Matrix Metalloproteinases Expression Is Associated with SARS-CoV-2-Induced Lung Pathology and Extracellular-Matrix Remodeling in K18-hACE2 Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines and Viruses
2.2. Animal Experiments
2.3. RT-PCR and Quantitative PCR Analysis
2.4. Collagen Concentration in the BALF-Sircol Assay
2.5. H&E Staining and Tissue/Air-Space Ratio Calculation
2.6. Immunofluorescence Staining
2.7. Statistics
3. Results
3.1. Evaluation of Lung Infection with SARS-CoV-2 in K18-hACE2 Mouse Model
3.2. Characterization of Alveoli Epithelial Damage following SARS-CoV-2 Infection
3.3. MMPs Expression Levels in the Lungs of SARS-CoV-2-Infected K-18 Mice
3.4. Pulmonary ECM Integrity after SARS-CoV-2 Infection
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Wu, C.; Chen, X.; Cai, Y.; Xia, J.; Zhou, X.; Xu, S.; Huang, H.; Zhang, L.; Zhou, X.; Du, C.; et al. Risk Factors Associated with Acute Respiratory Distress Syndrome and Death in Patients with Coronavirus Disease 2019 Pneumonia in Wuhan, China. JAMA Intern. Med. 2020, 180, 934–943. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Tan, C.; Wu, J.; Chen, M.; Wang, Z.; Luo, L.; Zhou, X.; Liu, X.; Huang, X.; Yuan, S.; et al. Impact of coronavirus disease 2019 on pulmonary function in early convalescence phase. Respir. Res. 2020, 21, 163. [Google Scholar] [CrossRef]
- Rai, D.K.; Sharma, P.; Kumar, R. Post COVID-19 pulmonary fibrosis. Is it real threat? Indian J. Tuberc. 2021, 68, 330–333. [Google Scholar] [CrossRef] [PubMed]
- Zuo, Y.; Yalavarthi, S.; Shi, H.; Gockman, K.; Zuo, M.; Madison, M.A.; Blair, C.; Weber, A.; Barnes, B.J.; Egeblad, M. Neutrophil extracellular traps in COVID-19. JCI Insight 2020, 5, e138999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davey, A.; McAuley, D.F.; O’Kane, C.M. Matrix metalloproteinases in acute lung injury: Mediators of injury and drivers of repair. Eur. Respir. J. 2011, 38, 959–970. [Google Scholar] [CrossRef] [Green Version]
- Elkington, P.; Shiomi, T.; Breen, R.; Nuttall, R.K.; Ugarte-Gil, C.A.; Walker, N.F.; Saraiva, L.; Pedersen, B.; Mauri, F.; Lipman, M.; et al. MMP-1 drives immunopathology in human tuberculosis and transgenic mice. J. Clin. Investig. 2011, 121, 1827–1833. [Google Scholar] [CrossRef]
- Greenlee, K.J.; Werb, Z.; Kheradmand, F. Matrix metalloproteinases in lung: Multiple, multifarious, and multifaceted. Physiol. Rev. 2007, 87, 69–98. [Google Scholar] [CrossRef]
- Malik, M.; Bakshi, C.S.; McCabe, K.; Catlett, S.V.; Shah, A.; Singh, R.; Jackson, P.L.; Gaggar, A.; Metzger, D.W.; Melendez, J.A.; et al. Matrix metalloproteinase 9 activity enhances host susceptibility to pulmonary infection with type A and B strains of Francisella tularensis. J. Immunol. 2007, 178, 1013–1020. [Google Scholar] [CrossRef] [Green Version]
- Vagima, Y.; Levy, Y.; Gur, D.; Tidhar, A.; Aftalion, M.; Abramovich, H.; Zahavy, E.; Zauberman, A.; Flashner, Y.; Shafferman, A.; et al. Early sensing of Yersinia pestis airway infection by bone marrow cells. Front. Cell Infect. Microbiol. 2012, 2, 143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vagima, Y.; Zauberman, A.; Levy, Y.; Gur, D.; Tidhar, A.; Aftalion, M.; Shafferman, A.; Mamroud, E. Circumventing Y. pestis Virulence by Early Recruitment of Neutrophils to the Lungs during Pneumonic Plague. PLoS Pathog. 2015, 11, e1004893. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vandenbroucke, R.E.; Libert, C. Is there new hope for therapeutic matrix metalloproteinase inhibition? Nat. Rev. Drug Discov. 2014, 13, 904–927. [Google Scholar] [CrossRef] [PubMed]
