scholar] [CrossRef]
- Zheng, D.; Wang, Z.; Sui, L.; Xu, Y.; Wang, L.; Qiao, X.; Cui, W.; Jiang, Y.; Zhou, H.; Tang, L.; et al. Lactobacillus johnsonii activates porcine monocyte derived dendritic cells maturation to modulate Th cellular immune response. Cytokine 2021, 144, 155581. [Google Scholar] [CrossRef]
- Ma, S.; Qiao, X.; Xu, Y.; Wang, L.; Zhou, H.; Jiang, Y.; Cui, W.; Huang, X.; Wang, X.; Tang, L.; et al. Screening and Identification of a Chicken Dendritic Cell Binding Peptide by Using a Phage Display Library. Front. Immunol. 2019, 10, 1853. [Google Scholar] [CrossRef]
- Yang, B.; Qi, X.; Guo, H.; Jia, P.; Chen, S.; Chen, Z.; Wang, T.; Wang, J.; Xue, Q. Peste des Petits Ruminants Virus Enters Caprine Endometrial Epithelial Cells via the Caveolae-Mediated Endocytosis Pathway. Front. Microbiol. 2018, 9, 210. [Google Scholar] [CrossRef]
- Yang, B.; Xue, Q.; Qi, X.; Wang, X.; Jia, P.; Chen, S.; Wang, T.; Xue, T.; Wang, J. Autophagy enhances the replication of Peste des petits ruminants virus and inhibits caspase-dependent apoptosis in vitro. Virulence 2018, 9, 1176–1194. [Google Scholar] [CrossRef] [PubMed]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 2016, 12, 1–222. [Google Scholar] [CrossRef]
- Levine, B.; Kroemer, G. Autophagy in the pathogenesis of disease. Cell 2008, 132, 27–42. [Google Scholar] [CrossRef]
- Mizushima, N.; Levine, B. Autophagy in mammalian development and differentiation. Nat. Cell Biol. 2010, 12, 823–830. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.; Bowman, J.W.; Jung, J.U. Autophagy during viral infection—A double-edged sword. Nat. Rev. Microbiol. 2018, 16, 341–354. [Google Scholar] [CrossRef] [PubMed]
- Levine, B. Eating oneself and uninvited guests: Autophagy-related pathways in cellular defense. Cell 2005, 120, 159–162. [Google Scholar] [CrossRef] [PubMed]
- Liang, S.; Wu, Y.S.; Li, D.Y.; Tang, J.X.; Liu, H.F. Autophagy in Viral Infection and Pathogenesis. Front. Cell Dev. Biol. 2021, 9, 766142. [Google Scholar] [CrossRef]
- Heaton, N.S.; Randall, G. Dengue virus and autophagy. Viruses 2011, 3, 1332–1341. [Google Scholar] [CrossRef]
- Schiffer, L.; Barnard, L.; Baranowski, E.S.; Gilligan, L.C.; Taylor, A.E.; Arlt, W.; Shackleton, C.H.L.; Storbeck, K.H. Human steroid biosynthesis, metabolism and excretion are differentially reflected by serum and urine steroid metabolomes: A comprehensive review. J. Steroid Biochem. Mol. Biol. 2019, 194, 105439. [Google Scholar] [CrossRef]
- Kawasaki, T.; Kawai, T. Toll-like receptor signaling pathways. Front. Immunol. 2014, 5, 461. [Google Scholar] [CrossRef]
- Han, J.; Wang, Y. mTORC1 signaling in hepatic lipid metabolism. Protein Cell 2018, 9, 145–151. [Google Scholar] [CrossRef]
- Hardt, M.; Chantaravisoot, N.; Tamanoi, F. Activating mutations of TOR (target of rapamycin). Genes Cells Devoted Mol. Cell. Mech. 2011, 16, 141–151. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.J.; Choi, B.; Kim, J.Y.; Min, Y.; Kwon, D.H.; Son, J.; Lee, J.S.; Lee, J.S.; Chun, E.; Lee, K.Y. USP8 regulates liver cancer progression via the inhibition of TRAF6-mediated signal for NF-κB activation and autophagy induction by TLR4. Transl. Oncol. 2022, 15, 101250. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Sun, Y.; Xu, W.; Geng, Y.; Su, Y.; Wang, Q.; Wang, J. Baicalin inhibits Salmonella typhimurium-induced inflammation and mediates autophagy through TLR4/MAPK/NF-κB signalling pathway. Basic Clin. Pharmacol. Toxicol. 2021, 128, 241–255. [Google Scholar] [CrossRef] [PubMed]
- Cottam, E.M.; Whelband, M.C.; Wileman, T. Coronavirus NSP6 restricts autophagosome expansion. Autophagy 2014, 10, 1426–1441. [Google Scholar] [CrossRef]
- Benvenuto, D.; Angeletti, S.; Giovanetti, M.; Bianchi, M.; Pascarella, S.; Cauda, R.; Ciccozzi, M.; Cassone, A. Evolutionary analysis of SARS-CoV-2: How mutation of Non-Structural Protein 6 (NSP6) could affect viral autophagy. J. Infect. 2020, 81, e24–e27. [Google Scholar] [CrossRef]














