Epidemiology of Influenza-like Illness and Respiratory Viral Etiology in Adult Patients in Taiyuan City, Shanxi Province, China between 2018 and 2019
Abstract
1. Introduction
2. Materials and Methods
2.1. ILI Definition
2.2. Data Collection
2.3. Specimen Collection
2.4. Nucleic acid Extraction
2.5. IFV Identification
2.6. Multiplex Real-Time RT-PCR/PCR Identification for Other Respiratory Viral Pathogens
2.7. Statistical Analysis
3. Results
3.1. Epidemiological Feature
3.2. Seasonal Characteristics of ILI
3.3. Overall Detection of Respiratory Viruses in Adult Patients with ILI
3.4. Detection of IFV Subtypes Changed over Time
3.5. Age Distribution of Patients with Viral Infections
3.6. Monthly Distribution of Respiratory Viruses

4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Heijnen, M.L.; Dorigo-Zetsma, J.W.; Bartelds, A.I.; Wilbrink, B.; Sprenger, M.J. Surveillance of respiratory pathogens and influenza-like illnesses in general practices—The Netherlands, winter 1997–1998. Eurosurveillance 1999, 4, 81–84. [Google Scholar] [CrossRef] [PubMed]
- Mahmud, S.M.; Thompson, L.H.; Nowicki, D.L.; Plourde, P.J. Outbreaks of influenza-like illness in long-term care facilities in Winnipeg, Canada. Influenza Other Respir. Viruses 2013, 7, 1055–1061. [Google Scholar] [CrossRef] [PubMed]
- Lai, X.; Rong, H.; Ma, X.; Hou, Z.; Li, S.; Jing, R.; Zhang, H.; Lyu, Y.; Wang, J.; Feng, H.; et al. The Economic Burden of Influenza-Like Illness among Children, Chronic Disease Patients, and the Elderly in China: A National Cross-Sectional Survey. Int. J. Environ. Res. Public. Health 2021, 18, 6277. [Google Scholar] [CrossRef] [PubMed]
- Luzhao, F. Study on Viral Etiologies of Hospitalized Acute Respiratory Infection and Influenza Seasonality in China; Chinese Center for Disease Control and Prevention: Shanghai, China, 2014. [Google Scholar]
- Laguna-Torres, V.A.; Sánchez-Largaespada, J.F.; Lorenzana, I.; Forshey, B.; Aguilar, P.; Jimenez, M.; Parrales, E.; Rodriguez, F.; García, J.; Jimenez, I.; et al. Influenza and other respiratory viruses in three Central American countries. Influenza Other Respir. Viruses 2011, 5, 123–134. [Google Scholar] [CrossRef]
- Puzelli, S.; Valdarchi, C.; Ciotti, M.; Dorrucci, M.; Farchi, F.; Babakir-Mina, M.; Perno, C.F.; Donatelli, I.; Rezza, G. Viral causes of influenza-like illness: Insight from a study during the winters 2004–2007. J. Med. Virol. 2009, 81, 2066–2071. [Google Scholar] [CrossRef]
- Li, Z.J.; Zhang, H.Y.; Ren, L.L.; Lu, Q.B.; Ren, X.; Zhang, C.H.; Wang, Y.F.; Lin, S.H.; Zhang, X.A.; Li, J.; et al. Etiological and epidemiological features of acute respiratory infections in China. Nat. Commun. 2021, 12, 5026. [Google Scholar] [CrossRef]
- Fu, Y.; Pan, L.; Sun, Q.; Zhu, W.; Zhu, L.; Ye, C.; Xue, C.; Wang, Y.; Liu, Q.; Ma, P.; et al. The clinical and etiological characteristics of influenza-like illness (ILI) in outpatients in Shanghai, China, 2011 to 2013. PLoS ONE 2015, 10, e0119513. [Google Scholar] [CrossRef]
- World Health Organization. Influenza (Seasonal). Available online: https://www.who.int/en/news-room/fact-sheets/detail/influenza-(seasonal) (accessed on 3 October 2023).
