Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus
Abstract
1. Introduction
2. Materials and Method
2.1. Plant Material, Total RNA Extraction, and Crude Sample Preparation
2.2. The Detection of YMV by RT-PCR and Phylogenetic Analysis
2.3. New LAMP Primer Design for YMV Detection
2.4. Detection of YMV by RT-LAMP
2.5. Sensitivity Test for the Improved YMV RT-LAMP Assay
3. Results
3.1. Indexing of YMV by RT-PCR and RT-LAMP Assays
3.2. Evaluation of Improved YMV RT-LAMP Assay Specificity
3.3. Sensitivity of Improved YMV RT-LAMP
3.4. Comparison of Conventional RT-PCR and the New RT-LAMP
3.5. Sequence Identity and Phylogenetic Analysis of YMV Amplicons
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Thouvenel, J.C.; Fauquet, C. Yam mosaic, a new potyvirus infecting Dioscorea cayenensis in the Ivory Coast. Ann. Appl. Biol. 1979, 93, 279–283. [Google Scholar] [CrossRef]
- Bakayoko, Y.; Kouakou, A.; Kouassi, A.B.; Gomez, R.M.; Dibi, K.E.B.; Essis, B.S.; N’Zué, B.; Adebola, P.; N’Guetta, A.S.P.; Umber, M. Detection and diversity of viruses infecting African yam (Dioscorea rotundata) in a collection and F1 progenies in Côte d’Ivoire shed light to plant-to-plant viral transmission. Plant Pathol. 2021, 70, 1486–1495. [Google Scholar] [CrossRef] [PubMed]
- Diouf, M.B.; Festus, R.; Silva, G.; Guyader, S.; Umber, M.; Seal, S.; Teycheney, P.Y. Viruses of yams (Dioscorea spp.): Current gaps in knowledge and future research directions to improve disease management. Viruses 2022, 14, 1884. [Google Scholar] [CrossRef] [PubMed]
- Luo, G.F.; Podolyan, A.; Kidanemariam, D.B.; Pilotti, C.; Houliston, G.; Sukal, A.C. A review of viruses infecting yam (Dioscorea spp.). Viruses 2022, 14, 662. [Google Scholar] [CrossRef] [PubMed]
- Asiedu, R.; Sartie, A. Crops that feed the World 1. Yams. Food Secur. 2010, 2, 305–315. [Google Scholar] [CrossRef]
- Aleman-Verdaguer, M.E.; Goudou-Urbino, C.; Dubern, J.; Beachy, R.N.; Fauquet, C. Analysis of the sequence diversity of the P1, HC, P3, NIb and CP genomic regions of several yam mosaic potyvirus isolates: Implications for the intraspecies molecular diversity of potyviruses. J. Gen. Virol. 1997, 78, 1253–1264. [Google Scholar] [CrossRef]
- Fuji, S.; Nakamae, H. Complete nucleotide sequence of the genomic RNA of a Japanese Yam mosaic virus, a new potyvirus in Japan. Arch. Virol. 1999, 144, 231–240. [Google Scholar] [CrossRef]
- Bömer, M.; Rathnayake, A.I.; Visendi, P.; Sewe, S.O.; Sicat, J.P.A.; Silva, G.; Kumar, P.L.; Seal, S.E. Tissue culture and next-generation sequencing: A combined approach for detecting yam (Dioscorea spp.) viruses. Physiol. Mol. Plant Pathol. 2019, 105, 54–66. [Google Scholar] [CrossRef]
- Mendoza, A.R.; Margaria, P.; Nagata, T.; Winter, S.; Blawid, R. Characterization of Yam mosaic viruses from Brazil reveals a new phylogenetic group and possible incursion from the African continent. Virus Genes 2022, 58, 294–307. [Google Scholar] [CrossRef]
