A Multiplex Quantitative Polymerase Chain Reaction for the Rapid Differential Detection of Subgroups A, B, J, and K Avian Leukosis Viruses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virus and Clinical Sample Treatment
2.2. DNA/RNA Extraction
2.3. Design of Primers and Probes
2.4. Optimization of the Multiplex qPCR
2.5. Specificity of the Multiplex qPCR
2.6. Sensitivity of the Multiplex qPCR
2.7. Repeatability of the Multiplex qPCR
2.8. Verification of the Multiplex qPCR
3. Results
3.1. Establishment of a Novel Multiplex qPCR
3.2. The Specificity of the Multiplex qPCR
3.3. Sensitivity of the Multiplex qPCR
3.4. Repeatability of the Multiplex qPCR
3.5. Evaluation of the Simulated Coinfections
3.6. Evaluation Using the Clinical Samples
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Payne, L.N.; Nair, V. The long view: 40 years of avian leukosis research. Avian Pathol. 2012, 41, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Su, Q.; Zhang, Z.; Cui, Z.; Chang, S.; Zhao, P. Molecular characteristics of the re-emerged avian leukosis virus in China, 2018–2019. Transbound. Emerg. Dis. 2020, 67, 1141–1151. [Google Scholar] [CrossRef] [PubMed]
- Fujita, D.J.; Chen, Y.C.; Friis, R.R.; Vogt, P.K. RNA tumor viruses of pheasants: Characterization of avian leukosis subgroups F and G. Virology 1974, 60, 558–571. [Google Scholar] [CrossRef] [PubMed]
- Fadly, A.M. Isolation and identification of avian leukosis viruses: A review. Avian Pathol. 2000, 29, 529–535. [Google Scholar] [CrossRef]
- Zhang, L.; Cai, D.; Zhao, X.; Cheng, Z.; Guo, H.; Qi, C.; Liu, J.; Xu, R.; Zhao, P.; Cui, Z. Liposomes containing recombinant gp85 protein vaccine against ALV-J in chickens. Vaccine 2014, 32, 2452–2456. [Google Scholar] [CrossRef]
- Xu, Q.; Ma, X.; Wang, F.; Li, H.; Zhao, X. Evaluation of a multi-epitope subunit vaccine against avian leukosis virus subgroup J in chickens. Virus Res. 2015, 210, 62–68. [Google Scholar] [CrossRef]
- Gao, Q.; Yun, B.; Wang, Q.; Jiang, L.; Zhu, H.; Gao, Y.; Qin, L.; Wang, Y.; Qi, X.; Gao, H.; et al. Development and application of a multiplex PCR method for rapid differential detection of subgroup A, B, and J avian leukosis viruses. J. Clin. Microbiol. 2014, 52, 37–44. [Google Scholar] [CrossRef]
- Chen, J.; Zhao, Z.; Chen, Y.; Zhang, J.; Yan, L.; Zheng, X.; Liao, M.; Cao, W. Development and application of a SYBR green real-time PCR for detection of the emerging avian leukosis virus subgroup K. Poult. Sci. 2018, 97, 2568–2574. [Google Scholar] [CrossRef]
- Dai, M.; Feng, M.; Liu, D.; Cao, W.; Liao, M. Development and application of SYBR Green I real-time PCR assay for the separate detection of subgroup J Avian leukosis virus and multiplex detection of avian leukosis virus subgroups A and B. Virol. J. 2015, 12, 52. [Google Scholar] [CrossRef]
- Mo, G.; Wei, P.; Hu, B.; Nie, Q.; Zhang, X. Advances on genetic and genomic studies of ALV resistance. J. Anim. Sci. Biotechnol. 2022, 13, 123. [Google Scholar] [CrossRef]