| Target Gene | Sequence (5′-3′) | 
|---|---|
| β-actin | F: GGTGGGTATGGGTCAGAAAG R: TCCATGTCGTCCCAGTTGGT | 
| PEDV-N | F: GGTATTGGAGAAAATCCTGACAGGGCAACAGCA R: GACGCATCAACACCTTTTTCGTTCCGCATC | 
| Target Gene | Sequence (5′-3′) | 
|---|---|
| Negative control | F: UUCUCCGAACGUGUCACGUTT R: ACGUGACACGUUCGGAGAATT | 
| TFRC | F: GCAAUUGGUGUCUUGAUAUTT R: AUAUCAAGACACCAAUUGCTT | 
| TLR4 | F: GCAAAUGCCUCUGUGAUUUTT R: AAAUCACAGAGGCAUUUGCTT | 
| GABRG3 | F: GCUCCUCAGAAUUUGGAAUTT R: AUUCCAAAUUCUGAGGAGCTT | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, H.; Zheng, D.; Chang, Q.; Zhang, H.; Shao, Y.; Li, J.; Cui, W.; Jiang, Y.; Tang, L.; Li, Y.; et al. IPEC-J2 Autophagy Induced by TLR4 and NSP6 Interactions Facilitate Porcine Epidemic Diarrhea Virus Replication. Viruses 2024, 16, 1787. https://doi.org/10.3390/v16111787
Zhao H, Zheng D, Chang Q, Zhang H, Shao Y, Li J, Cui W, Jiang Y, Tang L, Li Y, et al. IPEC-J2 Autophagy Induced by TLR4 and NSP6 Interactions Facilitate Porcine Epidemic Diarrhea Virus Replication. Viruses. 2024; 16(11):1787. https://doi.org/10.3390/v16111787
Chicago/Turabian StyleZhao, Haiyuan, Dianzhong Zheng, Qinyuan Chang, Hailin Zhang, Yilan Shao, Jiaxuan Li, Wen Cui, Yanping Jiang, Lijie Tang, Yijing Li, and et al. 2024. "IPEC-J2 Autophagy Induced by TLR4 and NSP6 Interactions Facilitate Porcine Epidemic Diarrhea Virus Replication" Viruses 16, no. 11: 1787. https://doi.org/10.3390/v16111787
APA StyleZhao, H., Zheng, D., Chang, Q., Zhang, H., Shao, Y., Li, J., Cui, W., Jiang, Y., Tang, L., Li, Y., & Wang, X. (2024). IPEC-J2 Autophagy Induced by TLR4 and NSP6 Interactions Facilitate Porcine Epidemic Diarrhea Virus Replication. Viruses, 16(11), 1787. https://doi.org/10.3390/v16111787
 
        


 
       