The Synergy of Chicken Anemia Virus and Gyrovirus Homsa 1 in Chickens
Abstract
:1. Introduction
2. Material and Method
2.1. Virus and Animals
2.2. Experimental Infection and Sampling
2.3. ELISA
2.4. Quantitative Real-Time PCR (qPCR)
2.5. Statistical Analysis
3. Results
3.1. Clinical Manifestations
3.2. Viremia and Viral Shedding
3.3. Erythrocyte Examination in the Blood
3.4. Dynamic Changes in the Immune Organ Index
3.5. Viral Loads in Various Tissues at Different Time Points
3.6. Histopathological Results
4. Discussions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Todd, D. Circoviruses: Immunosuppressive threats to avian species: A review. Avian Pathol. 2000, 29, 373–394. [Google Scholar] [CrossRef] [PubMed]
- Rosario, K.; Breitbart, M.; Harrach, B.; Segalés, J.; Delwart, E.; Biagini, P.; Varsani, A. Revisiting the taxonomy of the family Circoviridae: Establishment of the genus Cyclovirus and removal of the genus Gyrovirus. Arch. Virol. 2017, 162, 1447–1463. [Google Scholar] [CrossRef]
- Chu, D.K.; Poon, L.L.; Chiu, S.S.; Chan, K.H.; Ng, E.M.; Bauer, I.; Cheung, T.K.; Ng, I.H.; Guan, Y.; Wang, D.; et al. Characterization of a novel gyrovirus in human stool and chicken meat. J. Clin. Virol. 2012, 55, 209–213. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, T.L.; Clyde, V.L.; Gendron-Fitzpatrick, A.; Sibley, S.D.; Wallace, R. Severe neurologic disease and chick mortality in crested screamers (Chauna torquata) infected with a novel Gyrovirus. Virology 2018, 520, 111–115. [Google Scholar] [CrossRef] [PubMed]
- Loiko, M.R.; Varela, A.P.M.; Tochetto, C.; Lopes, B.C.; Scheffer, C.M.; Morel, A.P.; Vidaletti, M.R.; Lima, D.A.; Cerva, C.; Mayer, F.Q.; et al. Novel Gyrovirus genomes recovered from free-living pigeons in Southern Brazil. Virology 2020, 548, 132–135. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.G.; Li, L.; O’Ryan, M.G.; Cortes, H.; Mamani, N.; Bonkoungou, I.J.O.; Wang, C.; Leutenegger, C.M.; Delwart, E. A third gyrovirus species in human faeces. J. Gen. Virol. 2012, 93 Pt 6, 1356–1361. [Google Scholar] [CrossRef]
- Rijsewijk, F.A.; Dos Santos, H.F.; Teixeira, T.F.; Cibulski, S.P.; Varela, A.P.; Dezen, D.; Franco, A.C.; Roehe, P.M. Discovery of a genome of a distant relative of chicken anemia virus reveals a new member of the genus Gyrovirus. Arch. Virol. 2011, 156, 1097–1100. [Google Scholar] [CrossRef]
- Sauvage, V.; Cheval, J.; Foulongne, V.; Gouilh, M.A.; Pariente, K.; Manuguerra, J.C.; Richardson, J.; Dereure, O.; Lecuit, M.; Burguiere, A.; et al. Identification of the first human gyrovirus, a virus related to chicken anemia virus. J. Virol. 2011, 85, 7948–7950. [Google Scholar] [CrossRef]
- Truchado, D.A.; Diaz-Piqueras, J.M.; Gomez-Lucia, E.; Doménech, A.; Milá, B.; Pérez-Tris, J.; Schmidt-Chanasit, J.; Cadar, D.; Benítez, L. A Novel and Divergent Gyrovirus with Unusual Genomic Features Detected in Wild Passerine Birds from a Remote Rainforest in French Guiana. Viruses 2019, 11, 1148. [Google Scholar] [CrossRef]
- Zhang, W.; Li, L.; Deng, X.; Kapusinszky, B.; Delwart, E. What is for dinner? Viral metagenomics of US store bought beef, pork, and chicken. Virology 2014, 468, 303–310. [Google Scholar] [CrossRef] [Green Version]
- Kraberger, S.; Opriessnig, T.; Celer, V.; Maggi, F.; Okamoto, H.; Blomström, A.L.; Cadar, D.; Harrach, B.; Biagini, P.; Varsani, A. Taxonomic updates for the genus Gyrovirus (family Anelloviridae): Recognition of several new members and establishment of species demarcation criteria. Arch. Virol. 2021, 166, 2937–2942. [Google Scholar] [CrossRef]