- Shen, Y.; Cai, L.; Wang, Y.; Wei, R.; He, M.; Wang, S.; Wang, G.; Cheng, Z. Genetic mutations of avian leukosis virus subgroup J strains extended their host range. J. Gen. Virol. 2014, 95, 691–699. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Lin, L.; Shi, M.; Li, H.; Gu, Z.; Li, M.; Gao, Y.; Teng, H.; Mo, M.; Wei, T.; et al. Vertical transmission of ALV from ALV-J positive parents caused severe immunosuppression and significantly reduced marek’s disease vaccine efficacy in three-yellow chickens. Vet. Microbiol. 2020, 244, 108683. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.H.; Yao, Z.Q.; Zhao, Q.Q.; Chen, S.; Hu, Z.Z.; Xie, Z.; Chen, L.Y.; Ji, J.; Chen, F.; Zhang, X.H.; et al. Development and application of a reverse-transcription recombinase-aided amplification assay for subgroup J Avian leukosis virus. Poult. Sci. 2022, 101, 101743. [Google Scholar] [CrossRef] [PubMed]
- Peng, H.; Qin, L.; Bi, Y.; Wang, P.; Zou, G.; Li, J.; Yang, Y.; Zhong, X.; Wei, P. Rapid detection of the common avian leukosis virus subgroups by real-time loop-mediated isothermal amplification. Virol. J. 2015, 12, 195. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Yun, B.; Qin, L.; Pan, W.; Qu, Y.; Liu, Z.; Wang, Y.; Qi, X.; Gao, H.; Wang, X. Molecular epidemiology of avian leukosis virus subgroup J in layer flocks in China. J. Clin. Microbiol. 2012, 50, 953–960. [Google Scholar] [CrossRef]
- Du, X.; Zhou, D.; Zhou, J.; Xue, J.; Cheng, Z. Marek’s Disease virus and reticuloendotheliosis virus coinfection enhances viral replication and alters cellular protein profiles. Front. Vet. Sci. 2022, 9, 854007. [Google Scholar] [CrossRef]
- Yan, T.; Zhu, S.; Wang, H.; Li, C.; Diao, Y.; Tang, Y. Synergistic pathogenicity in sequential coinfection with fowl adenovirus type 4 and avian orthoreovirus. Vet. Microbiol. 2020, 251, 108880. [Google Scholar] [CrossRef]
- Zheng, L.P.; Teng, M.; Li, G.X.; Zhang, W.K.; Wang, W.D.; Liu, J.L.; Li, L.Y.; Yao, Y.; Nair, V.; Luo, J. Current epidemiology and co-infections of avian immunosuppressive and neoplastic diseases in chicken flocks in Central China. Viruses 2022, 14, 2599. [Google Scholar] [CrossRef]
- Chen, W.; Chen, S.; Nie, Y.; Li, W.; Li, H.; Zhang, X.; Chen, F.; Xie, Q. Synergistic immunosuppression of avian leukosis virus subgroup J and infectious bursal disease virus is responsible for enhanced pathogenicity. Viruses 2022, 14, 2312. [Google Scholar] [CrossRef]
- Zhou, D.; Ding, L.; Xu, M.; Liu, X.; Xue, J.; Zhang, X.; Du, X.; Zhou, J.; Cui, X.; Cheng, Z. Musashi-1 and miR-147 Precursor interaction mediates synergistic oncogenicity induced by co-infection of two avian retroviruses. Cells 2022, 11, 3312. [Google Scholar] [CrossRef]
- Li, M.; Xiong, H.; Wu, H.; Hu, D.; Lin, Y.; Huang, X.; Wang, J.; Qi, K.; Liu, H. Pathologic characterization of coinfection with Histomonas meleagridis, Marek’s Disease virus, and subtype J avian leukosis virus in chickens. Avian Dis. 2021, 65, 237–240. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.Z.; Zhang, H.H.; Liu, Q.; Qiu, B.; Wang, F.; Wang, X.W.; Chen, H.B.; Cheng, Z.Q. Isolation and identification of avian leukosis virus-B from layer chickens infected with avian leukosis virus-J. Bing Du Xue Bao 2009, 25, 445–451. [Google Scholar] [PubMed]
