STING Orchestrates EV-D68 Replication and Immunometabolism within Viral-Induced Replication Organelles
Abstract
1. Introduction
2. Materials and Methods
2.1. Analysis of Publicly Available Transcriptomic Data
2.2. Materials
2.3. Cell Culture/Viruses
2.4. Confocal Microscopy
2.5. CRISPR Knockout
MDA5 | gRNA Target sequence CGAATTCCCGAGTCCAACCA |
gRNA Target sequence AGCGTTCTCAAACGATGGAG | |
STING | gRNA Target sequence GCGGGCCGACCGCATTTGGG |
gRNA Target sequence GGTGCCTGATAACCTGAGTA | |
RIG-I | gRNA Target sequence GGGTCTTCCGGATATAATCC |
gRNA Target sequence TTGCAGGCTGCGTCGCTGCT |
3. Results
3.1. Involvement of STING in RNA Viruses That Utilise ROs
3.2. Non-Canonical Function of STING Is Essential for EV-D68 Replication
3.3. STING Does Not Contribute to Type-I Interferon Production in Response to EV-D68
3.4. STING Resides in PI4P-Rich Viral Replication Organelles
3.5. STING Modulates EV-D68-Induced Immunometabolism
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paul, D.; Madan, V.; Bartenschlager, R. Hepatitis C virus RNA replication and assembly: Living on the fat of the land. Cell Host Microbe 2014, 16, 569–579. [Google Scholar] [CrossRef] [PubMed]
- Welsch, S.; Miller, S.; Romero-Brey, I.; Merz, A.; Bleck, C.K.; Walther, P.; Fuller, S.D.; Antony, C.; Krijnse-Locker, J.; Bartenschlager, R. Composition and three-dimensional architecture of the dengue virus replication and assembly sites. Cell Host Microbe 2009, 5, 365–375. [Google Scholar] [CrossRef] [PubMed]
- Cortese, M.; Goellner, S.; Acosta, E.G.; Neufeldt, C.J.; Oleksiuk, O.; Lampe, M.; Haselmann, U.; Funaya, C.; Schieber, N.; Ronchi, P.; et al. Ultrastructural Characterization of Zika Virus Replication Factories. Cell Rep. 2017, 18, 2113–2123. [Google Scholar] [CrossRef] [PubMed]
- Richards, A.L.; Soares-Martins, J.A.; Riddell, G.T.; Jackson, W.T. Generation of unique poliovirus RNA replication organelles. mBio 2014, 5, e00833-13. [Google Scholar] [CrossRef]
- Zhang, J.; Lan, Y.; Sanyal, S. Membrane heist: Coronavirus host membrane remodeling during replication. Biochimie 2020, 179, 229–236. [Google Scholar] [CrossRef]
- Snijder, E.J.; Limpens, R.; de Wilde, A.H.; de Jong, A.W.M.; Zevenhoven-Dobbe, J.C.; Maier, H.J.; Faas, F.; Koster, A.J.; Barcena, M. A unifying structural and functional model of the coronavirus replication organelle: Tracking down RNA synthesis. PLoS Biol. 2020, 18, e3000715. [Google Scholar] [CrossRef]
- Nagy, P.D.; Strating, J.R.; van Kuppeveld, F.J. Building Viral Replication Organelles: Close Encounters of the Membrane Types. PLoS Pathog. 2016, 12, e1005912. [Google Scholar] [CrossRef]
- Triantafilou, M.; Ramanjulu, J.; Booty, L.M.; Jimenez-Duran, G.; Keles, H.; Saunders, K.; Nevins, N.; Koppe, E.; Modis, L.K.; Pesiridis, G.S.; et al. Human rhinovirus promotes STING trafficking to replication organelles to promote viral replication. Nat. Commun. 2022, 13, 1406. [Google Scholar] [CrossRef]
- Burdette, D.L.; Monroe, K.M.; Sotelo-Troha, K.; Iwig, J.S.; Eckert, B.; Hyodo, M.; Hayakawa, Y.; Vance, R.E. STING is a direct innate immune sensor of cyclic di-GMP. Nature 2011, 478, 515–518. [Google Scholar] [CrossRef]
- Ishikawa, H.; Barber, G.N. STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 2008, 455, 674–678. [Google Scholar] [CrossRef]
- Zhong, B.; Yang, Y.; Li, S.; Wang, Y.Y.; Li, Y.; Diao, F.; Lei, C.; He, X.; Zhang, L.; Tien, P.; et al. The adaptor protein MITA links virus-sensing receptors to IRF3 transcription factor activation. Immunity 2008, 29, 538–550. [Google Scholar] [CrossRef] [PubMed]
