Integrated Jingmenvirus Polymerase Gene in Ixodes ricinus Genome
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. The Study Areas
2.3. Tick Sampling and Processing
2.4. PCR Assays
2.5. Quantitative PCR
2.6. Sequencing and Cloning
2.6.1. Next Generation Sequencing
2.6.2. Sanger Sequencing
2.6.3. Cloning
2.7. Data Analysis
3. Results
3.1. High Prevalence of Jingmenviruses Positive Ticks in Moscow Region
3.2. RNA Virus or DNA Form?
3.3. Is the DNA Fragment Integrated in the Tick Genome?
3.3.1. NGS and Further Confirmation by Sanger Sequencing
3.3.2. Quantifying the Integrated Jingmenvirus Polymerase Gene in Ixodes Ricinus Genome
3.4. Screening for Jingmenviruses and the Integrated Jingmenvirus Polymerase Gene in Ixodes Ricinus from Different Regions of Russia
3.5. Screening for Jingmenviruses and the Integrated Jingmenvirus Polymerase Gene in Other Ixodid Tick Species
3.6. Genetic Variability of the Jingmenvirus Polymerase Gene Fragment in the Studied Ticks
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Qin, X.C.; Shi, M.; Tian, J.H.; Lin, X.D.; Gao, D.Y.; He, J.R.; Wang, J.B.; Li, C.X.; Kang, Y.J.; Yu, B.; et al. A tick-borne segmented RNA virus contains genome segments derived from unsegmented viral ancestors. Proc. Natl. Acad. Sci. USA 2014, 111, 6744–6749. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.D.; Wang, B.; Wei, F.; Han, S.Z.; Zhang, L.; Yang, Z.T.; Yan, Y.; Lv, X.L.; Li, L.; Wang, S.C.; et al. A new segmented virus associated with human febrile illness in China. N. Engl. J. Med. 2019, 380, 2116–2125. [Google Scholar] [CrossRef]
- Kholodilov, I.S.; Belova, O.A.; Morozkin, E.S.; Litov, A.G.; Ivannikova, A.Y.; Makenov, M.T.; Shchetinin, A.M.; Aibulatov, S.V.; Bazarova, G.K.; Bell-Sakyi, L.; et al. Geographical and tick-dependent distribution of Flavi-like Alongshan and Yanggou tick viruses in Russia. Viruses 2021, 13, 458. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, D.; Kuwata, R.; Kimura, T.; Shimoda, H.; Fujita, R.; Faizah, A.N.; Kai, I.; Matsumura, R.; Kuroda, Y.; Watanabe, S.; et al. Detection of Jingmenviruses in Japan with evidence of vertical transmission in ticks. Viruses 2021, 13, 2547. [Google Scholar] [CrossRef]
- Jia, N.; Liu, H.B.; Ni, X.B.; Bell-Sakyi, L.; Zheng, Y.C.; Song, J.L.; Li, J.; Jiang, B.G.; Wang, Q.; Sun, Y.; et al. Emergence of human infection with Jingmen tick virus in China: A retrospective study. EBioMedicine 2019, 43, 317–324. [Google Scholar] [CrossRef]
- Ternovoi, V.A.; Gladysheva, A.V.; Sementsova, A.O.; Zaykovskaya, A.V.; Volynkina, A.S.; Kotenev, E.S.; Agafonov, A.P.; Loktev, V.B. Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in Southern Russia. Vestn. Ross. Akad. Meditsinskikh Nauk 2020, 75, 129–134. [Google Scholar] [CrossRef]
- Emmerich, P.; Jakupi, X.; von Possel, R.; Berisha, L.; Halili, B.; Günther, S.; Cadar, D.; Ahmeti, S.; Schmidt-Chanasit, J. Viral metagenomics, genetic and evolutionary characteristics of Crimean-Congo hemorrhagic fever Orthonairovirus in humans, Kosovo. Infect. Genet. Evol. 2018, 65, 6–11. [Google Scholar] [CrossRef]
- Kholodilov, I.S.; Litov, A.G.; Klimentov, A.S.; Belova, O.A.; Polienko, A.E.; Nikitin, N.A.; Shchetinin, A.M.; Ivannikova, A.Y.; Bell-Sakyi, L.; Yakovlev, A.S.; et al. Isolation and Characterisation of Alongshan Virus in Russia. Viruses 2020, 12, 362. [Google Scholar] [CrossRef]