- Azeteh, I.N.; Hanna, R.; Njukeng, A.P.; Oresanya, A.O.; Sakwe, P.N.; Kumar, L.P. Distribution and diversity of viruses infecting yams (Dioscorea spp.) in Cameroon. VirusDisease 2019, 30, 526–537. [Google Scholar] [CrossRef]
- Eni, A.O.; Hughes, J.A.; Asiedu, R.; Rey, M.E.C. Survey of the incidence and distribution of viruses infecting yam (Dioscorea spp.) in Ghana and Togo. Ann. Appl. Biol. 2010, 156, 243–251. [Google Scholar] [CrossRef]
- Séka, K.; Etchian, A.O.; Assiri, P.K.; Toualy, M.N.Y.; Diallo, H.A.; Kouassi, N.K. Yield loss caused by Yam mosaic virus (YMV) and cucumber mosaic virus (CMV) on the varieties of Dioscorea spp. Int. J. Agron. Agric. Res. 2014, 5, 64–71. [Google Scholar]
- Adeniji, M.O.; Shoyinka, S.A.; Ikotun, T.; Asiedu, R.; Hughes, J.A.; Odu, B.O. Yield loss in Guinea yam (Dioscorea rotundata poir.) due to infection by Yam mosaic virus (YMV) genus Potyvirus. Ife J. Sci. 2012, 14, 237–244. [Google Scholar]
- Hahn, S.K.; Osiru, D.S.O.; Akoroda, M.O.; Otoo, J.A. Yam production and its future prospects. Outlook Agric. 1987, 16, 105–110. [Google Scholar] [CrossRef]
- Balogun, M.O.; Maroya, N.; Asiedu, R. Status and prospects for improving yam seed systems using temporary immersion bioreactors. Afr. J. Biotechnol. 2014, 13, 1614–1622. [Google Scholar] [CrossRef]
- Aighewi, B.A.; Asiedu, R.; Maroya, N.; Balogun, M. Improved propagation methods to raise the productivity of yam (Dioscorea rotundata Poir.). Food Secur. 2015, 7, 823–834. [Google Scholar] [CrossRef]
- Stuart, E.; Asfaw, A.; Adebola, P.; Maroya, N.; Edemodu, A.; Adeosun, T.; Asiedu, R.; Almekinders, C. Yam seed system characteristics in Nigeria: Local practices, preferences, and the implications for seed system interventions. Outlook Agric. 2021, 50, 455–467. [Google Scholar] [CrossRef]
- Balogun, M.; Maroya, N.; Augusto, J.; Ajayi, A.; Kumar, L.; Aighewi, B.; Asiedu, R. Relative efficiency of positive selection and tissue culture for generating pathogen-free planting materials of yam (Dioscorea spp.). Czech J. Genet. Plant Breed. 2017, 53, 9–16. [Google Scholar] [CrossRef]
- Ita, E.E.; Uyoh, E.A.; Nakamura, I.; Ntui, V.O. Efficient elimination of Yam mosaic virus (YMV) from white yam (Dioscorea rotundata Poir.) by cryotherapy of axillary buds. S. Afr. J. Bot. 2020, 130, 123–129. [Google Scholar] [CrossRef]
- Maroya, N.; Balogun, M.; Asiedu, R.; Aighewi, B.; Kumar, P.L.; Augusto, J. Yam propagation using ‘aeroponics’ technology. Annu. Res. Rev. Biol. 2014, 4, 3894–3903. [Google Scholar] [CrossRef]
- Aighewi, B.; Maroya, N.; Kumar, P.L.; Balogun, M.; Aihebhoria, D.; Mignouna, D.; Asiedu, R. Seed yam production using high-quality minitubers derived from plants established with vine cuttings. Agronomy 2021, 11, 978. [Google Scholar] [CrossRef]
