Using Multiplex Amplicon PCR Technology to Efficiently and Timely Generate Rift Valley Fever Virus Sequence Data for Genomic Surveillance
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples Dataset
2.2. IgM Antibody Capture ELISA
2.3. Virus Enrichment by Cell Culture
2.4. Nucleic Acid Isolation
2.5. Diagnosis Using RT-qPCR
2.6. Designing Multiplex Amplicon (Tiling) Primers
2.7. cDNA Synthesis
2.7.1. Amplicon Multiplex PCR
2.7.2. Library Preparation Using NEBNext Ultra II DNA Library Prep Kit
2.7.3. Generation of Consensus Sequences
2.8. Maximum Likelihood Estimation and Molecular Clock Phylogenetic Reconstruction
3. Results
3.1. Sequencing and Consensus Genomes
3.2. Performance of Amplicon Primers
3.3. Amplification Accuracy Assessed by SNP Concordance
3.4. Similar Lineage Placement in CCE, amPCRe and Direct Genomes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Adams, M.J.; Lefkowitz, E.J.; King, A.M.Q.; Harrach, B.; Harrison, R.L.; Knowles, N.J.; Kropinski, A.M.; Krupovic, M.; Kuhn, J.H.; Mushegian, A.R.; et al. Changes to Taxonomy and the International Code of Virus Classification and Nomenclature Ratified by the International Committee on Taxonomy of Viruses (2017). Arch. Virol. 2017, 162, 2505–2538. [Google Scholar] [CrossRef]
- Daubney, R.; Hudson, J.R.; Garnham, P.C. Enzootic Hepatitis or Rift Valley Fever. An Undescribed Virus Disease of Sheep Cattle and Man from East Africa. J. Pathol. Bacteriol. 1931, 34, 545–579. [Google Scholar] [CrossRef]
- Nanyingi, M.O.; Munyua, P.; Kiama, S.G.; Muchemi, G.M.; Thumbi, S.M.; Bitek, A.O.; Bett, B.; Muriithi, R.M.; Njenga, M.K. A Systematic Review of Rift Valley Fever Epidemiology 1931–2014. Infect. Ecol. Epidemiol. 2015, 5, 28024. [Google Scholar] [CrossRef]
- Himeidan, Y.E.; Kweka, E.J.; Mahgoub, M.M.; El Rayah, E.A.; Ouma, J.O. Recent Outbreaks of Rift Valley Fever in East Africa and the Middle East. Front. Public Health 2014, 2, 169. [Google Scholar] [CrossRef]
- Paweska, J.T.; Jansen van Vuren, P. Rift Valley Fever Virus. In The Role of Animals in Emerging Viral Diseases; Elsevier: Amsterdam, The Netherlands, 2014; pp. 169–200. ISBN 978-0-12-405191-1. [Google Scholar]
- Hanafi, H.; Warigia, M.; Breiman, R.F.; Godsey, M.; Hoel, D.; Lutomiah, J.; Koka, H.; O’Guinn, M.; Miller, B.; Ochieng, C.; et al. Rift Valley Fever Virus Epidemic in Kenya, 2006/2007: The Entomologic Investigations. Am. J. Trop. Med. Hyg. 2010, 83, 28–37. [Google Scholar] [CrossRef]
- Woods, C.W. An Outbreak of Rift Valley Fever in Northeastern Kenya, 1997–1998. Emerg. Infect. Dis. 2002, 8, 138–144. [Google Scholar] [CrossRef]
- Pepin, M.; Bouloy, M.; Bird, B.H.; Kemp, A.; Paweska, J. Rift Valley Fever Virus (Bunyaviridae: Phlebovirus): An Update on Pathogenesis, Molecular Epidemiology, Vectors, Diagnostics and Prevention. Vet. Res. 2010, 41, 61. [Google Scholar] [CrossRef]
- Ikegami, T.; Makino, S. The Pathogenesis of Rift Valley Fever. Viruses 2011, 3, 493–519. [Google Scholar] [CrossRef]
- WHO. Prioritizing Diseases for Research and Development in Emergency Contexts. Available online: https://www.who.int/activities/prioritizing-diseases-for-research-and-development-in-emergency-contexts (accessed on 28 July 2022).