- Zeng, T.; Xie, Z.; Xie, L.; Deng, X.; Xie, Z.; Luo, S.; Huang, L.; Huang, J. Simultaneous detection of eight immunosuppressive chicken viruses using a GeXP analyser-based multiplex PCR assay. Virol. J. 2015, 12, 226. [Google Scholar] [CrossRef]
- Li, X.; Yu, Y.; Ma, M.; Chang, F.; Muhammad, F.; Yu, M.; Ren, C.; Bao, Y.; Zhang, Z.; Liu, A.; et al. Molecular characteristic and pathogenicity analysis of a novel multiple recombinant ALV-K strain. Vet. Microbiol. 2021, 260, 109184. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Gu, Y.; Chen, X.; Li, T.; Gao, Y.; Wang, X.; Fang, C.; Fang, S.; Yang, Y. Identification and characterization of a novel natural recombinant avian leucosis virus from Chinese indigenous chicken flock. Virus Genes 2019, 55, 726–733. [Google Scholar] [CrossRef]
- Lupiani, B.; Hunt, H.; Silva, R.; Fadly, A. Identification and characterization of recombinant subgroup J avian leukosis viruses (ALV) expressing subgroup A ALV envelope. Virology 2000, 276, 37–43. [Google Scholar] [CrossRef]
- Li, Q.; Wang, P.; Li, M.; Lin, L.; Shi, M.; Li, H.; Deng, Q.; Teng, H.; Mo, M.; Wei, T.; et al. Recombinant subgroup B avian leukosis virus combined with the subgroup J env gene significantly increases its pathogenicity. Vet. Microbiol. 2020, 250, 108862. [Google Scholar] [CrossRef]
ALV-A | ALV-B | ALV-J | ALV-K | ALV-E |
---|---|---|---|---|
KY612442.1 | MG812183.1 | MN735295.1 | KM873219.1 | KC610517.1 |
L10922.1 | KC282901.1 | MK683480.1 | KP686144.1 | AY013303.1 |
AF507031.1 | JX570799.1 | KF562374.1 | MT783273.1 | MF817822.1 |
MT179557.1 | AF052428.1 | MT538248.1 | AB670312.1 | KY235336.1 |
EU352877.1 | MT648687.1 | JN624880.1 | KY490696.1 | AY013304.1 |
MH186087.1 | X00144.1 | KU997685.1 | KF999962.1 | MF817821.1 |
KU375453.1 | L10924.1 | MW891540.1 | MK941182.1 | KC610516.1 |
KF866225.1 | M11206.1 | KY980662.1 | KU605774.1 | MT623675.1 |
HM452340.1 | MT648688.1 | JX423792.1 | HM582658.1 | EF467236.1 |
MZ836212.1 | M14902.1 | OL799232.1 | KY767731.1 | AB617818.1 |
Primers and Probes | Sequences (5′ end to 3′ end) |
---|---|
qALV-A/K-F | TTCCCAGTCTCTCCCTAACATTACT |
qALV-A/K-R | GCTGTCACCACCGTAAATGGTT |
qALV-A-Probe | ROX-TTAGAAAAGGAGGATTGTYTAAGGAGGAA-BHQ2 |
qALV-K-Probe | FAM-AGTTGCGGCCTGGACCAATCTGAAA-BHQ1 |
qALV-B-F | CTACAGGTTCTGGGAAATGTACAAT |
qALV-B-R | CTGTGCTTGTGCACCAATTTTC |
qALV-B-Probe | Cy5-AAATGAGWCAGAATTGGTCCATCTGTCA-BHQ2 |
qALV-J-F | AAGAAAGACCCGGAGAAGACAC |
qALV-J-R | CTTATTTGCCCAGGTGACCC |
qALV-J-Probe | VIC-CACGTTTCCTGGTTGTTGCAACAGATG-BHQ1 |
ALV-A/B/J-F | GGATGAGGTGACTAAGAAAG |
ALV-A-R | AGAGAAAGAGGGGTGTCTAAGGAGA |
ALV-B-R | ATGGACCAATTCTGACTCATT |
ALV-J-R | CGAACCAAAGGTAACACACG |
ALV-K-F | TATGGATCCGATGTTCACTTACTCGAGC |
ALV-K-R | AGAGTCGACGATGCTTCGTTTACGTCTTA |
Plasmid | No. of DNA Copies | Intra-Assay | Inter-Assay | ||