- Silva, G.; Bömer, M.; Nkere, C.; Kumar, P.L.; Seal, S.E. Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification. J. Virol. Methods 2015, 222, 138–144. [Google Scholar] [CrossRef] [PubMed]
- Nkere, C.K.; Oyekanmi, J.O.; Silva, G.; Bömer, M.; Atiri, G.I.; Onyeka, J.; Maroya, N.G.; Seal, S.E.; Kumar, P.L. Chromogenic detection of Yam mosaic virus by closed-tube reverse transcription loop-mediated isothermal amplification (CT-RT-LAMP). Arch. Virol. 2018, 163, 1057–1061. [Google Scholar] [CrossRef]
- Bousalem, M.; Dallot, S.; Guyader, S. The use of phylogenetic data to develop molecular tools for the detection and genotyping of Yam mosaic virus. Potential application in molecular epidemiology. J. Virol. Methods 2000, 90, 25–36. [Google Scholar] [CrossRef]
- Mumford, R.A.; Jayaratne, D.L.; Seal, S.E. The Use of the Polymerase Chain Reaction for the Characterisation and Diagnosis of Yam Potyviruses; Springer: Dordrecht, The Netherlands, 1997; pp. 157–160. [Google Scholar] [CrossRef]
- Mumford, R.A.; Seal, S.E. Rapid single-tube immunocapture RT-PCR for the detection of two yam potyviruses. J. Virol. Methods 1997, 69, 73–79. [Google Scholar] [CrossRef] [PubMed]
- Silva, G.; Oyekanmi, J.; Nkere, C.K.; Bömer, M.; Kumar, P.L.; Seal, S.E. Rapid detection of potyviruses from crude plant extracts. Anal. Biochem. 2018, 546, 17–22. [Google Scholar] [CrossRef]
- Umber, M.; Filloux, D.; Gélabale, S.; Gomez, R.M.; Marais, A.; Gallet, S.; Gamiette, F.; Pavis, C.; Teycheney, P.Y. Molecular viral diagnosis and sanitation of yam genetic resources: Implications for safe yam germplasm exchange. Viruses 2020, 12, 1101. [Google Scholar] [CrossRef]
- Fukuta, S.; Iida, T.; Mizukami, Y.; Ishida, A.; Ueda, J.; Kanbe, M.; Ishimoto, Y. Detection of Japanese Yam mosaic virus by RT-LAMP. Arch. Virol. 2003, 148, 1713–1720. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Aleman, M.E.; Marcos, J.F.; Brugidou, C.; Beachy, R.N.; Fauquet, C. The complete nucleotide sequence of Yam mosaic virus (Ivory Coast isolate) genomic RNA. Arch. Virol. 1996, 141, 1259–1278. [Google Scholar] [CrossRef]
- Adams, M.J.; Antoniw, J.F.; Fauquet, C.M. Molecular criteria for genus and species discrimination within the family Potyviridae. Arch. Virol. 2005, 150, 459–479. [Google Scholar] [CrossRef] [PubMed]
- Inoue-Nagata, A.K.; Jordan, R.; Kreuze, J.; Li, F.; Mäkinen, K.; Wylie, S.J. ICTV Virus Taxonomy Profile: Potyviridae 2022. J. Gen. Virol. 2022, 103, 001738. [Google Scholar] [CrossRef]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef]
- Bru, D.; Martin-Laurent, F.; Philippot, L. Quantification of the detrimental effect of a single primer-template mismatch by real-time PCR using the 16S rRNA gene as an example. Appl. Environ. Microbiol. 2008, 74, 1660–1663. [Google Scholar] [CrossRef] [PubMed]