- Mehand, M.S.; Al-Shorbaji, F.; Millett, P.; Murgue, B. The WHO R&D Blueprint: 2018 Review of Emerging Infectious Diseases Requiring Urgent Research and Development Efforts. Antiviral Res. 2018, 159, 63–67. [Google Scholar] [CrossRef]
- Armstrong, G.L.; MacCannell, D.R.; Taylor, J.; Carleton, H.A.; Neuhaus, E.B.; Bradbury, R.S.; Posey, J.E.; Gwinn, M. Pathogen Genomics in Public Health. N. Engl. J. Med. 2019, 381, 2569–2580. [Google Scholar] [CrossRef]
- Gwinn, M.; MacCannell, D.; Armstrong, G.L. Next-Generation Sequencing of Infectious Pathogens. JAMA 2019, 321, 893. [Google Scholar] [CrossRef]
- Deurenberg, R.H.; Bathoorn, E.; Chlebowicz, M.A.; Couto, N.; Ferdous, M.; García-Cobos, S.; Kooistra-Smid, A.M.D.; Raangs, E.C.; Rosema, S.; Veloo, A.C.M.; et al. Application of next Generation Sequencing in Clinical Microbiology and Infection Prevention. J. Biotechnol. 2017, 243, 16–24. [Google Scholar] [CrossRef]
- Houldcroft, C.J.; Beale, M.A.; Breuer, J. Clinical and Biological Insights from Viral Genome Sequencing. Nat. Rev. Microbiol. 2017, 15, 183–192. [Google Scholar] [CrossRef]
- Gu, W.; Miller, S.; Chiu, C.Y. Clinical Metagenomic Next-Generation Sequencing for Pathogen Detection. Annu. Rev. Pathol. Mech. Dis. 2019, 14, 319–338. [Google Scholar] [CrossRef]
- Quick, J.; Loman, N.J.; Duraffour, S.; Simpson, J.T.; Severi, E.; Cowley, L.; Bore, J.A.; Koundouno, R.; Dudas, G.; Mikhail, A.; et al. Real-Time, Portable Genome Sequencing for Ebola Surveillance. Nature 2016, 530, 228–232. [Google Scholar] [CrossRef]
- Schlaberg, R.; Chiu, C.Y.; Miller, S.; Procop, G.W.; Weinstock, G.; the Professional Practice Committee and Committee on Laboratory Practices of the American Society for Microbiology; the Microbiology Resource Committee of the College of American Pathologists. Validation of Metagenomic Next-Generation Sequencing Tests for Universal Pathogen Detection. Arch. Pathol. Lab. Med. 2017, 141, 776–786. [Google Scholar] [CrossRef]
- Laughlin, L.W.; Meegan, J.M.; Strausbaugh, L.J.; Morens, D.M.; Watten, R.H. Epidemic Rift Valley Fever in Egypt: Observations of the Spectrum of Human Illness. Trans. R. Soc. Trop. Med. Hyg. 1979, 73, 630–633. [Google Scholar] [CrossRef]
- Quick, J.; Grubaugh, N.D.; Pullan, S.T.; Claro, I.M.; Smith, A.D.; Gangavarapu, K.; Oliveira, G.; Robles-Sikisaka, R.; Rogers, T.F.; Beutler, N.A.; et al. Multiplex PCR Method for MinION and Illumina Sequencing of Zika and Other Virus Genomes Directly from Clinical Samples. Nat. Protoc. 2017, 12, 1261–1276. [Google Scholar] [CrossRef]
- Illingworth, C.J.R.; Roy, S.; Beale, M.A.; Tutill, H.; Williams, R.; Breuer, J. On the Effective Depth of Viral Sequence Data. Virus Evol. 2017, 3, vex030. [Google Scholar] [CrossRef]
- McCrone, J.T.; Lauring, A.S. Measurements of Intrahost Viral Diversity Are Extremely Sensitive to Systematic Errors in Variant Calling. J. Virol. 2016, 90, 6884–6895. [Google Scholar] [CrossRef] [Green Version]
- Schirmer, M.; Ijaz, U.Z.; D’Amore, R.; Hall, N.; Sloan, W.T.; Quince, C. Insight into Biases and Sequencing Errors for Amplicon Sequencing with the Illumina MiSeq Platform. Nucleic Acids Res. 2015, 43, e37. [Google Scholar] [CrossRef]
- Gardy, J.L.; Loman, N.J. Towards a Genomics-Informed, Real-Time, Global Pathogen Surveillance System. Nat. Rev. Genet. 2018, 19, 9–20. [Google Scholar] [CrossRef]
- Smith, M.R.; Schirtzinger, E.E.; Wilson, W.C.; Davis, A.S. Rift Valley Fever Virus: Propagation, Quantification, and Storage. Curr. Protoc. Microbiol. 2019, 55, 92. [Google Scholar] [CrossRef]
- Ikegami, T.; Won, S.; Peters, C.J.; Makino, S. Characterization of Rift Valley Fever Virus Transcriptional Terminations. J. Virol. 2007, 81, 8421–8438. [Google Scholar] [CrossRef]
- Carrillo, C.; Lu, Z.; Borca, M.V.; Vagnozzi, A.; Kutish, G.F.; Rock, D.L. Genetic and Phenotypic Variation of Foot-and-Mouth Disease Virus during Serial Passages in a Natural Host. J. Virol. 2007, 81, 11341–11351. [Google Scholar] [CrossRef]
- Faria, N.R.; Quick, J.; Claro, I.M.; Thézé, J.; de Jesus, J.G.; Giovanetti, M.; Kraemer, M.U.G.; Hill, S.C.; Black, A.; da Costa, A.C.; et al. Establishment and Cryptic Transmission of Zika Virus in Brazil and the Americas. Nature 2017, 546, 406–410. [Google Scholar] [CrossRef]
- Grubaugh, N.D.; Ladner, J.T.; Kraemer, M.U.G.; Dudas, G.; Tan, A.L.; Gangavarapu, K.; Wiley, M.R.; White, S.; Thézé, J.; Magnani, D.M.; et al. Genomic Epidemiology Reveals Multiple Introductions of Zika Virus into the United States. Nature 2017, 546, 401–405. [Google Scholar] [CrossRef]
- Quick, J. NCoV-2019 Sequencing Protocol v3 (LoCost) V.3. Protocols.Io. Available online: https://www.protocols.io/view/ncov-2019-sequencing-protocol-v3-locost-bh42j8ye (accessed on 18 July 2022).