- Moghadami, M. A Narrative Review of Influenza: A Seasonal and Pandemic Disease. Iran. J. Med. Sci. 2017, 42, 2–13. [Google Scholar]
- Yu, G.Q.; Huang, Y.M.; Chi, J.; Xiao, J.H.; Wu, Z.H.; Zhang, Z.W. Viral etiology investigation on influenza—Like illnesses in Shenzhen in 2011. Chin. J. Health Lab. Technol. 2012, 22, 2419–2422. [Google Scholar]
- Heim, A.; Ebnet, C.; Harste, G.; Pring-Akerblom, P. Rapid and quantitative detection of human adenovirus DNA by real-time PCR. J. Med. Virol. 2003, 70, 228–239. [Google Scholar] [CrossRef]
- Templeton, K.E.; Scheltinga, S.A.; Beersma, M.F.; Kroes, A.C.; Claas, E.C. Rapid and sensitive method using multiplex real-time PCR for diagnosis of infections by influenza a and influenza B viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3, and 4. J. Clin. Microbiol. 2004, 42, 1564–1569. [Google Scholar] [CrossRef] [PubMed]
- van Elden, L.J.; van Loon, A.M.; van Alphen, F.; Hendriksen, K.A.; Hoepelman, A.I.; van Kraaij, M.G.; Oosterheert, J.J.; Schipper, P.; Schuurman, R.; Nijhuis, M. Frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction. J. Infect. Dis. 2004, 189, 652–657. [Google Scholar] [CrossRef] [PubMed]
- Watzinger, F.; Suda, M.; Preuner, S.; Baumgartinger, R.; Ebner, K.; Baskova, L.; Niesters, H.G.; Lawitschka, A.; Lion, T. Real-time quantitative PCR assays for detection and monitoring of pathogenic human viruses in immunosuppressed pediatric patients. J. Clin. Microbiol. 2004, 42, 5189–5198. [Google Scholar] [CrossRef] [PubMed]
- Gunson, R.N.; Collins, T.C.; Carman, W.F. Real-time RT-PCR detection of 12 respiratory viral infections in four triplex reactions. J. Clin. Virol. 2005, 33, 341–344. [Google Scholar] [CrossRef] [PubMed]
- Allander, T.; Jartti, T.; Gupta, S.; Niesters, H.G.; Lehtinen, P.; Osterback, R.; Vuorinen, T.; Waris, M.; Bjerkner, A.; Tiveljung-Lindell, A.; et al. Human bocavirus and acute wheezing in children. Clin. Infect. Dis. 2007, 44, 904–910. [Google Scholar] [CrossRef] [PubMed]
- Brittain-Long, R.; Nord, S.; Olofsson, S.; Westin, J.; Anderson, L.M.; Lindh, M. Multiplex real-time PCR for detection of respiratory tract infections. J. Clin. Virol. 2008, 41, 53–56. [Google Scholar] [CrossRef]
- Tiveljung-Lindell, A.; Rotzén-Ostlund, M.; Gupta, S.; Ullstrand, R.; Grillner, L.; Zweygberg-Wirgart, B.; Allander, T. Development and implementation of a molecular diagnostic platform for daily rapid detection of 15 respiratory viruses. J. Med. Virol. 2009, 81, 167–175. [Google Scholar] [CrossRef]
- Li, H.; Wei, Q.; Tan, A.; Wang, L. Epidemiological analysis of respiratory viral etiology for influenza-like illness during 2010 in Zhuhai, China. Virol. J. 2013, 10, 143. [Google Scholar] [CrossRef]
- Yu, Y.; Ji, Y.; Zhao, S.; Seng, M.; Jiang, H.; Ye, Y.; Xu, J. Analysis on the influenza-like cases surveillance data of the sentinel hospitals in Henan province during 2010–2015. Mod. Prev. Med. 2016, 43, 4188–4191. [Google Scholar]