- Stadhouders, R.; Pas, S.D.; Anber, J.; Voermans, J.; Mes, T.H.M.; Schutten, M. The effect of primer-template mismatches on the detection and quantification of nucleic acids using the 5′ nuclease assay. J. Mol. Diagn. 2010, 12, 109. [Google Scholar] [CrossRef]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Boudreau, D.K.; Bergeron, M.G. Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology. Mol. Cell. Probes 2015, 29, 116–121. [Google Scholar] [CrossRef]
- Higgins, M.; Stringer, O.W.; Ward, D.; Andrews, J.M.; Forrest, M.S.; Campino, S.; Clark, T.G. Characterizing the impact of primer-template mismatches on recombinase polymerase amplification. J. Mol. Diagn. 2022, 24, 1207–1216. [Google Scholar] [CrossRef]
- Van Stelten, A.; Kreman, T.M.; Hall, N.; DesJardin, L.E. Optimization of a real-time RT-PCR assay reveals an increase of genogroup I norovirus in the clinical setting. J. Virol. Methods 2011, 175, 80–84. [Google Scholar] [CrossRef]
- Wang, M.; Li, F.; Zhou, G.; Lan, P.; Xu, D.; Li, R. Molecular detection and characterization of Chinese yam mild mosaic virus isolates. J. Phytopathol. 2015, 163, 1036–1040. [Google Scholar] [CrossRef]
- Mugerwa, H.; Seal, S.; Wang, H.L.; Patel, M.V.; Kabaalu, R.; Omongo, C.A.; Alicai, T.; Tairo, F.; Ndunguru, J.; Sseruwagi, P.; et al. African ancestry of New World, Bemisia tabaci-whitefly species. Sci. Rep. 2018, 8, 2734. [Google Scholar] [CrossRef]
- Wang, D. Effect of internal primer–template mismatches on loop-mediated isothermal amplification. Biotechnol. Biotechnol. Equip. 2016, 30, 314–318. [Google Scholar] [CrossRef]
- Zhou, Y.; Wan, Z.; Yang, S.; Li, Y.; Li, M.; Wang, B.; Hu, Y.; Xia, X.; Jin, X.; Yu, N.; et al. A mismatch-tolerant reverse transcription loop-mediated isothermal amplification method and its application on simultaneous detection of all four serotype of dengue viruses. Front. Microbiol. 2019, 10, 1056. [Google Scholar] [CrossRef] [PubMed]
- Tiberini, A.; Tomlinson, J.; Micali, G.; Fontana, A.; Albanese, G.; Tomassoli, L. Development of a reverse transcription-loop- mediated isothermal amplification (LAMP) assay for the rapid detection of onion yellow dwarf virus. J. Virol. Methods 2019, 271, 113680–113687. [Google Scholar] [CrossRef] [PubMed]
- Ammour, M.S.; Castaldo, E.; Fedele, G.; Rossi, V. Use of LAMP for Assessing Botrytis cinerea Colonization of Bunch Trash and Latent Infection of Berries in Grapevines. Plants 2020, 9, 1538. [Google Scholar] [CrossRef]
- Tembo, M.; Adediji, A.O.; Bouvaine, S.; Chikoti, P.C.; Seal, S.E.; Silva, G. A quick and sensitive diagnostic tool for detection of Maize streak virus. Sci. Rep. 2020, 10, 19633. [Google Scholar] [CrossRef]
- Kokane, A.D.; Kokane, S.B.; Warghane, A.J.; Gubyad, M.G.; Sharma, A.K.; Reddy, M.K.; Ghosh, D.K. A rapid and sensitive reverse transcription–loop-mediated isothermal amplification (RT-LAMP) assay for the detection of indian citrus ringspot virus. Plant Dis. 2021, 105, 1346–1355. [Google Scholar] [CrossRef]
- Eni, A.O.; Asiedu, R.; Hughes, J.D.A.; Asiedu, R.; Rey, M.E.C. Re-evaluation of Yam mosaic virus (YMV) detection methods. Acad. J. Plant Sci. 2012, 5, 18–22. [Google Scholar]