- Kuivanen, S.; Levanov, L.; Kareinen, L.; Sironen, T.; Jääskeläinen, A.J.; Plyusnin, I.; Zakham, F.; Emmerich, P.; Schmidt-Chanasit, J.; Hepojoki, J.; et al. Detection of novel tick-borne pathogen, Alongshan virus, in Ixodes ricinus ticks, South-Eastern Finland, 2019. Eurosurveillance 2019, 24, 1–8. [Google Scholar] [CrossRef]
- Dinçer, E.; Hacıoglu, S.; Kar, S.; Emanet, N.; Brinkmann, A.; Nitsche, A.; Özkul, A.; Linton, Y.-M.; Ergünay, K. Survey and characterization of Jingmen tick virus variants. Viruses 2019, 11, 1071. [Google Scholar] [CrossRef] [Green Version]
- Guo, J.-J.; Lin, X.-D.; Chen, Y.-M.; Hao, Z.-Y.; Wang, Z.-X.; Yu, Z.-M.; Lu, M.; Li, K.; Qin, X.-C.; Wang, W.; et al. Diversity and circulation of Jingmen tick virus in ticks and mammals. Virus Evol. 2020, 6, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Temmam, S.; Bigot, T.; Chrétien, D.; Gondard, M.; Pérot, P.; Pommelet, V.; Dufour, E.; Petres, S.; Devillers, E.; Hoem, T.; et al. Insights into the host range, genetic diversity, and geographical distribution of Jingmenviruses. mSphere 2019, 4, e00645-19. [Google Scholar] [CrossRef] [PubMed]
- Ternovoi, V.A.; Protopopova, E.V.; Shvalov, A.N.; Kartashov, M.Y.; Bayandin, R.B.; Tregubchak, T.V.; Yakovlev, S.A.; Nikiforov, K.A.; Konovalova Svetlana, N.; Loktev, V.B.; et al. Complete coding genome sequence for a novel multicomponent kindia tick virus detected from ticks collected in Guinea. bioRxiv 2020, 4–9. [Google Scholar] [CrossRef]
- Vandegrift, K.J.; Kumar, A.; Sharma, H.; Murthy, S.; Kramer, L.D.; Ostfeld, R.; Hudson, P.J.; Kapoor, A. Presence of segmented Flavivirus Infections in North America. Emerg. Infect. Dis. 2020, 26, 1810–1817. [Google Scholar] [CrossRef]
- Villa, E.C.; Maruyama, S.R.; de Miranda-Santos, I.K.F.; Palacios, G.; Ladner, J.T. Complete coding genome sequence for Mogiana Tick Virus, a Jingmenvirus isolated from ticks in Brazil. Genome Announc. 2017, 5, 17–18. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.M.; Chen, J.T.; Qin, J.; Guo, J.J.; Li, K.; Xu, Q.Y.; Wang, W.; Lu, M.; Qin, X.C.; Zhang, Y.Z. Identification and characterization of Jingmen tick virus in rodents from Xinjiang, China. Infect. Genet. Evol. 2020, 84, 10441. [Google Scholar] [CrossRef]
- Maruyama, S.R.; Castro-Jorge, L.A.; Ribeiro, C.; Gardinassi, L.G.; Garcia, G.R.; Brandão, L.G.; Rodrigues, A.R.; Okada, M.I.; Abrão, E.P.; Ferreira, B.R. Characterisation of divergent Flavivirus NS3 and NS5 protein sequences detected in Rhipicephalus microplus ticks from Brazil. Mem. Inst. Oswaldo Cruz 2014, 109, 38–50. [Google Scholar] [CrossRef]
- Gondard, M.; Temmam, S.; Devillers, E.; Pinarello, V.; Bigot, T.; Chrétien, D.; Aprelon, R.; Vayssier-Taussat, M.; Albina, E.; Eloit, M.; et al. RNA viruses of Amblyomma variegatum and Rhipicephalus microplus and cattle susceptibility in the French Antilles. Viruses 2020, 12, 144. [Google Scholar] [CrossRef]
- Holmes, E.C. The evolution of endogenous viral elements. Cell Host Microbe 2011, 10, 368–377. [Google Scholar] [CrossRef]
- Katzourakis, A.; Gifford, R.J. Endogenous viral elements in animal genomes. PLoS Genet. 2010, 6, e1001191. [Google Scholar] [CrossRef]