- Winkler, E.S.; Bailey, A.L.; Kafai, N.M.; Nair, S.; McCune, B.T.; Yu, J.; Fox, J.M.; Chen, R.E.; Earnest, J.T.; Keeler, S.P.; et al. SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function. Nat. Immunol. 2020, 21, 1327–1335. [Google Scholar] [CrossRef]
- Yinda, C.K.; Port, J.R.; Bushmaker, T.; Owusu, I.O.; Purushotham, J.N.; Avanzato, V.A.; Fischer, R.J.; Schulz, J.E.; Holbrook, M.G.; Hebner, M.J.; et al. K18-hACE2 mice develop respiratory disease resembling severe COVID-19. PLoS Pathog. 2021, 17, e1009195. [Google Scholar] [CrossRef] [PubMed]
- Elia, U.; Rotem, S.; Bar-Haim, E.; Ramishetti, S.; Naidu, G.S.; Gur, D.; Aftalion, M.; Israeli, M.; Bercovich-Kinori, A.; Alcalay, R.; et al. Lipid Nanoparticle RBD-hFc mRNA Vaccine Protects hACE2 Transgenic Mice against a Lethal SARS-CoV-2 Infection. Nano Lett. 2021, 21, 4774–4779. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Americo, J.L.; Cotter, C.A.; Earl, P.L.; Erez, N.; Peng, C.; Moss, B. One or two injections of MVA-vectored vaccine shields hACE2 transgenic mice from SARS-CoV-2 upper and lower respiratory tract infection. Proc. Natl. Acad. Sci. USA 2021, 118, e2026785118. [Google Scholar] [CrossRef] [PubMed]
- Rosenfeld, R.; Noy-Porat, T.; Mechaly, A.; Makdasi, E.; Levy, Y.; Alcalay, R.; Falach, R.; Aftalion, M.; Epstein, E.; Gur, D.; et al. Post-exposure protection of SARS-CoV-2 lethal infected K18-hACE2 transgenic mice by neutralizing human monoclonal antibody. Nat. Commun. 2021, 12, 944. [Google Scholar] [CrossRef]
- Yahalom-Ronen, Y.; Tamir, H.; Melamed, S.; Politi, B.; Shifman, O.; Achdout, H.; Vitner, E.B.; Israeli, O.; Milrot, E.; Stein, D.; et al. A single dose of recombinant VSV-G-spike vaccine provides protection against SARS-CoV-2 challenge. Nat. Commun. 2020, 11, 6402. [Google Scholar] [CrossRef]
- Zhang, L.; Narayanan, K.K.; Cooper, L.; Chan, K.K.; Devlin, C.A.; Aguhob, A.; Shirley, K.; Rong, L.; Rehman, J.; Malik, A.B.; et al. An engineered ACE2 decoy receptor can be administered by inhalation and potently targets the BA.1 and BA.2 omicron variants of SARS-CoV-2. bioRxiv 2022. [Google Scholar] [CrossRef]
- Dampalla, C.S.; Zheng, J.; Perera, K.D.; Wong, L.R.; Meyerholz, D.K.; Nguyen, H.N.; Kashipathy, M.M.; Battaile, K.P.; Lovell, S.; Kim, Y.; et al. Postinfection treatment with a protease inhibitor increases survival of mice with a fatal SARS-CoV-2 infection. Proc. Natl. Acad. Sci. USA 2021, 118, e2101555118. [Google Scholar] [CrossRef]
- Berg, S.; Kutra, D.; Kroeger, T.; Straehle, C.N.; Kausler, B.X.; Haubold, C.; Schiegg, M.; Ales, J.; Beier, T.; Rudy, M.; et al. ilastik: Interactive machine learning for (bio)image analysis. Nat. Methods 2019, 16, 1226–1232. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jansing, N.L.; McClendon, J.; Henson, P.M.; Tuder, R.M.; Hyde, D.M.; Zemans, R.L. Unbiased Quantitation of Alveolar Type II to Alveolar Type I Cell Transdifferentiation during Repair after Lung Injury in Mice. Am. J. Respir. Cell Mol. Biol. 2017, 57, 519–526. [Google Scholar] [CrossRef] [PubMed]
- Hou, Y.J.; Okuda, K.; Edwards, C.E.; Martinez, D.R.; Asakura, T.; Dinnon, K.H.; Kato, T.; Lee, R.E.; Yount, B.L.; Mascenik, T.M.; et al. SARS-CoV-2 Reverse Genetics Reveals a Variable Infection Gradient in the Respiratory Tract. Cell 2020, 182, 429–446.e414. [Google Scholar] [CrossRef] [PubMed]
- Ziegler, C.G.K.; Allon, S.J.; Nyquist, S.K.; Mbano, I.M.; Miao, V.N.; Tzouanas, C.N.; Cao, Y.; Yousif, A.S.; Bals, J.; Hauser, B.M.; et al. SARS-CoV-2 Receptor ACE2 Is an Interferon-Stimulated Gene in Human Airway Epithelial Cells and Is Detected in Specific Cell Subsets across Tissues. Cell 2020, 181, 1016–1035.e1019. [Google Scholar] [CrossRef]