- Zheng, L.; Wayper, P.J.; Gibbs, A.J.; Fourment, M.; Rodoni, B.C.; Gibbs, M.J. Accumulating variation at conserved sites in potyvirus genomes is driven by species discovery and affects degenerate primer design. PLoS ONE 2008, 3, 1586. [Google Scholar] [CrossRef] [PubMed]






| Sample ID | Collection Origin | Dioscorea spp. |
|---|---|---|
| Ben1 | Benin | D. rotundata |
| Cam1 | Cameroon | D. rotundata |
| Cam2 | Cameroon | D. rotundata |
| Cam3 | Cameroon | D. rotundata |
| Cam4 | Cameroon | D. rotundata |
| Gh1 | Ghana | D. rotundata |
| Gh2 | Ghana | D. rotundata |
| Gh3 | Ghana | D. rotundata |
| Gh4 | Ghana | D. rotundata |
| Gh5 | Ghana | D. rotundata |
| Gh6 | Ghana | D. rotundata |
| Gh7 | Ghana | D. rotundata |
| Gh8 | Ghana | D. rotundata |
| Gh9 | Ghana | D. rotundata |
| Gh10 | Ghana | D. rotundata |
| Gh11 | Ghana | D. rotundata |
| Gh12 | Ghana | D. rotundata |
| Gh13 | Ghana | D. rotundata |
| Gh14 | Ghana | D. rotundata |
| Gh15 | Ghana | D. rotundata |
| Gh16 | Ghana | D. rotundata |
| Gh17 | Ghana | D. rotundata |
| Gh18 | Ghana | D. alata |
| Gh19 | Ghana | D. rotundata |
| Gh20 | Ghana | D. rotundata |
| Gh21 | Ghana | D. alata |
| Gh22 | Ghana | D. alata |
| Gh23 | Ghana | D. rotundata |
| Gh24 | Ghana | D. rotundata |
| Gh25 | Ghana | D. rotundata |
| Gh26 | Ghana | D. rotundata |
| Gh27 | Ghana | D. rotundata |
| Gh28 | Ghana | D. rotundata |
| Gh29 | Ghana | D. rotundata |
| Gh30 | Ghana | D. rotundata |
| Gh31 | Ghana | D. rotundata |
| Gh32 | Ghana | D. rotundata |
| Gh33 | Ghana | D. rotundata |
| Gh34 | Ghana | D. rotundata |
| Gh35 | Ghana | D. rotundata |
| Gh36 | Ghana | D. rotundata |
| Gh37 | Ghana | D. rotundata |
| Nig1 | Nigeria | D. rotundata |
| Nig2 | Nigeria | D. rotundata |
| Nig3 | Nigeria | D. rotundata |
| Nig4 | Nigeria | D. rotundata |
| Nig5 | Nigeria | D. rotundata |
| Nig6 | Nigeria | D. rotundata |
| Nig7 | Nigeria | D. rotundata |
| Nig8 | Nigeria | D. rotundata |
| Nig9 | Nigeria | D. rotundata |
| Nig10 | Nigeria | D. rotundata |
| Nig11 | Nigeria | D. rotundata |
| Nig12 | Nigeria | D. rotundata |
| Nig13 | Nigeria | D. rotundata |
| Nig14 | Nigeria | D. rotundata |
| Nig15 | Nigeria | D. rotundata |
| Tog1 | Togo | D. rotundata |
| Tog2 | Togo | D. rotundata |
| Test | Primer Name | Position * | Sequence (5’–3’) | Orientation # | Reference |
|---|---|---|---|---|---|
| RT-LAMP | YMV1-OPT-F3 | 9120–9138 | ATGATGCATTTCAGTGACG | F | This study |
| YMV1-OPT-B3 | 9307–9305 | TTGTTTCCAATAGCTGCTG | R | ||
| YMV1-OPT-FIP (F1C + F2) | F1C: 9199–9219 | ARTCCCTCAARTTGCGCTGAA- | R | ||
| F2: 9144–9163 | GAAGCGTACATTGAATTGCG | F | |||
| YMV1-OPT-BIP (B1C + B2) | B1C: 9240–9259 | TTYGAYTTCTTAGARATAAC- | F | ||
| B2: 9287–9304 | TTCATCTGATGGTGGGCY | R | |||
| YMV1-OPT-LF | 9164–9187 | GGCATATACGGTTCTTTTGAGTTC | R | ||