- Crochu, S.; Cook, S.; Attoui, H.; Charrel, R.N.; De Chesse, R.; Belhouchet, M.; Lemasson, J.J.; de Micco, P.; de Lamballerie, X. Sequences of Flavivirus-related RNA viruses persist in DNA form integrated in the genome of Aedes spp. Mosquitoes. J. Gen. Virol. 2004, 85, 1971–1980. [Google Scholar] [CrossRef] [PubMed]
- Roiz, D.; Vázquez, A.; Seco, M.P.S.; Tenorio, A.; Rizzoli, A. Detection of novel insect Flavivirus sequences integrated in Aedes albopictus (Diptera: Culicidae) in Northern Italy. Virol. J. 2009, 6, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, Y.; Frangeul, L.; Dickson, L.B.; Blanc, H.; Verdier, Y.; Vinh, J.; Lambrechts, L.; Saleh, M.-C. Uncovering the repertoire of endogenous Flaviviral elements in Aedes mosquito genomes. J. Virol. 2017, 91, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Crava, C.M.; Varghese, F.S.; Pischedda, E.; Halbach, R.; Palatini, U.; Marconcini, M.; Gasmi, L.; Redmond, S.; Afrane, Y.; Ayala, D.; et al. Population genomics in the arboviral vector Aedes aegypti reveals the genomic architecture and evolution of endogenous viral elements. Mol. Ecol. 2021, 30, 1594–1611. [Google Scholar] [CrossRef]
- Spadar, A.; Phelan, J.E.; Benavente, E.D.; Campos, M.; Gomez, L.F.; Mohareb, F.; Clark, T.G.; Campino, S. Flavivirus integrations in Aedes aegypti are limited and highly conserved across samples from different geographic regions unlike integrations in Aedes albopictus. Parasites Vectors 2021, 14, 1–14. [Google Scholar] [CrossRef]
- Lequime, S.; Lambrechts, L. Discovery of Flavivirus-derived endogenous viral elements in Anopheles mosquito genomes supports the existence of Anopheles-associated insect-specific Flaviviruses. Virus Evol. 2017, 3, 1–8. [Google Scholar] [CrossRef]
- Russo, A.G.; Kelly, A.G.; Tuipulotu, D.E.; Tanaka, M.M.; White, P.A. Novel insights into endogenous RNA viral elements in Ixodes scapularis and other arbovirus vector genomes. Virus Evol. 2019, 5, 1–18. [Google Scholar] [CrossRef]
- ter Horst, A.M.; Nigg, J.C.; Dekker, F.M.; Falk, B.W. Endogenous viral elements are widespread in arthropod genomes and commonly give rise to PIWI-interacting RNAs. J. Virol. 2019, 93, e02124-18. [Google Scholar] [CrossRef]
- Filippova, N.A. Ixodid Ticks of Subfamily Ixodinae // Fauna SSSR Paukoobraznye; Nauka: Leningrad, Russia, 1977. [Google Scholar]
- Filippova, N.A. Ixodid Ticks of Subfamily Ambyomminae // Fauna of Russia and Neighbouring Countries. Arachnoidea; Nauka: Saint Petersburg, Russia, 1997. [Google Scholar]
- Makenov, M.; Karan, L.; Shashina, N.; Akhmetshina, M.; Zhurenkova, O.; Kholodilov, I.; Karganova, G.; Smirnova, N.; Grigoreva, Y.; Yankovskaya, Y.; et al. First detection of tick-borne encephalitis virus in Ixodes ricinus ticks and their rodent hosts in Moscow, Russia. Ticks Tick. Borne Dis. 2019, 10, 101265. [Google Scholar] [CrossRef]
- Kovalev, S.Y.; Golovljova, I.V.; Mukhacheva, T.A. Natural hybridization between Ixodes ricinus and Ixodes persulcatus ticks evidenced by molecular genetics methods. Ticks Tick. Borne Dis. 2016, 7, 113–118. [Google Scholar] [CrossRef]
- Scherer, R. PropCIs: Various Confidence Interval Methods for Proportions. R Package Version 0.2-5. Available online: https://cran.r-project.org/package=PropCIs (accessed on 26 August 2022).
