Genetic Variability and Molecular Evolution of Tomato Mosaic Virus Populations in Three Northern China Provinces
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Virus Detection
2.2. Whole Genome Amplification, Sequence Alignment, and Phylogenetic Analysis
2.3. Estimation of Genetic Diversity Parameters and Population Differentiation
2.4. Recombination Analysis
3. Results
3.1. Field Symptoms and ToMV PCR Identification
3.2. Phylogenetic Relationship among ToMV Strains
3.3. Homology and Variation among ToMV Strains
3.4. Estimation of Genetic Diversity Parameters and Population Differentiation
3.5. The ToMV Genetic Organisation Is Highly Conserved
3.6. Recombination Analyses
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ghorbani, A.; Razavi, S.M.; Ghasemi Omran, V.O.; Pirdashti, H. Piriformospora indica inoculation alleviates the adverse effect of NaCl stress on growth, gas exchange and chlorophyll fluorescence in tomato (Solanum lycopersicum L.). Plant Biol. 2018, 20, 729–736. [Google Scholar] [CrossRef] [PubMed]
- Desneux, N.; Luna, M.G.; Guillemaud, T.; Urbaneja, A. The invasive South American tomato pinworm, Tuta absoluta, continues to spread in Afro-Eurasia and beyond: The new threat to tomato world production. J. Pest Sci. 2011, 84, 403–408. [Google Scholar] [CrossRef]
- Prasad, A.; Sharma, N.; Hari-Gowthem, G.; Muthamilarasan, M.; Prasad, M. Tomato yellow leaf curl virus: Impact, challenges, and management. Trends Plant Sci. 2020, 25, 897–911. [Google Scholar] [CrossRef] [PubMed]
- Fukuhara, T.; Tabara, M.; Koiwa, H.; Takahashi, H. Effect of asymptomatic infection with southern tomato virus on tomato plants. Arch. Virol. 2020, 165, 11–20. [Google Scholar] [CrossRef]
- Fiallo-Olivé, E.; Navas-Castillo, J. Tomato chlorosis virus, an emergent plant virus still expanding its geographical and host ranges. Mol. Plant Pathol. 2019, 20, 1307–1320. [Google Scholar] [CrossRef] [Green Version]
- Yan, Z.Y.; Ma, H.Y.; Han, S.L.; Geng, C.; Tian, Y.P.; Li, X.D. First report of tomato brown rugose fruit virus infecting tomato in China. Plant Dis. 2019, 103, 2973. [Google Scholar] [CrossRef]
- Kumar, S.; Udaya Shankar, A.C.; Nayaka, S.C.; Lund, O.S.; Prakash, H.S. Detection of tobacco mosaic virus and tomato mosaic virus in pepper and tomato by multiplex RT–PCR. Lett. Appl. Microbiol. 2011, 53, 359–363. [Google Scholar] [CrossRef]
- FAO. Statistical Database of the Food and Agricultural Organization of the United Nations: FAOSTAT. 2018. Available online: http://www.fao.org/faostat/en/#data (accessed on 18 December 2020).
- Mrkvová, M.; Hančinský, R.; Grešíková, S.; Kaňuková, Š.; Barilla, J.; Glasa, M.; Hauptvogel, P.; Kraic, J.; Mihálik, D. Evaluation of new polyclonal antibody developed for serological diagnostics of tomato mosaic virus. Viruses 2022, 14, 1331. [Google Scholar] [CrossRef]
- Rangel, E.A.; Alfaro-Fernández, A.; Font-San-Ambrosio, M.I.; Luis-Arteaga, M.; Rubio, L. Genetic variability and evolutionary analyses of the coat protein gene of tomato mosaic virus. Virus Genes 2011, 43, 435–438. [Google Scholar] [CrossRef]
- Gibbs, A. Evolution and origins of tobamoviruses. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 1999, 354, 593–602. [Google Scholar] [CrossRef] [Green Version]
- Hu, Q.; Jiang, T.; Xue, C.; Zhou, X. Characterization and complete nucleotide sequence of two isolates of tomato mosaic virus. J. Phytopathol. 2012, 160, 115–119. [Google Scholar] [CrossRef]