| YMV1-OPT-LB | 9269–9286 | TCCAGTTCGAGCGCGTGA | F | ||
| RT-LAMP | F3 | 9038–9055 | GACAATGATGGACGGTGC | F | [23] |
| B3 | 9228–9248 | GAAGTCAAACGCATATCTAGC | R | ||
| FIP (F1C + F2) | F1C: 9109–9134 | ACTGAAATGCATCATTATCTGAC GAA- | R | ||
| F2: 9059–9076 | GCAAGTGGAATACCCATT | F | |||
| BIP (B1C + B2) | B1C: 9144–9171 | GAAGCATACATTGAATTGCGGAA CTCAA- | F | ||
| B2: 9206–9244 | TGAGTAATCCCTCAAGTTG | R | |||
| LF | 9079–9103 | GGTTTGGCATTTTCTATGATCGGTT | R | ||
| LB | 9186–9205 | CCCCGATACGGTATTCAGCG | F | ||
| RT-PCR | YMV-CP 1F | 9026–9045 | ATCCGGGATGTGGACAATGA | F | [26] |
| YMV-UTR 1R | 9590–9608 | TGGTCCTCCGCCACATCAAA | R |
| Group* | Isolate | Sample Origin | Dioscorea spp. | Accession Number | Reference |
|---|---|---|---|---|---|
| I | BFC 56 | Burkina Faso | D. cayenensis-rotundata | AJ244052 | [24] |
| C1/C3 | Burkina Faso | D. cayenensis-rotundata | AJ244053 | [24] | |
| BFC 51/C11 | Burkina Faso | D. cayenensis-rotundata | AJ244050 | [24] | |
| BFC 54 | Burkina Faso | D. cayenensis-rotundata | AJ244051 | [24] | |
| II | CKA1/C11 | Ivory Coast | D. cayenensis-rotundata | AJ244059 | [24] |
| CID3/C12 | Ivory Coast | D. cayenensis-rotundata | AJ244058 | [24] | |
| POGNON/C1 | Guadeloupe island | D. cayenensis-rotundata | AJ244064 | [24] | |
| U42596 | Ivory Coast | D. cayenensis-rotundata | NC004752 | [31] | |
| III | CAM1/C1 | Benin | D. cayenensis-rotundata | AJ244054 | [24] |
| B1/c1 | Benin | D. cayenensis-rotundata | AJ244048 | [24] | |
| CBE6b/C3 | Benin | D. cayenensis-rotundata | AJ244056 | [24] | |
| B14 | Cameroon | D. cayenensis-rotundata | AJ244049 | [24] | |
| Ben1 | Benin | D. rotundata | OR004217 | This study | |
| Cam4 | Benin | D. rotundata | OR004218 | This study | |
| Gh2 | Ghana | D. rotundata | OQ677012 | This study | |
| Gh3 | Ghana | D. rotundata | OQ677013 | This study | |
| Gh15 | Ghana | D. rotundata | OQ677004 | This study | |
| Gh17 | Ghana | D. rotundata | OQ677006 | This study | |
| Gh18 | Ghana | D. alata | OQ677007 | This study | |
| Gh19 | Ghana | D. rotundata | OQ677008 | This study | |
| Gh20 | Ghana | D. rotundata | OQ677009 | This study | |
| Gh23 | Ghana | D. rotundata | OQ677011 | This study | |
| Gh27 | Ghana | D. rotundata | OR004219 | This study | |
| Gh29 | Ghana | D. rotundata | OR004229 | This study | |
| Gh30 | Ghana | D. rotundata | OR004220 | This study | |
| Gh32 | Ghana | D. rotundata | OR004223 | This study | |
| Gh33 | Ghana | D. rotundata | OR004225 | This study | |
| Gh35 | Ghana | D. rotundata | OR004222 | This study | |
| Gh36 | Ghana | D. rotundata | OR004224 | This study | |
| Nig3 | Nigeria | D. rotundata | OR004228 | This study | |
| Nig4 | Nigeria | D. rotundata | OR004221 | This study | |
| Nig6 | Nigeria | D. rotundata | OR004226 | This study | |
| Tog2 | Togo | D. rotundata | OR004227 | This study | |
| IV | SOA Ai/C1 | Burkina Faso | D. alata | AJ244065 | [24] |
| SOA2/C2 | Burkina Faso | D. alata | AJ244066 | [24] | |