- Zhang, C.; Shang, X.Y.; Tang, X.P.; Li, Y. Distribution characteristics of viral etiology in adult patients with respiratory tract infections. Mil. Med. Sci. 2017, 41, 325–327. [Google Scholar]
- Xu, H.T.; Li, Y.; Chen, D.K.; Wang, H.; Ai, X.M.; Chen, X.; Tao, F.R.; Lai, H.Y.; Hu, Y.J.; Zhang, X.Z. Epidemiological analysis of respiratory tract viruses among adult patients in Beijing. Lab. Med. 2016, 31, 499–502. [Google Scholar]
- Na, W.; Zhang, W.H.; Gao, B.; Zhang, X. Influenza etiological surveillance analysis in Yinchuan from 2010-2019. Jiangsu J. Prev. Med. 2021, 32, 53–55. [Google Scholar]
- Lee, S.S.; Viboud, C.; Petersen, E. Understanding the rebound of influenza in the post COVID-19 pandemic period holds important clues for epidemiology and control. Int. J. Infect. Dis. 2022, 122, 1002–1004. [Google Scholar] [CrossRef] [PubMed]
- Ali, S.T.; Lau, Y.C.; Shan, S.; Ryu, S.; Du, Z.; Wang, L.; Xu, X.K.; Chen, D.; Xiong, J.; Tae, J.; et al. Prediction of upcoming global infection burden of influenza seasons after relaxation of public health and social measures during the COVID-19 pandemic: A modelling study. Lancet Glob. Health 2022, 10, e1612–e1622. [Google Scholar] [CrossRef]
- Yu, X.; Lei, J.; Wang, Y. Epidemiological characteristics of influenza outbreaks in Guiyang, 2015–2018. Mod. Prev. Med. 2020, 47, 24–26. [Google Scholar]
- Dong, X.Q.; He, M.; Wang, Y.Q.; Shi, L.M.; Qi, X.; Du, X.F. Epidemiological and etiological characteristics of influenza in Nanjing from 2011 to 2020. J. Trop. Med. 2021, 21, 1594–1596+1621. [Google Scholar]
- Zhong, J.; Liang, L.; Huang, P.; Zhu, X.; Zou, L.; Yu, S.; Zhang, X.; Zhang, Y.; Ni, H.; Yan, J. Genetic mutations in influenza H3N2 viruses from a 2012 epidemic in Southern China. Virol. J. 2013, 10, 345. [Google Scholar] [CrossRef]
- Recommended composition of influenza virus vaccines for use in the 2017–2018 northern hemisphere influenza season. Wkly. Epidemiol. Rec. 2017, 92, 117–128.
- Recommended composition of influenza virus vaccines for use in the 2018–2019 northern hemisphere influenza season. Wkly. Epidemiol. Rec. 2018, 93, 133–141.
- Technical guidelines for seasonal influenza vaccination in China (2019–2020). Chin. J. Prev. Med. 2020, 54, 21–36. [CrossRef]
- Nickbakhsh, S.; Mair, C.; Matthews, L.; Reeve, R.; Johnson, P.C.D.; Thorburn, F.; von Wissmann, B.; Reynolds, A.; McMenamin, J.; Gunson, R.N.; et al. Virus-virus interactions impact the population dynamics of influenza and the common cold. Proc. Natl. Acad. Sci. USA 2019, 116, 27142–27150. [Google Scholar] [CrossRef] [PubMed]
- Esneau, C.; Duff, A.C.; Bartlett, N.W. Understanding Rhinovirus Circulation and Impact on Illness. Viruses 2022, 14. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Q.; Chen, S.; Gu, L.; Qu, J. Comparative analyses of clinical features reveal the severity of human adenovirus type 55 and type 7 in acute respiratory tract infections. J. Med. Microbiol. 2021, 70. [Google Scholar] [CrossRef]