- Pozharskiy, A.; Kostyukova, V.; Taskuzhina, A.; Nizamdinova, G.; Kisselyova, N.; Kalendar, R.; Karimov, N.; Gritsenko, D. Screening a collection of local and foreign varieties of Solanum lycopersicum L. in Kazakhstan for genetic markers of resistance against three tomato viruses. Heliyon 2022, 8, e10095. [Google Scholar] [CrossRef]
- Diaz-Lara, A.; Santamaria, L.; Martin, R.R. Identification of tomato mosaic virus (ToMV) and potato latent virus (PotLV) as mixed infection in Chinese lantern (Physalis alkekengi) expressing virus-like disease symptoms. Plant Dis. 2017, 101, 1061. [Google Scholar] [CrossRef]
- Pagán, I.; Firth, C.; Holmes, E.C. Phylogenetic analysis reveals rapid evolutionary dynamics in the plant RNA virus genus tobamovirus. J. Mol. Evol. 2010, 71, 298–307. [Google Scholar] [CrossRef]
- Xu, Y.; Zhang, S.; Shen, J.; Wu, Z.; Du, Z.; Gao, F. The phylogeographic history of tomato mosaic virus in Eurasia. Virology 2021, 554, 42–47. [Google Scholar] [CrossRef] [PubMed]
- Fujisaki, K.; Ishikawa, M. Identification of an Arabidopsis thaliana protein that binds to tomato mosaic virus genomic RNA and inhibits its multiplication. Virology 2008, 380, 402–411. [Google Scholar] [CrossRef] [Green Version]
- Aghamohammadi, V.; Rakhshandehroo, F.; Shamsbakhsh, M.; Palukaitis, P. Distribution and genetic diversity of tomato mosaic virus isolates in Iran. J. Plant Pathol. 2013, 95, 339–347. [Google Scholar]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sanchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [PubMed]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ullah, N.; Akhtar, K.P.; Saleem, M.Y.; Habib, M. Characterization of tomato mosaic virus and search for its resistance in Solanum species. Eur. J. Plant Pathol. 2019, 155, 1195–1209. [Google Scholar] [CrossRef]
- Ge, B.B.; Liu, G.J.; Wang, H.Q. First report of tomato mosaic virus infecting pepino in China. Plant Dis. 2012, 96, 1704. [Google Scholar] [CrossRef] [PubMed]
- Hashemi, S.S.; Rakhshandehroo, F.; Shahraeen, N. First report of tomato mosaic virus on common sow thistle in Iran. Plant Dis. 2014, 98, 1164. [Google Scholar] [CrossRef]
- Fillmer, K.; Adkins, S.; Pongam, P.; D’Elia, T. Complete genome sequence of tomato mosaic virus isolated from jasmine in the United States. Genome Announc. 2015, 3, e00706–e00715. [Google Scholar] [CrossRef] [Green Version]
- Broadbent, L. Epidemiology and control of tomato mosaic virus. Annu. Rev. Phytopathol. 1976, 14, 75–96. [Google Scholar] [CrossRef]
- Fraile, A.; García-Arenal, F. The coevolution of plants and viruses: Resistance and pathogenicity. Adv. Virus Res. 2010, 76, 1–32. [Google Scholar] [CrossRef] [Green Version]
- Lewandowski, D.J.; Dawson, W.O. Functions of the 126-and 183-kDa proteins of tobacco mosaic virus. Virology 2000, 271, 90–98. [Google Scholar] [CrossRef] [Green Version]
- Abrahamian, P.; Cai, W.; Nunziata, S.O.; Ling, K.-S.; Jaiswal, N.; Mavrodieva, V.A.; Rivera, Y.; Nakhla, M.K. Comparative analysis of tomato brown rugose fruit virus isolates shows limited genetic diversity. Viruses 2022, 14, 2816. [Google Scholar] [CrossRef] [PubMed]
- Hak, H.; Spiegelman, Z. The Tomato brown rugose fruit virus movement protein overcomes Tm-22 resistance in tomato while attenuating viral transport. Mol. Plant-Microbe Interact. 2021, 34, 1024–1032. [Google Scholar] [CrossRef] [PubMed]