- Ishikawa, H.; Ma, Z.; Barber, G.N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 2009, 461, 788–792. [Google Scholar] [CrossRef] [PubMed]
- Gui, X.; Yang, H.; Li, T.; Tan, X.; Shi, P.; Li, M.; Du, F.; Chen, Z.J. Autophagy induction via STING trafficking is a primordial function of the cGAS pathway. Nature 2019, 567, 262–266. [Google Scholar] [CrossRef] [PubMed]
- Drosten, C.; Gunther, S.; Preiser, W.; van der Werf, S.; Brodt, H.R.; Becker, S.; Rabenau, H.; Panning, M.; Kolesnikova, L.; Fouchier, R.A.; et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N. Engl. J. Med. 2003, 348, 1967–1976. [Google Scholar] [CrossRef] [PubMed]
- Bermingham, A.; Chand, M.A.; Brown, C.S.; Aarons, E.; Tong, C.; Langrish, C.; Hoschler, K.; Brown, K.; Galiano, M.; Myers, R.; et al. Severe respiratory illness caused by a novel coronavirus, in a patient transferred to the United Kingdom from the Middle East, September 2012. Eurosurveillance 2012, 17, 20290. [Google Scholar] [CrossRef]
- Wu, J.T.; Leung, K.; Leung, G.M. Nowcasting and forecasting the potential domestic and international spread of the 2019-nCoV outbreak originating in Wuhan, China: A modelling study. Lancet 2020, 395, 689–697. [Google Scholar] [CrossRef]
- Lauinger, I.L.; Bible, J.M.; Halligan, E.P.; Bangalore, H.; Tosas, O.; Aarons, E.J.; MacMahon, E.; Tong, C.Y. Patient characteristics and severity of human rhinovirus infections in children. J. Clin. Virol. 2013, 58, 216–220. [Google Scholar] [CrossRef]
- Zhao, Y.; Shen, J.; Wu, B.; Liu, G.; Lu, R.; Tan, W. Genotypic diversity and epidemiology of human rhinovirus among children with severe acute respiratory tract infection in Shanghai, 2013–2015. Front. Microbiol. 2018, 9, 1836. [Google Scholar] [CrossRef]
- Civljak, R.; Tot, T.; Falsey, A.R.; Huljev, E.; Vranes, J.; Ljubin-Sternak, S. Viral pathogens associated with acute respiratory illness in hospitalized adults and elderly from Zagreb, Croatia, 2016 to 2018. J. Med. Virol. 2019, 91, 1202–1209. [Google Scholar] [CrossRef]
- Esposito, S.; Daleno, C.; Prunotto, G.; Scala, A.; Tagliabue, C.; Borzani, I.; Fossali, E.; Pelucchi, C.; Principi, N. Impact of viral infections in children with community-acquired pneumonia: Results of a study of 17 respiratory viruses. Influenza Other Respir. Viruses 2013, 7, 18–26. [Google Scholar] [CrossRef]
- Oberste, M.S.; Maher, K.; Schnurr, D.; Flemister, M.R.; Lovchik, J.C.; Peters, H.; Sessions, W.; Kirk, C.; Chatterjee, N.; Fuller, S.; et al. Enterovirus 68 is associated with respiratory illness and shares biological features with both the enteroviruses and the rhinoviruses. J. Gen. Virol. 2004, 85, 2577–2584. [Google Scholar] [CrossRef] [PubMed]
- Hixon, A.M.; Frost, J.; Rudy, M.J.; Messacar, K.; Clarke, P.; Tyler, K.L. Understanding Enterovirus D68-Induced Neurologic Disease: A Basic Science Review. Viruses 2019, 11, 821. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Yang, S.; Liu, S.; Chen, Y.; Liu, H.; Su, Y.; Liu, R.; Cui, Y.; Song, Y.; Teng, Y.; et al. Transcriptomic Profiling Reveals a Role for TREM-1 Activation in Enterovirus D68 Infection-Induced Proinflammatory Responses. Front. Immunol. 2021, 12, 749618. [Google Scholar] [CrossRef]
- Bass, A.; Liu, Y.; Dakshanamurthy, S. Single-Cell and Bulk RNASeq Profiling of COVID-19 Patients Reveal Immune and Inflammatory Mechanisms of Infection-Induced Organ Damage. Viruses 2021, 13, 2418. [Google Scholar] [CrossRef]