---|---|---|---|---|---|
Ct (Mean ± SD) | CV (%) | Ct (Mean ± SD) | CV (%) | ||
pMD-alvA | 4 × | 26.54 ± 0.19 | 0.72 | 26.62 ± 0.11 | 0.41 |
4 × | 30.03 ± 0.08 | 0.27 | 29.81 ± 0.04 | 0.13 | |
4 × | 33.85 ± 0.22 | 0.65 | 32.98 ± 0.36 | 1.09 | |
pMD-alvB | 1.1 × | 23.67 ± 0.13 | 0.55 | 25.78 ± 0.11 | 0.43 |
1.1 × | 27.34 ± 0.20 | 0.73 | 29.18 ± 0.14 | 0.48 | |
1.1 × | 31.28 ± 0.26 | 0.83 | 31.56 ± 0.30 | 0.95 | |
pMD-alvJ | 1.37 × | 24.80 ± 0.04 | 0.17 | 25.55 ± 0.08 | 0.31 |
1.37 × | 27.70 ± 0.08 | 0.29 | 28.16 ± 0.07 | 0.25 | |
1.37 × | 30.83 ± 0.07 | 0.23 | 30.60 ± 0.25 | 0.82 | |
pMD-alvK | 9.6 × | 24.81 ± 0.19 | 0.77 | 24.17 ± 0.08 | 0.33 |
9.6 × | 27.52 ± 0.23 | 0.84 | 27.50 ± 0.12 | 0.44 | |
9.6 × | 31.73 ± 0.27 | 0.85 | 31.28 ± 0.18 | 0.58 |
Samples | Total | ELISA | Multiplex qPCR | Routine PCR | Virus Isolation |
---|---|---|---|---|---|
Tissue | 132 | 26/132 | 25/132 | 25/132 | 21/132 |
Albumen | 401 | 62/401 | 44/401 | 41/401 | 30/401 |
Plasma | 104 | 32/104 | 30/104 | 28/104 | 27/104 |
Semen | 215 | 41/215 | 37/215 | 36/215 | 32/215 |
Total | 852 | 161/852 | 136/852 | 130/852 | 110/852 |
Positive rate | - | 18.90% | 15.96% | 15.14% | 12.91% |
ALV Subgroup | Numbers (Percent) | ||
---|---|---|---|
Multiplex qPCR | PCR | ELISA a | |
ALV-A alone | 0 (0%) | 0 (0%) | - |
ALV-B alone | 0 (0%) | 0 (0%) | - |
ALV-J alone | 100 (11.74%) | 97 (11.38%) | - |
ALV-K alone | 0 (0%) | 0 (0%) | - |
ALV-A/J | 6 (0.70%) | 6 (0.70%) | - |
ALV-B/J | 3 (0.35%) | 3 (0.35%) | - |
ALV-K/J | 2 (0.23%) | 2 (0.23%) | - |
ALV-A/B/K | 1 (0.12%) | 1 (0.12%) | - |
ALV-A/B/J | 1 (0.12%) | 1 (0.12%) | - |
Total | 113/852 (13.26%) | 110/852 (12.91%) | 110/852 (12.91%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dou, J.; Wang, Z.; Li, L.; Lu, Q.; Jin, X.; Ling, X.; Cheng, Z.; Zhang, T.; Shao, H.; Zhai, X.; et al. A Multiplex Quantitative Polymerase Chain Reaction for the Rapid Differential Detection of Subgroups A, B, J, and K Avian Leukosis Viruses. Viruses 2023, 15, 1789. https://doi.org/10.3390/v15091789
Dou J, Wang Z, Li L, Lu Q, Jin X, Ling X, Cheng Z, Zhang T, Shao H, Zhai X, et al. A Multiplex Quantitative Polymerase Chain Reaction for the Rapid Differential Detection of Subgroups A, B, J, and K Avian Leukosis Viruses. Viruses. 2023; 15(9):1789. https://doi.org/10.3390/v15091789
Chicago/Turabian StyleDou, Junfeng, Zui Wang, Li Li, Qin Lu, Xinxin Jin, Xiaochun Ling, Zhengyu Cheng, Tengfei Zhang, Huabin Shao, Xinguo Zhai, and et al. 2023. "A Multiplex Quantitative Polymerase Chain Reaction for the Rapid Differential Detection of Subgroups A, B, J, and K Avian Leukosis Viruses" Viruses 15, no. 9: 1789. https://doi.org/10.3390/v15091789
APA StyleDou, J., Wang, Z., Li, L., Lu, Q., Jin, X., Ling, X., Cheng, Z., Zhang, T., Shao, H., Zhai, X., & Luo, Q. (2023). A Multiplex Quantitative Polymerase Chain Reaction for the Rapid Differential Detection of Subgroups A, B, J, and K Avian Leukosis Viruses. Viruses, 15(9), 1789. https://doi.org/10.3390/v15091789