- Liang, H.; Liu, Q. The pathogen spectrum and molecular epidemiological characteristics of enterovirus in cases of influenza-like illness in Chaoyang, Beijing from 2016–2018. J. Pathog. Biol. 2019, 14, 1443–1447. [Google Scholar] [CrossRef]
- Lu, Y.; Tong, J.; Pei, F.; Yang, Y.; Xu, D.; Ji, M.; Xing, C.; Jia, P.; Xu, C.; Wang, Y.; et al. Viral aetiology in adults with acute upper respiratory tract infection in Jinan, Northern China. Clin. Dev. Immunol. 2013, 2013, 869521. [Google Scholar] [CrossRef][Green Version]
- Liu, J.; Qiu, Q.; Zhang, W.; Kong, D.; Cui, X.; Zheng, Y.; Zhang, X.; Teng, Z. Analysis on viral infection in acute respiratory infection cases in adults in Shanghai, 2020−2022. Dis. Surveill. 2023, 38, 792–798. [Google Scholar]
- Fall, A.; Dia, N.; Kébé, O.; Sarr, F.D.; Kiori, D.E.; Cisséel, H.A.; Sy, S.; Goudiaby, D.; Richard, V.; Diop, O.M.; et al. Enteroviruses and Rhinoviruses: Molecular Epidemiology of the Most Influenza-Like Illness Associated Viruses in Senegal. Am. J. Trop. Med. Hyg. 2016, 95, 339–347. [Google Scholar] [CrossRef]
- Wang, H.B.; Lei, N.; Zhao, J.H.; Ma, J.X.; Liang, H.X.; Sun, L.L. Pathogen spectrum and epidemic characteristics of influenza—Like illness in Chaoyang District of Beijing, 2017. Chin. J. Health Lab. Tec. 2020, 30, 2913–2917. [Google Scholar]
- Silva, R.C.; Mendes Gda, S.; Rojas, M.A.; Amorim, A.R.; Couceiro, J.N.; Lupi, O.; Elabras, J.; Pires, G.; Valle, S.; Santos, N. Frequency of viral etiology in symptomatic adult upper respiratory tract infections. Braz. J. Infect. Dis. 2015, 19, 30–35. [Google Scholar] [CrossRef]
- Bagasi, A.A.; Howson-Wells, H.C.; Clark, G.; Tarr, A.W.; Soo, S.; Irving, W.L.; McClure, C.P. Human Bocavirus infection and respiratory tract disease identified in a UK patient cohort. J. Clin. Virol. 2020, 129, 104453. [Google Scholar] [CrossRef]
- Mao, A.J.; Liu, H.F.; Chen, Z. Etiological characteristics and treatment of common viral respiratory tract infection in children. China Mod. Med. 2021, 28, 178–181. [Google Scholar]
- Brendish, N.J.; Clark, T.W. Antiviral treatment of severe non-influenza respiratory virus infection. Curr. Opin. Infect. Dis. 2017, 30, 573–578. [Google Scholar] [CrossRef]
- Jain, S.; Williams, D.J.; Arnold, S.R.; Ampofo, K.; Bramley, A.M.; Reed, C.; Stockmann, C.; Anderson, E.J.; Grijalva, C.G.; Self, W.H.; et al. Community-Acquired Pneumonia Requiring Hospitalization among US Children. N. Engl. J. Med. 2015, 372, 835–845. [Google Scholar] [CrossRef]


| Mixture | Pathogen | Primer/Probe | Sequences (5′-3′) * | Labels 5′/3′ |
|---|---|---|---|---|
| A | HKU1 | Forword primer | CACTTCTATTCCCTCCG TGTTTC | |
| Reverse primer | TTAGAAGCAGACCTTCCTGAGCC | |||
| Probe | CGCCTGGTACGATTTTGCCTCAAGGCT | FAM/TAMRA | ||
| 229E | Forword primer | CAGTCAAATGGGCTGATGCA | ||
| Reverse primer | AAAGGGCTATAAAGAGAATAAGGTATTCT | |||
| Probe | CCCTGACGACCACGTTGTGGTTC | HEX/BHQ | ||
| OC43 | Forword primer | CGATGAGGCTATTCCGACTAGGT | ||
| Reverse primer | CCTTCCTGAGCCTTCAATATAGTAACC | |||
| Probe | TCCGCCTGGCACGGTACTCCCT | CY5/BHQ | ||