- Vagima, Y.; Gur, D.; Erez, N.; Achdout, H.; Aftalion, M.; Levy, Y.; Zauberman, A.; Tidhar, A.; Gutman, H.; Lazar, S.; et al. Influenza virus infection augments susceptibility to respiratory Yersinia pestis exposure and impacts the efficacy of antiplague antibiotic treatments. Sci. Rep. 2020, 10, 19116. [Google Scholar] [CrossRef]
- Supasorn, O.; Sringkarin, N.; Srimanote, P.; Angkasekwinai, P. Matrix metalloproteinases contribute to the regulation of chemokine expression and pulmonary inflammation in Cryptococcus infection. Clin. Exp. Immunol. 2016, 183, 431–440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Talmi-Frank, D.; Altboum, Z.; Solomonov, I.; Udi, Y.; Jaitin, D.A.; Klepfish, M.; David, E.; Zhuravlev, A.; Keren-Shaul, H.; Winter, D.R.; et al. Extracellular Matrix Proteolysis by MT1-MMP Contributes to Influenza-Related Tissue Damage and Mortality. Cell Host Microbe 2016, 20, 458–470. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.; Wang, L.; Zimmerman, M.D.; Chen, K.Y.; Huang, L.; Fu, D.J.; Kaya, F.; Rakhilin, N.; Nazarova, E.V.; Bu, P.; et al. Matrix metalloproteinase inhibitors enhance the efficacy of frontline drugs against Mycobacterium tuberculosis. PLoS Pathog. 2018, 14, e1006974. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elkington, P.T.; O’Kane, C.M.; Friedland, J.S. The paradox of matrix metalloproteinases in infectious disease. Clin. Exp. Immunol. 2005, 142, 12–20. [Google Scholar] [CrossRef]
- Theocharis, A.D.; Manou, D.; Karamanos, N.K. The extracellular matrix as a multitasking player in disease. FEBS J. 2019, 286, 2830–2869. [Google Scholar] [CrossRef] [Green Version]
- Moreau, G.B.; Burgess, S.L.; Sturek, J.M.; Donlan, A.N.; Petri, W.A.; Mann, B.J. Evaluation of K18-hACE2 Mice as a Model of SARS-CoV-2 Infection. Am. J. Trop. Med. Hyg. 2020, 103, 1215–1219. [Google Scholar] [CrossRef] [PubMed]
- Tian, S.; Xiong, Y.; Liu, H.; Niu, L.; Guo, J.; Liao, M.; Xiao, S.Y. Pathological study of the 2019 novel coronavirus disease (COVID-19) through postmortem core biopsies. Mod. Pathol. 2020, 33, 1007–1014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rojas-Quintero, J.; Wang, X.; Tipper, J.; Burkett, P.R.; Zuñiga, J.; Ashtekar, A.R.; Polverino, F.; Rout, A.; Yambayev, I.; Hernández, C.; et al. Matrix metalloproteinase-9 deficiency protects mice from severe influenza A viral infection. JCI Insight 2018, 3, e99022. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, S.; Ishii, M.; Namkoong, H.; Hegab, A.E.; Asami, T.; Yagi, K.; Sasaki, M.; Haraguchi, M.; Sato, M.; Kameyama, N.; et al. Pneumococcal Infection Aggravates Elastase-Induced Emphysema via Matrix Metalloproteinase 12 overexpression. J. Infect. Dis. 2016, 213, 1018–1030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cohen, J. From mice to monkeys, animals studied for coronavirus answers. Science 2020, 368, 221–222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- MelaMed, S.; Politi, B.; Grauer, E.; Achdout, H.; Aftalion, M.; Gur, D.; Tamir, H.; Yahalom-Ronen, Y.; Maimon, S.; Yitzhak, E.; et al. Monitoring Group Activity of Hamsters and Mice as a Novel Tool to Evaluate COVID-19 Progression, Convalescence, and rVSV-DeltaG-Spike Vaccination Efficacy. Front. Bioeng. Biotechnol. 2021, 9, 737627. [Google Scholar] [CrossRef]