- Schat, K.A. Chicken anemia virus. Curr. Top. Microbiol. Immunol. 2009, 331, 151–183. [Google Scholar] [PubMed]
- Yuasa, N.; Taniguchi, T.; Yoshida, I. Isolation and Some Characteristics of an Agent Inducing Anemia in Chicks. Avian Dis. 1979, 23, 366–385. [Google Scholar] [CrossRef]
- van Santen, V.L.; Joiner, K.S.; Murray, C.; Petrenko, N.; Hoerr, F.J.; Toro, H. Pathogenesis of chicken anemia virus: Comparison of the oral and the intramuscular routes of infection. Avian Dis. 2004, 48, 494–504. [Google Scholar] [CrossRef] [PubMed]
- Smuts, H.E. Novel Gyroviruses, including Chicken Anaemia Virus, in Clinical and Chicken Samples from South Africa. Adv. Virol. 2014, 2014, 321284. [Google Scholar] [CrossRef]
- Niu, J.T.; Yi, S.S.; Dong, G.Y.; Guo, Y.B.; Zhao, Y.L.; Huang, H.L.; Wang, K.; Hu, G.X.; Dong, H. Genomic Characterization of Diverse Gyroviruses Identified in the Feces of Domestic Cats. Sci. Rep. 2019, 9, 13303. [Google Scholar] [CrossRef]
- Li, G.; Yuan, S.; He, M.; Zhao, M.; Hao, X.; Song, M.; Zhang, L.; Qiao, C.; Huang, L.; Zhang, L.; et al. Emergence of gyrovirus 3 in commercial broiler chickens with transmissible viral proventriculitis. Transbound Emerg. Dis. 2018, 65, 1170–1174. [Google Scholar] [CrossRef]
- Zhang, S.; Yuan, S.; Yan, T.; Li, G.; Hao, X.; Zhou, D.; Li, R.; Li, Y.; Cheng, Z. Serological investigation of Gyrovirus homsa1 infections in chickens in China. BMC Vet. Res. 2022, 18, 231. [Google Scholar] [CrossRef]
- Kumar, N.; Sharma, S.; Barua, S.; Tripathi, B.N.; Rouse, B.T. Virological and Immunological Outcomes of Coinfections. Clin. Microbiol. Rev. 2018, 31, e00111-17. [Google Scholar] [CrossRef]
- McNeilly, F.; Smyth, J.A.; Adair, B.M.; McNulty, M.S. Synergism between chicken anemia virus (CAV) and avian reovirus following dual infection of 1-day-old chicks by a natural route. Avian Dis. 1995, 39, 532–537. [Google Scholar] [CrossRef]
- Dong, X.; Zhao, P.; Chang, S.; Ju, S.; Li, Y.; Meng, F.; Sun, P.; Cui, Z. Synergistic pathogenic effects of co-infection of subgroup J avian leukosis virus and reticuloendotheliosis virus in broiler chickens. Avian Pathol. 2015, 44, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Chen, S.; Nie, Y.; Li, W.; Li, H.; Zhang, X.; Chen, F.; Xie, Q. Synergistic Immunosuppression of Avian Leukosis Virus Subgroup J and Infectious Bursal Disease Virus Is Responsible for Enhanced Pathogenicity. Viruses 2022, 14, 2312. [Google Scholar] [CrossRef] [PubMed]
- Diao, Z.; Yuan, S.; Hao, X.; Feng, Y.; Zhang, Y.; Cheng, Z. Diagnosis of gonadal gastritis co-infected by Gyrovirus 3 and chicken infectious anemia virus. China Poult. 2019, 41, 78–80. [Google Scholar]
- Tian, X.; Gao, Y.; Yu, K.; Hu, F.; Huang, B.; Song, M.; Li, Y. Laboratory diagnosis of infectious glandular gastritis in a small broiler. Poult. Sci. 2020, 14, 49–52. [Google Scholar]
- Su, Q.; Li, Y.; Meng, F.; Cui, Z.; Chang, S.; Zhao, P. Newcastle disease virus-attenuated vaccine co-contaminated with fowl adenovirus and chicken infectious anemia virus results in inclusion body hepatitis-hydropericardium syndrome in poultry. Vet. Microbiol. 2018, 218, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Zapor, M. Persistent Detection and Infectious Potential of SARS-CoV-2 Virus in Clinical Specimens from COVID-19 Patients. Viruses 2020, 12, 1384. [Google Scholar] [CrossRef] [PubMed]