| B | HPIV1 | Forword primer | GTTGTCAATGTCTTAATTCGTATCAATAATT | |
| Reverse primer | GTAGCCTMCCTTCGGCACCTAA | |||
| Probe | TAGGCCAAAGATTGTTGTCGAGACTATTCCAA | FAM/TAMRA | ||
| HEV | Forword primer | CATGGTGYGAAGAGTCTATTGAGCTA | ||
| Reverse primer | GGACACCCAAAGTAGTCGGTTC | |||
| Probe | CGGCCCCTGAATGCGGCTAATC | HEX/BHQ | ||
| HMPV | Forword primer | ATGTCTCTTCAAGGGATTCACCT | ||
| Reverse primer | AMAGYGTTATTTCTTGTTGCAATGATGA | |||
| Probe | CATGCTATATTAAAAGAGTCTCARTAC | ROX/BHQ | ||
| HRSV | Forword primer | GCAAATATGGAAACATACGTGAACA | ||
| Reverse primer | GCACCCATATTGTWAGTGATGCA | |||
| Probe | CTTCACGAAGGCTCCACATACACAGCWG | CY5/BHQ | ||
| C | HPIV2 | Forword primer | GCATTTCCAATCTTCAGGACTATGA | |
| Reverse primer | ACCTCCTGGTATAGCAGTGACTGAAC | |||
| Probe | CCATTTACCTAAGTGATGGAATCAATCGCAAA | FAM/TAMRA | ||
| HAdV | Forword primer | GCCACGGTGGGGTTTCTAAACTT | ||
| Reverse primer | GCCCCAGTGGTCTTACATGCACATC | |||
| Probe | TGCACCAGACCCGGGCTCAGGTACTCCGA | HEX/BHQ | ||
| HBoV | Forword primer | GGA AGA GAC ACT GGC AGA CAA | ||
| Reverse primer | GGG TGT TCC TGA TGA TAT GAG C | |||
| Probe | CTG CGG CTC CTG CTC CTG TGAT | ROX/BHQ | ||
| D | NL63 | Forword primer | ACGTACTTCTATTATGAAGCATGATATTAA | |
| Reverse primer | AGCAGATCTAATGTTATACTTAAAACTACG | |||
| Probe | ATTGCCAAGGCTCCTAAACGTACAGGTGTT | HEX/BHQ | ||
| E | HRV | Forword primer1 | GGTGTGAAGAGCCSCRTGTGCT | |
| Forword prime2 | GGTGTGAAGACTCGCATGTGCT | |||
| Forword prime3 | GGGTGYGAAGAGYCTANTGTGCT | |||
| Reverse primer3 | GGACACCCAAAGTAGTYGGTYC | |||
| Probe | CCGGCCCTGAATGYGGCTAAYC | CY5/BHQ | ||
| F | HPIV4 | Forword primer | CCTGGAGTCCCATCAAAAGT | |
| Reverse primer | GCATCTATACGAACACCTGCT | |||
| Probe | GCTGCCGTCTCAAAATTTGTTGATCAAGACAATACAATTGGCAGC | ROX/BHQ | ||
| HPIV3 | Forword primer | GGAGCATTGTGTCATCTGTC | ||
| Reverse primer | TAGTGTGTAATGCAGCTCGT | |||
| Probe | CGCGCTACCCAGTCATAACTTACTCAACAGCAACAGCGCG | CY5/BHQ |
| Items | 2018 | 2019 | Total |
|---|---|---|---|
| No. of outpatient and emergency cases | 920,635 | 987,234 | 1,907,869 |
| No. of ILI reported cases (%) | 12,453 (1.35) | 13,752 (1.39) | 26,205 (1.37) |
| Incidence rate (per 100,000) | 284.33 | 311.03 | 297.75 |
| Incidence by age groups (per 100,000) | |||
| 0–4 | 5839 (3161.20) | 6189 (2962.60) | 12,028 (3055.84) |
| 5–14 | 4471 (1236.70) | 4849 (1280.80) | 9320 (1259.26) |
| 15–24 | 603 (70.00) | 816 (146.02) | 1419 (99.91) |
| 25–59 | 1247 (52.60) | 1614 (62.25) | 2861 (57.62) |
| ≥60 | 293 (48.80) | 284 (41.62) | 577 (45.00) |
| Virus Detected | 18–24 (n = 631) | 25–59 (n = 1620) | ≥60 (n = 462) | Total (n = 2713) No. (%) | p Value | |||
|---|---|---|---|---|---|---|---|---|
| Total No. (%) | Coinfection No. (%) | Total No. (%) | Coinfection No. (%) | Total No. (%) | Coinfection No. (%) | |||
| HRV | 12 (1.90) | 1 (0.16) | 33 (2.04) | 9 (0.56) | 9 (1.95) | 3 (0.65) | 54 (1.99) | 0.098 |
| HAdV | 16 (2.54) | 6 (0.95) | 38 (2.35) | 16 (0.99) | 5 (1.08) | 4 (0.87) | 59 (2.17) | 0.202 |