- Dombrovsky, A.; Smith, E. Seed transmission of Tobamoviruses: Aspects of global disease distribution. Adv. Seed Biol. 2017, 12, 233–260. [Google Scholar]
Primers | Sequence (5′-3′) | Temperature (°C) | Position (bp) | Reference |
---|---|---|---|---|
Primers used for virus detection | ||||
ToMV-f | CAAATCCTCAAAAAGAGGTCCG | 50 | 5540–5561 | This study |
ToMV-r | CAAACTTTATATTTCAGCACC | 6189–6209 | ||
Primers used for full-length cDNA amplification | ||||
ToMV-1F | GCCGTATTTTTACAACAATTACCAAC | 56 | 1–23 | This study |
ToMV-1R | GGGGCTACCAGGCTGTCTATAAAGT | 2216–1193 | ||
ToMV-2F | CAACAGCTAGTTCGTTAATTCATAA | 53 | 2116–2140 | This study |
ToMV-2R | TTACCGATAAAAGTTGTAACATCACCAC | 4432–4404 | ||
ToMV-3F | CAATGGACGTACTTGAGTTGGATG | 55 | 4207–4230 | This study |
ToMV-3R | TTATATATGGGCCCCAACCGG | 6383–6369 | ||
Primers used for 5′/3′ RACE | ||||
TO5SP1 | AAGTCAACCTGTCTCCATC | - | 850–831 | [12] |
TO5SP2 | GCTTTGGTTGCAATAAGCGTCTG | - | 265–243 | |
TO3SP1 | GTATGGGCTGACCCTATAGA | - | 5751–5770 | [12] |
TO3SP2 | TTGAAAGTATGTCTGGGTTG | - | 6136–6156 |
Province | Location | No. of Leaf Sample Tested | No. of ToMV-Positive Samples | ToMV Sample Detection Rate (%) |
---|---|---|---|---|
Shandong | Liaocheng | 54 | 30 | 55.56 |
Shouguang | 87 | 74 | 85.06 | |
Taian | 73 | 58 | 79.45 | |
Zibo | 90 | 15 | 16.67 | |
Jining | 32 | 11 | 34.38 | |
Yantai | 61 | 50 | 81.97 | |
Dezhou | 9 | 6 | 66.67 | |
Inner Mongolia | Hohhot | 6 | 6 | 100.00 |
Shanxi | Jinzhong | 13 | 11 | 84.62 |
Total | - | 425 | 261 | 61.41 |
Genomic Region | Nucleotide Number | Nucleotide Mutation | Nucleotide Mutation Rate% | Amino Acid Number | Amino Acid Mutation | Amino Acid Mutation Rate% |
---|---|---|---|---|---|---|
5′UTR | 71 | 4 | 5.6 | 23 | - | - |
126 KDa | 3351 | 64 | 1.9 | 1117 | 7 | 0.6 |
183 KDa | 4851 | 93 | 1.9 | 1617 | 13 | 0.8 |
MP | 795 | 12 | 1.5 | 265 | 0 | 0 |
CP | 480 | 12 | 2.5 | 160 | 1 | 0.6 |
3′UTR | 201 | 6 | 2.9 | 67 | - | - |
No. of Sequences a | Nucleotides b | h c | Hd d | S e | Eta f | π g | dN/dS | Tajima’s D | Fu & Li’s D | Fu & Li’s F | |
---|---|---|---|---|---|---|---|---|---|---|---|
A | 89 | 480 | 52 | 0.973 (±6 × 10−5) | 185 | 212 | 0.040 | 0.066 | −1.848 * | −3.689 * | −3.490 * |
B | 39 | 480 | 23 | 0.950 (±4 × 10−4) | 39 | 40 | 0.010 | 0.138 | −1.825 * | −1.775 ** | −2.126 ** |
C | 13 | 480 | 9 | 0.936 (±2.57 × 10−3) | 18 | 18 | 0.008 | 0.135 | −1.411 ** | −1.153 ** | −1.396 ** |
D | 4 | 480 | 4 | 1.000 (±3.125 × 10−2) | 75 | 76 | 0.080 | 0.055 | −0.828 ** | −0.786 ** | −0.848 ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lyu, J.; Yang, Y.; Sun, X.; Jiang, S.; Hong, H.; Zhu, X.; Liu, Y. Genetic Variability and Molecular Evolution of Tomato Mosaic Virus Populations in Three Northern China Provinces. Viruses 2023, 15, 1617. https://doi.org/10.3390/v15071617
Lyu J, Yang Y, Sun X, Jiang S, Hong H, Zhu X, Liu Y. Genetic Variability and Molecular Evolution of Tomato Mosaic Virus Populations in Three Northern China Provinces. Viruses. 2023; 15(7):1617. https://doi.org/10.3390/v15071617
Chicago/Turabian StyleLyu, Jinfu, Yuanyuan Yang, Xiaohui Sun, Shanshan Jiang, Hao Hong, Xiaoping Zhu, and Yongguang Liu. 2023. "Genetic Variability and Molecular Evolution of Tomato Mosaic Virus Populations in Three Northern China Provinces" Viruses 15, no. 7: 1617. https://doi.org/10.3390/v15071617