| CAM2/C31 | Cameroon | D. cayenensis-rotundata | AJ244055 | [24] | |
| 174/C1 | Benin | D. cayenensis-rotundata | AJ244046 | [24] | |
| V | G5/C10 | French Guiana | D. trifida | AJ244062 | [24] |
| G13/C1 | French Guiana | D. trifida | AJ244061 | [24] | |
| GY/INRA/C11 | French Guiana | D. trifida | AJ244045 | [24] | |
| VI | CGU1/C18 | Guadeloupe island | D. cayenensis-rotundata | AJ244057 | [24] |
| GR/SAVANE/C4 | Guadeloupe island | D. cayenensis-rotundata | AJ244063 | [24] | |
| VI | CGU2/C4 | Guadeloupe island | D. cayenensis-rotundata | AJ244044 | [24] |
| AID 10/5 | Puerto Rico | D. alata | AJ244043 | [24] | |
| VII | 608 | Nigeria | D. cayenensis-rotundata | AJ244047 | [24] |
| VIII | DIVIN | Guadeloupe Island | D. cayenensis-rotundata | AJ244060 | [24] |
| IX | CAM2 | Cameroon | D. cayenensis-rotundata | AJ244042 | [24] |
| X | YMV_DR2 | Brazil | D. cayenensis-rotundata | OK239701 | [9] |
| YMV_DR1 | Brazil | D. cayenensis-rotundata | OK239701 | [9] | |
| YMV_I4 | Brazil | D. cayenensis-rotundata | OL739290 | [9] | |
| XI | Nig2 | Nigeria | D. rotundata | OR004232 | This study |
| XII | Tog1 | Togo | D. rotundata | OR004230 | This study |
| XIII | Cam3 | Cameroon | D. rotundata | OR004231 | This study |
| XIV | Gh21 | Ghana | D. alata | OQ677010 | This study |
| Cam2 | Cameroon | D. rotundata | OR004209 | This study | |
| Gh5 | Ghana | D. rotundata | OQ677014 | This study | |
| Gh28 | Ghana | D. rotundata | OR004210 | This study | |
| Gh34 | Ghana | D. rotundata | OR004211 | This study | |
| Nig1 | Nigeria | D. rotundata | OQ677015 | This study | |
| Nig5 | Nigeria | D. rotundata | OR004213 | This study | |
| Nig10 | Nigeria | D. rotundata | OR004212 | This study | |
| Nig11 | Nigeria | D. rotundata | OR004215 | This study | |
| Nig12 | Nigeria | D. rotundata | OR004216 | This study | |
| Nig13 | Nigeria | D. rotundata | OR004214 | This study | |
| Nig14 | Nigeria | D. rotundata | OQ677016 | This study | |
| YMV-NG | Nigeria | D. rotundata | MG711313 | [9] |
| Sample ID | RT-PCR | RT-LAMP | |
|---|---|---|---|
| YMMV | YMV | YMV | |
| DA Nig1 | + | + | + |
| DA Nig2 | + | − | − |
| DA Nig3 | − | − | − |
| DA Tog2 | + | − | − |
| DA Tog3 | + | − | − |
| VU709 | + | − | − |
| VU711 | + | − | − |
| VU715 | − | − | − |
| VU717 | + | − | − |
| VU724 | + | − | − |
| VU740 | − | − | − |
| VU746 | + | − | − |
| CTRT127 | − | + | + |
| CTRT268 | + | − | − |
| YMV-positive control | − | + | + |
| Non-template control | − | − | − |
| S/N | Sample ID | Dioscorea spp. | RT-PCR | Improved RT-LAMP | |
|---|---|---|---|---|---|
| YMV Status | Time (min:sec) | ||||
| 1 | Gh6 | D. rotundata | − | − | − |
| 2 | Gh7 | D. rotundata | − | − | − |
| 3 | Gh8 | D. rotundata | − | − | − |
| 4 | Gh9 | D. rotundata | − | − | − |
| 5 | Gh10 | D. rotundata | − | − | − |
| 6 | Gh11 | D. rotundata | − | − | − |
| 7 | Gh12 | D. rotundata | − | − | − |