| HBoV | 5 (0.79) | 4 (0.63) | 24 (1.48) | 15 (0.93) | 14 (3.03) | 6 (1.30) | 43 (1.58) | 0.012 |
| HEV | 6 (0.95) | 1 (0.16) | 31 (1.91) | 19 (1.17) | 2 (0.43) | 1 (0.22) | 39 (1.44) | 0.031 |
| HMPV | 6 (0.95) | 0 | 14 (0.86) | 5 (0.31) | 4 (0.87) | 0 | 24 (0.88) | 0.98 |
| HRSV | 3 (0.48) | 3 (0.48) | 9 (0.56) | 4 (0.25) | 4 (0.87) | 1 (0.22) | 16 (0.59) | 0.679 |
| IFV | 64 (10.14) | 0 | 202 (12.47) | 6 (0.37) | 54 (11.69) | 2 (0.43) | 320 (11.80) | 0.306 |
| H1N1 (2009) | 27 (4.28) | 0 | 131 (8.09) | 4 (0.25) | 33 (7.14) | 0 | 191 (7.04) | 0.007 |
| H3N2 | 18 (2.85) | 0 | 28 (1.73) | 1 (0.06) | 11 (2.38) | 0 | 57 (2.10) | 0.223 |
| Yamagata | 14 (2.22) | 0 | 25 (1.54) | 1 (0.06) | 9 (1.95) | 2 (0.43) | 48 (1.77) | 0.523 |
| Victoria | 5 (0.79) | 0 | 18 (1.11) | 0 | 1 (0.22) | 0 | 24 (0.88) | 0.186 |
| HPIV | 4 (0.63) | 4 (0.63) | 24 (1.48) | 13 (0.80) | 2 (0.43) | 2 (0.43) | 36 (1.33) | 0.071 |
| HPIV1 | 0 | 0 | 2 (0.12) | 1 (0.06) | 0 | 0 | 2 (0.07) | |
| HPIV2 | 6 (0.95) | 4 (0.63) | 17 (1.05) | 11 (0.68) | 2 (0.43) | 2 (0.43) | 25 (0.92) | |
| HPIV3 | 0 | 0 | 1 (0.06) | 0 | 1 (0.22) | 0 | 2 (0.07) | |
| HPIV4 | 0 | 0 | 7 (0.43) | 1 (0.06) | 0 | 0 | 7 (0.26) | |
| HCoV | 5 (0.79) | 0 | 16 (0.99) | 5 (0.31) | 8 (1.73) | 5 (1.08) | 29 (1.07) | 0.290 |
| NL63 | 1 (0.16) | 0 | 5 (0.31) | 1 (0.06) | 1 (0.22) | 0 | 7 (0.26) | |
| OC43 | 2 (0.32) | 0 | 7 (0.43) | 2 (0.12) | 4 (0.87) | 3 (0.65) | 13 (0.48) | |
| 229E | 2 (0.32) | 0 | 3 (0.19) | 2 (0.12) | 3 (0.65) | 2 (0.43) | 8 (0.29) | |
| HKU1 | 0 | 0 | 1 (0.06) | 0 | 0 | 0 | 1 (0.04) | |
| Total | 119 (18.86) | 15 (3.01) | 337 (20.86) | 35 (2.16) | 90 (19.48) | 11 (2.38) | 546 (20.16) | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, Z.; Xue, P.; Gao, R.; Wang, R.; Zhao, L.; Zuo, Z.; Gao, L.; Han, R.; Yao, H.; Guo, J.; et al. Epidemiology of Influenza-like Illness and Respiratory Viral Etiology in Adult Patients in Taiyuan City, Shanxi Province, China between 2018 and 2019. Viruses 2023, 15, 2176. https://doi.org/10.3390/v15112176
Jia Z, Xue P, Gao R, Wang R, Zhao L, Zuo Z, Gao L, Han R, Yao H, Guo J, et al. Epidemiology of Influenza-like Illness and Respiratory Viral Etiology in Adult Patients in Taiyuan City, Shanxi Province, China between 2018 and 2019. Viruses. 2023; 15(11):2176. https://doi.org/10.3390/v15112176
Chicago/Turabian StyleJia, Zhao, Puna Xue, Ruihong Gao, Rui Wang, Lifeng Zhao, Zhihong Zuo, Li Gao, Rui Han, Hong Yao, Jiane Guo, and et al. 2023. "Epidemiology of Influenza-like Illness and Respiratory Viral Etiology in Adult Patients in Taiyuan City, Shanxi Province, China between 2018 and 2019" Viruses 15, no. 11: 2176. https://doi.org/10.3390/v15112176
APA StyleJia, Z., Xue, P., Gao, R., Wang, R., Zhao, L., Zuo, Z., Gao, L., Han, R., Yao, H., Guo, J., Xu, J., Zhu, Z., & Wang, J. (2023). Epidemiology of Influenza-like Illness and Respiratory Viral Etiology in Adult Patients in Taiyuan City, Shanxi Province, China between 2018 and 2019. Viruses, 15(11), 2176. https://doi.org/10.3390/v15112176