- Tanaka, Y.; Chen, Z.J. STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway. Sci. Signal 2012, 5, ra20. [Google Scholar] [CrossRef] [PubMed]
- Srikanth, S.; Woo, J.S.; Wu, B.; El-Sherbiny, Y.M.; Leung, J.; Chupradit, K.; Rice, L.; Seo, G.J.; Calmettes, G.; Ramakrishna, C.; et al. The Ca2+ sensor STIM1 regulates the type I interferon response by retaining the signaling adaptor STING at the endoplasmic reticulum. Nat. Immunol. 2019, 20, 152–162. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Kang, R.; Tang, D. STING1 in Different Organelles: Location Dictates Function. Front. Immunol. 2022, 13, 842489. [Google Scholar] [CrossRef]
- Zhang, R.; Kang, R.; Tang, D. The STING1 network regulates autophagy and cell death. Signal Transduct. Target. Ther. 2021, 6, 208. [Google Scholar] [CrossRef]
- Wu, J.; Chen, Y.J.; Dobbs, N.; Sakai, T.; Liou, J.; Miner, J.J.; Yan, N. STING-mediated disruption of calcium homeostasis chronically activates ER stress and primes T cell death. J. Exp. Med. 2019, 216, 867–883. [Google Scholar] [CrossRef]
- Akhmetova, K.; Balasov, M.; Chesnokov, I. Drosophila STING protein has a role in lipid metabolism. eLife 2021, 10, e67358. [Google Scholar] [CrossRef]
- dos Reis, L.M.; Berçot, M.R.; Castelucci, B.G.; Martins, A.J.E.; Castro, G.; Moraes-Vieira, P.M. Immunometabolic Signature during Respiratory Viral Infection: A Potential Target for Host-Directed Therapies. Viruses 2023, 15, 525. [Google Scholar] [CrossRef] [PubMed]
- Zevini, A.; Olagnier, D.; Hiscott, J. Crosstalk between Cytoplasmic RIG-I and STING Sensing Pathways. Trends Immunol. 2017, 38, 194–205. [Google Scholar] [CrossRef] [PubMed]
- Franz, K.M.; Neidermyer, W.J.; Tan, Y.J.; Whelan, S.P.J.; Kagan, J.C. STING-dependent translation inhibition restricts RNA virus replication. Proc. Natl. Acad. Sci. USA 2018, 115, E2058–E2067. [Google Scholar] [CrossRef] [PubMed]
- Tabata, K.; Prasad, V.; Paul, D.; Lee, J.-Y.; Pham, M.-T.; Twu, W.-I.; Neufeldt, C.J.; Cortese, M.; Cerikan, B.; Stahl, Y.; et al. Convergent use of phosphatidic acid for hepatitis C virus and SARS-CoV-2 replication organelle formation. Nat. Commun. 2021, 12, 7276. [Google Scholar] [CrossRef]
- Gomes, M.T.R.; Guimarães, E.S.; Marinho, F.V.; Macedo, I.; Aguiar, E.; Barber, G.N.; Moraes-Vieira, P.M.M.; Alves-Filho, J.C.; Oliveira, S.C. STING regulates metabolic reprogramming in macrophages via HIF-1α during Brucella infection. PLoS Pathog. 2021, 17, e1009597. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Triantafilou, K.; Szomolay, B.; Shepherd, M.W.; Ramanjulu, J.; Triantafilou, M. STING Orchestrates EV-D68 Replication and Immunometabolism within Viral-Induced Replication Organelles. Viruses 2024, 16, 1541. https://doi.org/10.3390/v16101541
Triantafilou K, Szomolay B, Shepherd MW, Ramanjulu J, Triantafilou M. STING Orchestrates EV-D68 Replication and Immunometabolism within Viral-Induced Replication Organelles. Viruses. 2024; 16(10):1541. https://doi.org/10.3390/v16101541
Chicago/Turabian StyleTriantafilou, Kathy, Barbara Szomolay, Mark William Shepherd, Joshi Ramanjulu, and Martha Triantafilou. 2024. "STING Orchestrates EV-D68 Replication and Immunometabolism within Viral-Induced Replication Organelles" Viruses 16, no. 10: 1541. https://doi.org/10.3390/v16101541
APA StyleTriantafilou, K., Szomolay, B., Shepherd, M. W., Ramanjulu, J., & Triantafilou, M. (2024). STING Orchestrates EV-D68 Replication and Immunometabolism within Viral-Induced Replication Organelles. Viruses, 16(10), 1541. https://doi.org/10.3390/v16101541