- Juma, J.; Fonseca, V.; Konongoi, S.L.; van Heusden, P.; Roesel, K.; Sang, R.; Bett, B.; Christoffels, A.; de Oliveira, T.; Oyola, S.O. Genomic Surveillance of Rift Valley Fever Virus: From Sequencing to Lineage Assignment. BMC Genom. 2022, 23, 520. [Google Scholar] [CrossRef]
- Bird, B.H.; Bawiec, D.A.; Ksiazek, T.G.; Shoemaker, T.R.; Nichol, S.T. Highly Sensitive and Broadly Reactive Quantitative Reverse Transcription-PCR Assay for High-Throughput Detection of Rift Valley Fever Virus. J. Clin. Microbiol. 2007, 45, 3506–3513. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Green Version]
- O’Leary, N.A.; Wright, M.W.; Brister, J.R.; Ciufo, S.; Haddad, D.; McVeigh, R.; Rajput, B.; Robbertse, B.; Smith-White, B.; Ako-Adjei, D.; et al. Reference Sequence (RefSeq) Database at NCBI: Current Status, Taxonomic Expansion, and Functional Annotation. Nucleic Acids Res. 2016, 44, D733–D745. [Google Scholar] [CrossRef]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, Scalable Generation of High-quality Protein Multiple Sequence Alignments Using Clustal Omega. Available online: https://www.embopress.org/doi/epdf/10.1038/msb.2011.75 (accessed on 4 February 2022).
- Juma, J. Rvfvampliconseq: A Nextflow Pipeline for Analyzing Rift Valley Fever Virus Amplicon Sequencing Data from Illumina Instrument. BMC Genom. 2022, 23, 520. [Google Scholar]
- Andrews, S. Babraham Bioinformatics—FastQC A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 18 July 2022).
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows–Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Grubaugh, N.D.; Gangavarapu, K.; Quick, J.; Matteson, N.L.; De Jesus, J.G.; Main, B.J.; Tan, A.L.; Paul, L.M.; Brackney, D.E.; Grewal, S.; et al. An Amplicon-Based Sequencing Framework for Accurately Measuring Intrahost Virus Diversity Using PrimalSeq and IVar. Genome Biol. 2019, 20, 8. [Google Scholar] [CrossRef]
- Quinlan, A.R.; Hall, I.M. BEDTools: A Flexible Suite of Utilities for Comparing Genomic Features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A Program for Annotating and Predicting the Effects of Single Nucleotide Polymorphisms, SnpEff: SNPs in the Genome of Drosophila Melanogaster Strain w-1118; Iso-2; Iso-3. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef]
- Cingolani, P.; Patel, V.M.; Coon, M.; Nguyen, T.; Land, S.J.; Ruden, D.M.; Lu, X. Using Drosophila Melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift. Front. Genet. 2012, 3, 35. [Google Scholar] [CrossRef]
- Juma, J. Viclara Is a Bioinformatics Analysis Pipeline for Classification and Reference Guided Assembly of Segmented Viruses from Metagenomics Reads Obtained on Illumina Platform. Viruses 2022, 14, 2163. [Google Scholar]
- Katoh, K. MAFFT: A Novel Method for Rapid Multiple Sequence Alignment Based on Fast Fourier Transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
- Tavaré, S. Some Probabilistic and Statistical Problems in the Analysis of DNA Sequences. In Some Mathematical Questions in Biology: DNA Sequence Analysis; Waterman, M.S., Ed.; American Mathematical Society: Providence, RI, USA, 1986; pp. 57–86. [Google Scholar]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. JModelTest 2: More Models, New Heuristics and Parallel Computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Guindon, S.; Dufayard, J.-F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef]