- Cowling, D.W.; Gardner, I.A.; Johnson, W.O. Comparison of methods for estimation of individual-level prevalence based on pooled samples. Prev. Vet. Med. 1999, 39, 211–225. [Google Scholar] [CrossRef]
- Sergeant, E. Epitools Epidemiological Calculators. Available online: http://epitools.ausvet.com.au (accessed on 26 August 2022).
- Williams, C.J.; Moffitt, C.M. A Critique of methods of sampling and reporting pathogens in populations of fish. J. Aquat. Anim. Health 2001, 13, 300–309. [Google Scholar] [CrossRef]
- Castresana, J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 2000, 17, 540–552. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Tavaré, S. Some probabilistic and statistical problems in the analysis of dna sequences. In Lectures on Mathematics in the Life Sciences; American Mathematical Society: Washington, DC, USA, 1986; pp. 57–86. [Google Scholar]
- Tamura, K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol. Biol. Evol. 1992, 9, 678–687. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Stanojević, M.; Li, K.; Stamenković, G.; Ilić, B.; Paunović, M.; Pešić, B.; Maslovara, I.Ð.; Šiljić, M.; Ćirković, V.; Zhang, Y. Depicting the RNA virome of hematophagous arthropods from Belgrade, Serbia. Viruses 2020, 12, 975. [Google Scholar] [CrossRef]
- Estrada-Peña, A.; Pfäffle, M.P.; Petney, T.N. Genus Ixodes Latreille, 1795. In Ticks of Europe and North Africa. A Guide to Species Identification; Springer: Berlin/Heidelberg, Germany, 2017; pp. 79–83. [Google Scholar]
- Bell-Sakyi, L.; Zweygarth, E.; Blouin, E.F.; Gould, E.A.; Jongejan, F. Tick cell lines: Tools for tick and tick-borne disease research. Trends Parasitol. 2007, 23, 450–457. [Google Scholar] [CrossRef]
- Charrier, N.P.; Hermouet, A.; Hervet, C.; Agoulon, A.; Barker, S.C.; Heylen, D.; Toty, C.; McCoy, K.D.; Plantard, O.; Rispe, C. A Transcriptome-based phylogenetic study of hard ticks (Ixodidae). Sci. Rep. 2019, 9, 12923. [Google Scholar] [CrossRef]
- Ladner, J.T.; Wiley, M.R.; Beitzel, B.; Auguste, A.J.; Dupuis, A.P.; Lindquist, M.E.; Sibley, S.D.; Kota, K.P.; Fetterer, D.; Eastwood, G.; et al. A Multicomponent animal virus isolated from mosquitoes. Cell Host Microbe 2016, 20, 357–367. [Google Scholar] [CrossRef] [PubMed]
- Aiewsakun, P.; Katzourakis, A. Endogenous Viruses: Connecting recent and ancient viral evolution. Virology 2015, 479–480, 26–37. [Google Scholar] [CrossRef] [PubMed]
- Goic, B.; Stapleford, K.A.; Frangeul, L.; Doucet, A.J.; Gausson, V.; Blanc, H.; Schemmel-Jofre, N.; Cristofari, G.; Lambrechts, L.; Vignuzzi, M.; et al. Virus-derived DNA drives mosquito vector tolerance to arboviral infection. Nat. Commun. 2016, 7, 1–10. [Google Scholar] [CrossRef]
- Wallau, G.L. RNA virus EVEs in insect genomes. Curr. Opin. Insect Sci. 2022, 49, 42–47. [Google Scholar] [CrossRef]
- Tassetto, M.; Kunitomi, M.; Whitfield, Z.J.; Dolan, P.T.; Sánchez-Vargas, I.; Garcia-Knight, M.; Ribiero, I.; Chen, T.; Olson, K.E.; Andino, R. Control of RNA viruses in mosquito cells through the acquisition of vDNA and endogenous viral elements. eLife 2019, 8, 1–29. [Google Scholar] [CrossRef]
