Porcine Epidemic Diarrhea Virus Replication in Human Intestinal Cells Reveals Potential Susceptibility to Cross-Species Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells, Viruses, and Reagents
2.2. Reverse Transcription PCR
2.3. Extraction of Cellular Proteins
2.4. Western Blotting
2.5. IFA Analyses
2.6. PEDV S Gene Homology and Evolutionary Analysis
2.7. Absolute Quantitative PCR
2.8. Electron Microscope
2.9. Median Tissue Culture Infectious Dose (TCID50) Assay of the Virus Titer
2.10. Statistical Analysis
3. Results
3.1. PEDV LJX Can Infect FHs 74 Int Cells, but PEDV CV777 Cannot
3.2. Characterization of the S Gene of PEDV LJX after Inoculation in FHs 74 Int Cells
3.3. PEDV Particle Could Be Detected in FHs 74 Int Cells
3.4. Proliferative Rule of PEDV in IPEC-J2 and FHs 74 Int Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lamers, M.M.; Beumer, J.; van der Vaart, J.; Knoops, K.; Puschhof, J.; Breugem, T.I.; Ravelli, R.B.G.; Paul van Schayck, J.; Mykytyn, A.Z.; Duimel, H.Q.; et al. SARS-CoV-2 Productively Infects Human Gut Enterocytes. Science 2020, 369, 50–54. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Li, W.; Feng, J.; Ramos da Silva, S.; Ju, E.; Zhang, H.; Chang, Y.; Moore, P.S.; Guo, H.; Gao, S.-J. SARS-CoV-2 Pseudovirus Infectivity and Expression of Viral Entry-Related Factors ACE2, TMPRSS2, Kim-1, and NRP-1 in Human Cells from the Respiratory, Urinary, Digestive, Reproductive, and Immune Systems. J. Med. Virol. 2021, 93, 6671–6685. [Google Scholar] [CrossRef]
- Hui, D.S.C.; Zumla, A. Severe Acute Respiratory Syndrome: Historical, Epidemiologic, and Clinical Features. Infect. Dis. Clin. N. Am. 2019, 33, 869–889. [Google Scholar] [CrossRef] [PubMed]
- Zumla, A.; Hui, D.S.; Perlman, S. Middle East Respiratory Syndrome. Lancet 2015, 386, 995–1007. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Liu, S. The Management of Coronavirus Disease 2019 (COVID-19). J. Med. Virol. 2020, 92, 1484–1490. [Google Scholar] [CrossRef]
- Wu, L.; Chen, Q.; Liu, K.; Wang, J.; Han, P.; Zhang, Y.; Hu, Y.; Meng, Y.; Pan, X.; Qiao, C.; et al. Broad Host Range of SARS-CoV-2 and the Molecular Basis for SARS-CoV-2 Binding to Cat ACE2. Cell Discov. 2020, 6, 68. [Google Scholar] [CrossRef]
- Holmes, E.C.; Goldstein, S.A.; Rasmussen, A.L.; Robertson, D.L.; Crits-Christoph, A.; Wertheim, J.O.; Anthony, S.J.; Barclay, W.S.; Boni, M.F.; Doherty, P.C.; et al. The Origins of SARS-CoV-2: A Critical Review. Cell 2021, 184, 4848–4856. [Google Scholar] [CrossRef]
- Turlewicz-Podbielska, H.; Pomorska-Mól, M. Porcine Coronaviruses: Overview of the State of the Art. Virol. Sin. 2021, 36, 833–851. [Google Scholar] [CrossRef]
- Chasey, D.; Cartwright, S.F. Virus-like Particles Associated with Porcine Epidemic Diarrhoea. Res. Vet. Sci. 1978, 25, 255–256. [Google Scholar] [CrossRef]
- Wang, D.; Fang, L.; Xiao, S. Porcine Epidemic Diarrhea in China. Virus Res. 2016, 226, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Bevins, S.N.; Lutman, M.; Pedersen, K.; Barrett, N.; Gidlewski, T.; Deliberto, T.J.; Franklin, A.B. Spillover of Swine Coronaviruses, United States. Emerg. Infect. Dis. 2018, 24, 1390–1392. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.; Miyazaki, A.; Saif, L.J. Immunohistochemical Detection of the Vomiting-Inducing Monoamine Neurotransmitter Serotonin and Enterochromaffin Cells in the Intestines of Conventional or Gnotobiotic (Gn) Pigs Infected with Porcine Epidemic Diarrhea Virus (PEDV) and Serum Cytokine Responses of Gn Pigs to Acute PEDV Infection. Res. Vet. Sci. 2018, 119, 99–108. [Google Scholar] [CrossRef] [PubMed]