- Gonzales, J.L.; Koch, G.; Elbers, A.R.W.; van der Goot, J.A. Similar transmissibility of the Italian H7N1 highly pathogenic avian influenza virus and its low pathogenic avian influenza virus predecessor. Vet. J. 2018, 232, 20–22. [Google Scholar] [CrossRef]
- Morinet, F.; Leruez-Ville, M.; Pillet, S.; Fichelson, S. Concise review: Anemia caused by viruses. Stem. Cells 2011, 29, 1656–1660. [Google Scholar] [CrossRef]
- de Melo Silva, J.; Pinheiro-Silva, R.; Dhyani, A.; Pontes, G.S. Cytomegalovirus and Epstein-Barr Infections: Prevalence and Impact on Patients with Hematological Diseases. Biomed Res. Int. 2020, 2020, 1627824. [Google Scholar] [CrossRef]
- Liu, H.; Ma, K.; Liu, M.; Yang, C.; Huang, X.; Zhao, Y.; Qi, K. Histologic findings and viral antigen distribution in natural coinfection of layer hens with subgroup J avian leukosis virus, Marek’s disease virus, and reticuloendotheliosis virus. J. Vet. Diagn Invest. 2019, 31, 761–765. [Google Scholar] [CrossRef]
- Zhou, J.; Zhao, G.L.; Wang, X.M.; Du, X.S.; Su, S.; Li, C.G.; Nair, V.; Yao, Y.X.; Cheng, Z.Q. Synergistic Viral Replication of Marek’s Disease Virus and Avian Leukosis Virus Subgroup J is Responsible for the Enhanced Pathogenicity in the Superinfection of Chickens. Viruses 2018, 10, 271. [Google Scholar] [CrossRef]
- Li, X.; Chen, S.; Zhang, L.; Niu, G.; Zhang, X.; Yang, L.; Ji, W.; Ren, L. Coinfection of Porcine Circovirus 2 and Pseudorabies Virus Enhances Immunosuppression and Inflammation through NF-κB, JAK/STAT, MAPK, and NLRP3 Pathways. Int. J. Mol. Sci. 2022, 23, 4469. [Google Scholar] [CrossRef] [PubMed]
- Sinha, A.; Shen, H.G.; Schalk, S.; Beach, N.M.; Huang, Y.W.; Meng, X.J.; Halbur, P.G.; Opriessnig, T. Porcine reproductive and respiratory syndrome virus (PRRSV) influences infection dynamics of porcine circovirus type 2 (PCV2) subtypes PCV2a and PCV2b by prolonging PCV2 viremia and shedding. Vet. Microbiol. 2011, 152, 235–246. [Google Scholar] [CrossRef] [PubMed]
- Thom, K.; Petrik, J. Progression towards AIDS leads to increased Torque teno virus and Torque teno minivirus titers in tissues of HIV infected individuals. J. Med. Virol. 2007, 79, 1–7. [Google Scholar] [CrossRef] [PubMed]
Primers and Probes | Sequence (5′-3′) | Size (bp) | |
---|---|---|---|
CAV | Forward | GGTGTTCAGGCCACCAACAA | 138 |
Reverse | GCAGATCTTAGCGTGGGAGC | ||
Probe | FAM-TATCGCTGTGTGGCTGCGCGAATGC-BHQ2 | ||
GyH1 | Forward | GTCGGTTGGGACTCTCTCCA | 139 |
Reverse | GGAACCAGTGGCGTCTGAAG | ||
Probe | CY5-TTCCTGGCTTCGCGAGTGTTCGCGT-BHQ2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, M.; Yang, Q.; Bi, X.; Shi, H.; Yang, J.; Cheng, X.; Yan, T.; Zhang, H.; Cheng, Z. The Synergy of Chicken Anemia Virus and Gyrovirus Homsa 1 in Chickens. Viruses 2023, 15, 515. https://doi.org/10.3390/v15020515
Yang M, Yang Q, Bi X, Shi H, Yang J, Cheng X, Yan T, Zhang H, Cheng Z. The Synergy of Chicken Anemia Virus and Gyrovirus Homsa 1 in Chickens. Viruses. 2023; 15(2):515. https://doi.org/10.3390/v15020515
Chicago/Turabian StyleYang, Mengzan, Qi Yang, Xiaoqing Bi, Hengyang Shi, Jianhao Yang, Xiangyu Cheng, Tianxing Yan, Honghai Zhang, and Ziqiang Cheng. 2023. "The Synergy of Chicken Anemia Virus and Gyrovirus Homsa 1 in Chickens" Viruses 15, no. 2: 515. https://doi.org/10.3390/v15020515