- Petersen, M.; Armisén, D.; Gibbs, R.A.; Hering, L.; Khila, A.; Mayer, G.; Richards, S.; Niehuis, O.; Misof, B. Correction to: Diversity and evolution of the transposable element repertoire in arthropods with particular reference to insects. BMC Ecol. Evol. 2019, 19, 11, Erratum in: BMC Ecol. Evol. 2021, 21, 146. [Google Scholar] [CrossRef]
- Gilbert, C.; Peccoud, J.; Cordaux, R. Transposable elements and the evolution of insects. Annu. Rev. Entomol. 2021, 66, 355–372. [Google Scholar] [CrossRef]
- Whitfield, Z.J.; Dolan, P.T.; Kunitomi, M.; Tassetto, M.; Seetin, M.G.; Oh, S.; Heiner, C.; Paxinos, E.; Andino, R. The diversity, structure, and function of heritable adaptive immunity sequences in the Aedes aegypti genome. Curr. Biol. 2017, 27, 3511–3519.e7. [Google Scholar] [CrossRef]
- Palatini, U.; Miesen, P.; Carballar-Lejarazu, R.; Ometto, L.; Rizzo, E.; Tu, Z.; van Rij, R.P.; Bonizzoni, M. Comparative genomics shows that viral integrations are abundant and express pirnas in the arboviral vectors Aedes aegypti and Aedes albopictus. BMC Genom. 2017, 18, 512. [Google Scholar] [CrossRef] [Green Version]






| Name | Nucleotide Sequence (5′–3′) | Target | Length of the Product, bp | |
|---|---|---|---|---|
| Nested PCR for screening on JMV | ||||
| Yanggou-OUT -F | Multiplex Mix Out | AAC GTG GAA AGG AAG AAT GGA | Jingmenvirus polymerase gene | 425 (first round) | 
| JMTV-OUT-F | AGA GAG GCA GAG AGG AAT GGA | |||
| Alongshan-OUT-F | AAA GRG GGA AGG ARG AGT GGA | |||
| Yanggou-OUT-R | TCT ATC CTT GCG TCT TTC TAC CA | |||
| JMTV-OUT-R | TCT GTC SGC TCT YCG CTC CCG GA | |||
| Alongshan-OUT-R | TCT GTC YTT CCT CCT CTC TGC CA | |||
| JMTV-IN-F | Multiplex Mix In | GAG ACC TTC AAA AGR GAC CA | Jingmenvirus polymerase gene | ~230 (second round) | 
| Alongshan-IN-F | GAG GCC TTC AAG AGG GAC CA | |||
| Alongshan-IN-Rev | TAC ATG ACC GTG TTG GAG AGG CGG T | |||
| JMTV-IN-Rev | TAC ATC ACR GTG TTG GAC AGC CTG T | |||
| Yanggou-IN-Rev | TAC ATA ACT GTG TTC GAG AGT CTT TC | |||
| PCR for sequencing of 509 bp fragment | ||||
| Mos-Seq-F-2380 | TGCTCCCATCAGTACTGGCCT | Jingmenvirus polymerase gene | 509 | |
| Mos-Seq-R-2925 | CGCCACCCCCGCAACCTGGT | |||
| Name | Nucleotide Sequence (5′–3′) | Target | 
|---|---|---|
| qPCR assay for the integrated Jingmenvirus polymerase gene | ||
| IRJPG-NS5 -F | GAGACCTTCAAAAGRGACCA | Jingmenvirus polymerase gene | 
| IRJPG-NS5 -Rev | TACATCACRGTGTTGGACAGCCTGT | |
| IRJPG-NS5-Probe | ROX-TGGCAGGTGAAGACAAACAAGGG-BHQ2 | |
| qPCR assay for the target site * detection | ||
| Ir-3100-F | ACCGGCATCTCGTCAAGACGA | Integration site * | 
| Ir-3100-R | AGATACTGTCTCTGCCACTCGT | |
| Ir-3100-probe | ROX-TCCCTCGACCCCAAGCATCGTGA-BHQ2 | |
| qPCR kit for ITS2 fragment detection | ||
| ITS2_B-TicksRP-F | KACRGAGTTCGTYGGCGCGT | ITS2 | 
| [32] | ||
| ITS2_B-TicksRP-R | TGCAAATCAACGCCACGAGA | |
| [32] | ||
| Probe-Ricin1 | ROX-TTAATGGCGGACGCCGCGTTTCAAACGC-BHQ2 | |
| [32] | ||
| Tick Species | Number of Ticks | Number of Formed Pools | Number of Ticks Per Pool | PCR-Positive Ticks on JMV Number–Prevalence, % (CI95%) | 