- Gallien, S.; Moro, A.; Lediguerher, G.; Catinot, V.; Paboeuf, F.; Bigault, L.; Berri, M.; Gauger, P.C.; Pozzi, N.; Authié, E.; et al. Evidence of Porcine Epidemic Diarrhea Virus (PEDV) Shedding in Semen from Infected Specific Pathogen-Free Boars. Vet. Res. 2018, 49, 7. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wu, Q.; Huang, L.; Yuan, C.; Wang, J.; Yang, Q. An Alternative Pathway of Enteric PEDV Dissemination from Nasal Cavity to Intestinal Mucosa in Swine. Nat. Commun. 2018, 9, 3811. [Google Scholar] [CrossRef] [PubMed]
- Sueyoshi, M.; Tsuda, T.; Yamazaki, K.; Yoshida, K.; Nakazawa, M.; Sato, K.; Minami, T.; Iwashita, K.; Watanabe, M.; Suzuki, Y. An Immunohistochemical Investigation of Porcine Epidemic Diarrhoea. J. Comp. Pathol. 1995, 113, 59–67. [Google Scholar] [CrossRef]
- Suda, Y.; Miyazaki, A.; Miyazawa, K.; Shibahara, T.; Ohashi, S. Systemic and Intestinal Porcine Epidemic Diarrhea Virus-Specific Antibody Response and Distribution of Antibody-Secreting Cells in Experimentally Infected Conventional Pigs. Vet. Res. 2021, 52, 2. [Google Scholar] [CrossRef]
- Utiger, A.; Frei, A.; Carvajal, A.; Ackermann, M. Studies on the in Vitro and in Vivo Host Range of Porcine Epidemic Diarrhoea Virus. Adv. Exp. Med. Biol. 1995, 380, 131–133. [Google Scholar] [CrossRef]
- Reed, L.; Muench, H. A Simple Method of Estimating 50 Percent End Point. Am. J. Hyg. 1938, 27, 493–497. [Google Scholar]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Zhang, H.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.-H. EvolView, an Online Tool for Visualizing, Annotating and Managing Phylogenetic Trees. Nucleic Acids Res. 2012, 40, W569–W572. [Google Scholar] [CrossRef]
- Lu, G.; Wang, Q.; Gao, G.F. Bat-to-Human: Spike Features Determining “host Jump” of Coronaviruses SARS-CoV, MERS-CoV, and Beyond. Trends Microbiol. 2015, 23, 468–478. [Google Scholar] [CrossRef]
- Zhou, P.; Yang, X.-L.; Wang, X.-G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.-R.; Zhu, Y.; Li, B.; Huang, C.-L.; et al. A Pneumonia Outbreak Associated with a New Coronavirus of Probable Bat Origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef]
- Menachery, V.D.; Yount, B.L.; Debbink, K.; Agnihothram, S.; Gralinski, L.E.; Plante, J.A.; Graham, R.L.; Scobey, T.; Ge, X.-Y.; Donaldson, E.F.; et al. A SARS-like Cluster of Circulating Bat Coronaviruses Shows Potential for Human Emergence. Nat. Med. 2015, 21, 1508–1513. [Google Scholar] [CrossRef]
- Yang, Y.-L.; Qin, P.; Wang, B.; Liu, Y.; Xu, G.-H.; Peng, L.; Zhou, J.; Zhu, S.J.; Huang, Y.-W. Broad Cross-Species Infection of Cultured Cells by Bat HKU2-Related Swine Acute Diarrhea Syndrome Coronavirus and Identification of Its Replication in Murine Dendritic Cells In Vivo Highlight Its Potential for Diverse Interspecies Transmission. J. Virol. 2019, 93, e01448-19. [Google Scholar] [CrossRef]
- Tse, L.V.; Meganck, R.M.; Araba, K.C.; Yount, B.L.; Shaffer, K.M.; Hou, Y.J.; Munt, J.E.; Adams, L.E.; Wykoff, J.A.; Morowitz, J.M.; et al. Genomewide CRISPR Knockout Screen Identified PLAC8 as an Essential Factor for SADS-CoVs Infection. Proc. Natl. Acad. Sci. USA 2022, 119, e2118126119. [Google Scholar] [CrossRef]