- Rambaut, A.; Lam, T.T.; Max Carvalho, L.; Pybus, O.G. Exploring the Temporal Structure of Heterochronous Sequences Using TempEst (Formerly Path-O-Gen). Virus Evol. 2016, 2, vew007. [Google Scholar] [CrossRef]
- Sagulenko, P.; Puller, V.; Neher, R.A. TreeTime: Maximum-Likelihood Phylodynamic Analysis. Virus Evol 2018, 4, vex042. [Google Scholar]
- Frey, U.H.; Bachmann, H.S.; Peters, J.; Siffert, W. PCR-Amplification of GC-Rich Regions: “Slowdown PCR”. Nat. Protoc. 2008, 3, 1312–1317. [Google Scholar] [CrossRef]
- Grobbelaar, A.A.; Weyer, J.; Leman, P.A.; Kemp, A.; Paweska, J.T.; Swanepoel, R. Molecular Epidemiology of Rift Valley Fever Virus. Emerg. Infect. Dis. 2011, 17, 2270–2276. [Google Scholar] [CrossRef]
Sample ID | Treatment(s) | Host Species | Sample Type | Country | Location | Collection Date |
---|---|---|---|---|---|---|
DVS-230 | amPCRe, CCE, Direct | Bovine | Serum | Kenya | Kiambu | 2021 |
DVS-356 | amPCRe, CCE, Direct | Bovine | Serum | Kenya | Kiambu | 2021 |
DK-B2 | amPCRe, CCE, Direct | Bovine | Serum | Kenya | Murang’a | 2021 |
RU1 | amPCRe, CCE, Direct | Bovine | Serum | Rwanda | Rulindo | 2018 |
08HAB | amPCRe, CCE, Direct | Bovine | Serum | Kenya | Wajir | 2018 |
RVFV Segment | Primer Name | Sequence 5′–3′ |
---|---|---|
L | RVFL-2912fwdGG | TGAAAATTCCTGAGACACATGG |
L | RVFL-2981revAC | ACTTCCTTGCATCATCTGATG |
L | RVFL-probe-2950 | CAATGTAAGGGGCCTGTGTGGACTTGTG |
Component | Amount (µL) | Final Concentration |
---|---|---|
Q5 Hot Start Master Mix buffer * | 12.5 | 1× |
Primer pool 1 or 2 (10 µM) | 1.4 each for pool 1 and pool 2 | 0.015 µM per primer |
Nuclease-Free Water | Up to 7 µL | |
cDNA | 4.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Juma, J.; Konongoi, S.L.; Nsengimana, I.; Mwangi, R.; Akoko, J.; Nyamota, R.; Muli, C.; Dobi, P.O.; Kiritu, E.; Osiany, S.; et al. Using Multiplex Amplicon PCR Technology to Efficiently and Timely Generate Rift Valley Fever Virus Sequence Data for Genomic Surveillance. Viruses 2023, 15, 477. https://doi.org/10.3390/v15020477
Juma J, Konongoi SL, Nsengimana I, Mwangi R, Akoko J, Nyamota R, Muli C, Dobi PO, Kiritu E, Osiany S, et al. Using Multiplex Amplicon PCR Technology to Efficiently and Timely Generate Rift Valley Fever Virus Sequence Data for Genomic Surveillance. Viruses. 2023; 15(2):477. https://doi.org/10.3390/v15020477
Chicago/Turabian StyleJuma, John, Samson L. Konongoi, Isidore Nsengimana, Reuben Mwangi, James Akoko, Richard Nyamota, Collins Muli, Paul O. Dobi, Edward Kiritu, Shebbar Osiany, and et al. 2023. "Using Multiplex Amplicon PCR Technology to Efficiently and Timely Generate Rift Valley Fever Virus Sequence Data for Genomic Surveillance" Viruses 15, no. 2: 477. https://doi.org/10.3390/v15020477
APA StyleJuma, J., Konongoi, S. L., Nsengimana, I., Mwangi, R., Akoko, J., Nyamota, R., Muli, C., Dobi, P. O., Kiritu, E., Osiany, S., Onwong’a, A. A., Gachogo, R. W., Sang, R., Christoffels, A., Roesel, K., Bett, B., & Oyola, S. O. (2023). Using Multiplex Amplicon PCR Technology to Efficiently and Timely Generate Rift Valley Fever Virus Sequence Data for Genomic Surveillance. Viruses, 15(2), 477. https://doi.org/10.3390/v15020477