|---|---|---|---|---|
| Unpooled samples | ||||
| Ixodes ricinus | 154 | 154 | 1 | 54–35.1 (27.6–43.2) | 
| Dermacentor reticulatus | 171 | 171 | 1 | 0–0 (0.0%) | 
| Pooled samples | ||||
| Ixodes ricinus | 220 | 44 | 5 | 11–27.4 (21.0–34.7) | 
| Ixodes ricinus Larvae | 32 | 2 | 9 and 23 | 1 * | 
| Dermacentor reticulatus | 99 | 33 | 3 | 0–0 (0.0%) | 
| Sample’s ID | qRT-PCR | ||
|---|---|---|---|
| Naïve | After DNase I | After RNase A | |
| I. ricinus-184 | 21.22 | no signal | 23.1 | 
| I. ricinus-723 | 21.94 | no signal | 23.91 | 
| I. ricinus-727 | 22.19 | no signal | 24.35 | 
| I. ricinus-746 | 21.27 | no signal | 23.65 | 
| I. ricinus-32654 | 21.47 | no signal | 23.68 | 
| I. ricinus-32659 | 26.78 | no signal | 29.30 | 
| I. ricinus-22684 | 19.16 | no signal | 21.37 | 
| I. ricinus-22687 | 29.68 | no signal | 31.72 | 
| I. ricinus-22689 | 27.73 | no signal | 29.94 | 
| I. ricinus-17433 | 22.54 | no signal | 24.43 | 
| TBEV strain Absettarov | 20.92 | 22.92 | no signal | 
| Region | Number of Ticks | Number of Formed Pools | Number of PCR-Positive on JMV Pools/Prevalence, % (CI95%) * | 
|---|---|---|---|
| Integrated jingmenvirus polymerase gene | |||
| Belgorod region | 97 | 21 | 10/12.8 (6.6–17.6) | 
| Republic of Tatarstan | 70 | 10 | 9/19.5 (9.6–33.6) | 
| Ulyanovsk region | 49 | 14 | 10/36.7 (19.1–59.2) | 
| Republic of Karelia | 72 | 33 | 10/15.3 (8.0–25.3) | 
| Voronezh region | 62 | 16 | 10/25.4 (13.2–42.0) | 
| Kaliningrad region | 102 | 49 | 10/10,1 (5.2–17.0) | 
| Alongshan virus | |||
| Republic of Tatarstan | 70 | 10 | 1/1.5 (0.0–6.6) | 
| Ulyanovsk region | 49 | 14 | 1/2.1 (0.1–9.1) | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morozkin, E.S.; Makenov, M.T.; Zhurenkova, O.B.; Kholodilov, I.S.; Belova, O.A.; Radyuk, E.V.; Fyodorova, M.V.; Grigoreva, Y.E.; Litov, A.G.; Valdokhina, A.V.; et al. Integrated Jingmenvirus Polymerase Gene in Ixodes ricinus Genome. Viruses 2022, 14, 1908. https://doi.org/10.3390/v14091908
Morozkin ES, Makenov MT, Zhurenkova OB, Kholodilov IS, Belova OA, Radyuk EV, Fyodorova MV, Grigoreva YE, Litov AG, Valdokhina AV, et al. Integrated Jingmenvirus Polymerase Gene in Ixodes ricinus Genome. Viruses. 2022; 14(9):1908. https://doi.org/10.3390/v14091908
Chicago/Turabian StyleMorozkin, Evgeny S., Marat T. Makenov, Olga B. Zhurenkova, Ivan S. Kholodilov, Oxana A. Belova, Ekaterina V. Radyuk, Marina V. Fyodorova, Yana E. Grigoreva, Alexander G. Litov, Anna V. Valdokhina, and et al. 2022. "Integrated Jingmenvirus Polymerase Gene in Ixodes ricinus Genome" Viruses 14, no. 9: 1908. https://doi.org/10.3390/v14091908
APA StyleMorozkin, E. S., Makenov, M. T., Zhurenkova, O. B., Kholodilov, I. S., Belova, O. A., Radyuk, E. V., Fyodorova, M. V., Grigoreva, Y. E., Litov, A. G., Valdokhina, A. V., Bulanenko, V. P., Samoilov, A. E., Korneenko, E. V., Voizekhovskaya, Y. A., Neverov, A. D., Karganova, G. G., & Karan, L. S. (2022). Integrated Jingmenvirus Polymerase Gene in Ixodes ricinus Genome. Viruses, 14(9), 1908. https://doi.org/10.3390/v14091908
 
        



 
       