- Li, W.; Hulswit, R.J.G.; Kenney, S.P.; Widjaja, I.; Jung, K.; Alhamo, M.A.; van Dieren, B.; van Kuppeveld, F.J.M.; Saif, L.J.; Bosch, B.-J. Broad Receptor Engagement of an Emerging Global Coronavirus May Potentiate Its Diverse Cross-Species Transmissibility. Proc. Natl. Acad. Sci. USA 2018, 115, E5135–E5143. [Google Scholar] [CrossRef]
- Liu, C.; Tang, J.; Ma, Y.; Liang, X.; Yang, Y.; Peng, G.; Qi, Q.; Jiang, S.; Li, J.; Du, L.; et al. Receptor Usage and Cell Entry of Porcine Epidemic Diarrhea Coronavirus. J. Virol. 2015, 89, 6121–6125. [Google Scholar] [CrossRef]
- Yang, L.; Xu, J.; Guo, L.; Guo, T.; Zhang, L.; Feng, L.; Chen, H.; Wang, Y. Porcine Epidemic Diarrhea Virus-Induced Epidermal Growth Factor Receptor Activation Impairs the Antiviral Activity of Type I Interferon. J. Virol. 2018, 92, e02095-17. [Google Scholar] [CrossRef]
- Chan, K.-H.; Chan, J.F.-W.; Tse, H.; Chen, H.; Lau, C.C.-Y.; Cai, J.-P.; Tsang, A.K.-L.; Xiao, X.; To, K.K.-W.; Lau, S.K.-P.; et al. Cross-Reactive Antibodies in Convalescent SARS Patients’ Sera against the Emerging Novel Human Coronavirus EMC (2012) by Both Immunofluorescent and Neutralizing Antibody Tests. J. Infect. 2013, 67, 130–140. [Google Scholar] [CrossRef]
- Sun, Z.F.; Meng, X.J. Antigenic Cross-Reactivity between the Nucleocapsid Protein of Severe Acute Respiratory Syndrome (SARS) Coronavirus and Polyclonal Antisera of Antigenic Group I Animal Coronaviruses: Implication for SARS Diagnosis. J. Clin. Microbiol. 2004, 42, 2351–2352. [Google Scholar] [CrossRef]
- Shao, X.; Guo, X.; Esper, F.; Weibel, C.; Kahn, J.S. Seroepidemiology of Group I Human Coronaviruses in Children. J. Clin. Virol. 2007, 40, 207–213. [Google Scholar] [CrossRef] [PubMed]
- Fouchier, R.A.M.; Hartwig, N.G.; Bestebroer, T.M.; Niemeyer, B.; de Jong, J.C.; Simon, J.H.; Osterhaus, A.D.M.E. A Previously Undescribed Coronavirus Associated with Respiratory Disease in Humans. Proc. Natl. Acad. Sci. USA 2004, 101, 6212–6216. [Google Scholar] [CrossRef]
Gene | Sequence (5′–3′) | bp |
---|---|---|
PEDV M | F: GTCTAACGGTTCTATTCCC | 462 |
R: TTATAGCCCTCTACAAGC |
Gene | Sequence (5′–3′) |
---|---|
PEDV S1 | F: TGCTAGTGCGTAATAATGACACC |
PEDV S3 | R: GTTGGCAGACTTTGAGACA |
Gene | Sequence (5′–3′) | bp |
---|---|---|
PEDV M | F: AGGTTGCTACTGGCGTACAG | 157 |
R: GAGTAGTCGCCGTGTTTGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niu, Z.; Zhang, S.; Xu, S.; Wang, J.; Wang, S.; Hu, X.; Zhang, L.; Ren, L.; Zhang, J.; Liu, X.; et al. Porcine Epidemic Diarrhea Virus Replication in Human Intestinal Cells Reveals Potential Susceptibility to Cross-Species Infection. Viruses 2023, 15, 956. https://doi.org/10.3390/v15040956
Niu Z, Zhang S, Xu S, Wang J, Wang S, Hu X, Zhang L, Ren L, Zhang J, Liu X, et al. Porcine Epidemic Diarrhea Virus Replication in Human Intestinal Cells Reveals Potential Susceptibility to Cross-Species Infection. Viruses. 2023; 15(4):956. https://doi.org/10.3390/v15040956
Chicago/Turabian StyleNiu, Zheng, Shujuan Zhang, Shasha Xu, Jing Wang, Siying Wang, Xia Hu, Li Zhang, Lixin Ren, Jingyi Zhang, Xiangyang Liu, and et al. 2023. "Porcine Epidemic Diarrhea Virus Replication in Human Intestinal Cells Reveals Potential Susceptibility to Cross-Species Infection" Viruses 15, no. 4: 956. https://doi.org/10.3390/v15040956
APA StyleNiu, Z., Zhang, S., Xu, S., Wang, J., Wang, S., Hu, X., Zhang, L., Ren, L., Zhang, J., Liu, X., Zhou, Y., Yang, L., & Song, Z. (2023). Porcine Epidemic Diarrhea Virus Replication in Human Intestinal Cells Reveals Potential Susceptibility to Cross-Species Infection. Viruses, 15(4), 956. https://doi.org/10.3390/v15040956