| 8 | Gh13 | D. rotundata | − | − | − |
| 9 | Gh14 | D. rotundata | − | − | − |
| 10 | Gh15 | D. rotundata | + | + | 13:56 |
| 11 | Gh16 | D. rotundata | + | + | 11:05 |
| 12 | Gh17 | D. rotundata | + | + | 09:53 |
| 13 | Gh18 | D. alata | + | + | 18:16 |
| 14 | Gh19 | D. rotundata | + | + | 11:57 |
| 15 | Gh20 | D. rotundata | + | + | 10:41 |
| 16 | Gh21 | D. alata | + | + | 14:14 |
| 17 | Gh22 | D. alata | + | + | 11:35 |
| 18 | Gh23 | D. rotundata | + | + | 25:02 |
| 19 | Gh24 | D. rotundata | − | − | − |
| 20 | Gh25 | D. rotundata | − | − | − |
| 21 | Gh26 | D. rotundata | − | − | − |
| 22 | Gh27 | D. rotundata | + | + | 08:30 |
| 23 | Gh28 | D. rotundata | + | + | 10:00 |
| 24 | Gh29 | D. rotundata | + | + | 11:15 |
| 25 | Gh30 | D. rotundata | + | + | 09:15 |
| 26 | Gh31 | D. rotundata | + | + | 20:00 |
| 27 | Gh32 | D. rotundata | + | + | 08:30 |
| 28 | Gh33 | D. rotundata | + | + | 09:00 |
| 29 | Gh34 | D. rotundata | + | + | 10:15 |
| 30 | Gh35 | D. rotundata | + | + | 09:30 |
| 31 | Gh36 | D. rotundata | + | + | 10:00 |
| 32 | Gh37 | D. rotundata | − | − | − |
| 33 | Nig2 | D. rotundata | + | + | 08:15 |
| 34 | Nig3 | D. rotundata | + | + | 10:00 |
| 35 | Nig4 | D. rotundata | + | + | 25:45 |
| 36 | Nig5 | D. rotundata | + | + | 08:00 |
| 37 | Nig6 | D. rotundata | + | + | 10:45 |
| 38 | Nig7 | D. rotundata | − | − | − |
| 39 | Nig8 | D. rotundata | − | − | − |
| 40 | Nig9 | D. rotundata | − | − | − |
| 41 | Nig10 | D. rotundata | + | + | 10:00 |
| 42 | Nig11 | D. rotundata | + | + | 13:00 |
| 43 | Nig12 | D. rotundata | + | + | 09:45 |
| 44 | Nig13 | D. rotundata | + | + | 09:30 |
| 45 | Nig14 | D. rotundata | + | + | 10:05 |
| 46 | Nig15 | D. rotundata | − | − | − |
| 47 | Ben1 | D. rotundata | + | + | 08:00 |
| 48 | Tog1 | D. rotundata | + | + | 07:15 |
| 49 | Tog2 | D. rotundata | + | + | 10:45 |
| 50 | Cam1 | D. rotundata | + | + | 08:00 |
| 51 | Cam2 | D. rotundata | + | + | 07:30 |
| 52 | Cam3 | D. rotundata | + | + | 12:30 |
| 53 | Cam4 | D. rotundata | + | + | 09:45 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Festus, R.O.; Seal, S.E.; Prempeh, R.; Quain, M.D.; Silva, G. Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus. Viruses 2023, 15, 1592. https://doi.org/10.3390/v15071592
Festus RO, Seal SE, Prempeh R, Quain MD, Silva G. Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus. Viruses. 2023; 15(7):1592. https://doi.org/10.3390/v15071592
Chicago/Turabian StyleFestus, Ruth O., Susan E. Seal, Ruth Prempeh, Marian D. Quain, and Gonçalo Silva. 2023. "Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus" Viruses 15, no. 7: 1592. https://doi.org/10.3390/v15071592
APA StyleFestus, R. O., Seal, S. E., Prempeh, R., Quain, M. D., & Silva, G. (2023). Improved Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) for the Rapid and Sensitive Detection of Yam mosaic virus. Viruses, 15(7), 1592. https://doi.org/10.3390/v15071592