- Imai, M.; Iwatsuki-Horimoto, K.; Hatta, M.; Loeber, S.; Halfmann, P.J.; Nakajima, N.; Watanabe, T.; Ujie, M.; Takahashi, K.; Ito, M.; et al. Syrian hamsters as a small animal model for SARS-CoV-2 infection and countermeasure development. Proc. Natl. Acad. Sci. USA 2020, 117, 16587–16595. [Google Scholar] [CrossRef]
- Nasr El-Din, A.; Ata, K.A.E.; Abdel-Gawad, A.R.; Fahmy, N.F. Impact of High Serum Levels of MMP-7, MMP-9, TGF-beta and PDGF Macrophage Activation Markers on Severity of COVID-19 in Obese-Diabetic Patients. Infect. Drug Resist. 2021, 14, 4015–4025. [Google Scholar] [CrossRef]
- Syed, F.; Li, W.; Relich, R.F.; Russell, P.M.; Zhang, S.; Zimmerman, M.K.; Yu, Q. Excessive Matrix Metalloproteinase-1 and Hyperactivation of Endothelial Cells Occurred in COVID-19 Patients and Were Associated with the Severity of COVID-19. J. Infect Dis. 2021, 224, 60–69. [Google Scholar] [CrossRef]
- Avila-Mesquita, C.D.; Couto, A.E.S.; Campos, L.C.B.; Vasconcelos, T.F.; Michelon-Barbosa, J.; Corsi, C.A.C.; Mestriner, F.; Petroski-Moraes, B.C.; Garbellini-Diab, M.J.; Couto, D.M.S.; et al. MMP-2 and MMP-9 levels in plasma are altered and associated with mortality in COVID-19 patients. BioMed Pharmacother. 2021, 142, 112067. [Google Scholar] [CrossRef]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [Green Version]
- Leng, L.; Cao, R.; Ma, J.; Mou, D.; Zhu, Y.; Li, W.; Lv, L.; Gao, D.; Zhang, S.; Gong, F.; et al. Pathological featuRes. of COVID-19-associated lung injury: A preliminary proteomics report based on clinical samples. Signal Transduct. Target. Ther. 2020, 5, 240. [Google Scholar] [CrossRef] [PubMed]




| Mouse Gene | Forward 5′-3′ | Reverse 5′-3′ |
|---|---|---|
| MMP2 NM_008610 | ACCATGCGGAAGCCAAGAT | TTAAGGCCCGAGCAAAAGC |
| MMP3 NM_010809 | CTTCCCAGGTTCGCCAAAAT | CATGTTCTCCAACTGCAAAGGA |
| MMP7 NM_010810 | GGTGAGGACGCAGGAGTGAA | GCGTGTTCCTCTTTCCATATAACTTC |
| MMP8 NM_008611 | CACACACAGCTTGCCAATGC | TCCCAGTCTCTGCTAAGCTGAAG |
| MMP9 NM_013599 | CAGACGTGGGTCGATTCC | TCATCGATCATGTCTCGC |
| MMP12 NM_008605 | TGAGGCAGAAACGTGGACTAAA | GGGCTCCATAGAGGGACTGAA |
| MMP14 NM_008608 | CCCAAAAACCCCGCCTAT | TCTGTGTCCATCCACTGGTAAAA |
| HPRT-1 NM_013556 | AGTACAGCCCCAAAATGG | TCCTTTTCACCAGCAAGCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gutman, H.; Aftalion, M.; Melamed, S.; Politi, B.; Nevo, R.; Havusha-Laufer, S.; Achdout, H.; Gur, D.; Israely, T.; Dachir, S.; et al. Matrix Metalloproteinases Expression Is Associated with SARS-CoV-2-Induced Lung Pathology and Extracellular-Matrix Remodeling in K18-hACE2 Mice. Viruses 2022, 14, 1627. https://doi.org/10.3390/v14081627
Gutman H, Aftalion M, Melamed S, Politi B, Nevo R, Havusha-Laufer S, Achdout H, Gur D, Israely T, Dachir S, et al. Matrix Metalloproteinases Expression Is Associated with SARS-CoV-2-Induced Lung Pathology and Extracellular-Matrix Remodeling in K18-hACE2 Mice. Viruses. 2022; 14(8):1627. https://doi.org/10.3390/v14081627
Chicago/Turabian StyleGutman, Hila, Moshe Aftalion, Sharon Melamed, Boaz Politi, Reinat Nevo, Sapir Havusha-Laufer, Hagit Achdout, David Gur, Tomer Israely, Shlomit Dachir, and et al. 2022. "Matrix Metalloproteinases Expression Is Associated with SARS-CoV-2-Induced Lung Pathology and Extracellular-Matrix Remodeling in K18-hACE2 Mice" Viruses 14, no. 8: 1627. https://doi.org/10.3390/v14081627
APA StyleGutman, H., Aftalion, M., Melamed, S., Politi, B., Nevo, R., Havusha-Laufer, S., Achdout, H., Gur, D., Israely, T., Dachir, S., Mamroud, E., Sagi, I., & Vagima, Y. (2022). Matrix Metalloproteinases Expression Is Associated with SARS-CoV-2-Induced Lung Pathology and Extracellular-Matrix Remodeling in K18-hACE2 Mice. Viruses, 14(8), 1627. https://doi.org/10.3390/v14081627

