The Antifungal Itraconazole Is a Potent Inhibitor of Chikungunya Virus Replication
Abstract
1. Introduction
2. Methods
2.1. Cells, Virus, and Compounds
2.2. Construction of Rep-GLuc-nsP-CHIKV-99659
2.3. Full-Length PCR and In Vitro Transcription
2.4. Cell Transfection and Development of the BHK-21-GLuc-nsP-CHIKV-99659 Cell Line
2.5. Stability Analysis of BHK-21-GLuc-nsP-CHIKV-99659
2.6. Validation of Replicon-Based Assays Using Suramin
2.7. Replicon-Based High-Throughput Screening of MMV/DNDi Libraries
2.8. Viral Infection Assays with CHIKV-Nanoluc
3. Results
3.1. Development, Characterization, and Validation of a CHIKV GLuc Replicon Cell Line
3.2. Identification of ITZ, GSK-983, Rubitecan, and MMV676270 as Inhibitors of CHIKV Replicon Replication
3.3. ITZ Strongly Inhibits CHIKV Infection In Vitro
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khongwichit, S.; Chansaenroj, J.; Chirathaworn, C.; Poovorawan, Y. Chikungunya virus infection: Molecular biology, clinical characteristics, and epidemiology in Asian countries. J. Biomed. Sci. 2021, 28, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Silva, L.A.; Dermody, T.S. Chikungunya virus: Epidemiology, replication, disease mechanisms, and prospective intervention strategies. J. Clin. Investig. 2017, 127, 737–749. [Google Scholar] [CrossRef]
- Suhrbier, A. Rheumatic manifestations of chikungunya: Emerging concepts and interventions. Nat. Rev. Rheumatol. 2019, 15, 597–611. [Google Scholar] [CrossRef]
- Schuffenecker, I.; Iteman, I.; Michault, A.; Murri, S.; Frangeul, L.; Vaney, M.-C.; Lavenir, R.; Pardigon, N.; Reynes, J.-M.; Pettinelli, F.; et al. Genome Microevolution of Chikungunya Viruses Causing the Indian Ocean Outbreak. PLoS Med. 2006, 3, 1058–1070. [Google Scholar] [CrossRef] [PubMed]
- Panning, M.; Grywna, K.; van Esbroeck, M.; Emmerich, P.; Drosten, C. Chikungunya Fever in Travelers Returning to Europe from the Indian Ocean Region, 2006. Emerg. Infect. Dis. 2008, 14, 416. [Google Scholar] [CrossRef] [PubMed]
- Wahid, B.; Ali, A.; Rafique, S.; Idrees, M. Global expansion of chikungunya virus: Mapping the 64-year history. Int. J. Infect. Dis. 2017, 58, 69–76. [Google Scholar] [CrossRef]
- Faria, N.R.; Lourenço, J.; de Cerqueira, E.M.; de Lima, M.M.; Pybus, O.; Alcantara, L.C.J. Epidemiology of Chikungunya Virus in Bahia, Brazil, 2014-2015. PLoS Curr. 2016, 8. [Google Scholar] [CrossRef]
- Silva, J.V.J., Jr.; Ludwig-Begall, L.F.; de Oliveira-Filho, E.F.; Oliveira, R.A.S.; Durães-Carvalho, R.; Lopes, T.R.R.; Silva, D.E.A.; Gil, L.H.V.G. A scoping review of Chikungunya virus infection: Epidemiology, clinical characteristics, viral co-circulation complications, and control. Acta Trop. 2018, 188, 213. [Google Scholar] [CrossRef]
- Hucke, F.I.L.; Bugert, J.J. Current and Promising Antivirals Against Chikungunya Virus. Front. Public Health 2020, 8, 916. [Google Scholar] [CrossRef]
- Kendall, C.; Khalid, H.; Müller, M.; Banda, D.H.; Kohl, A.; Merits, A.; Stonehouse, N.J.; Tuplin, A. Structural and phenotypic analysis of Chikungunya virus RNA replication elements. Nucleic Acids Res. 2019, 47, 9296–9312. [Google Scholar] [CrossRef]
- Burt, F.J.; Chen, W.; Miner, J.J.; Lenschow, D.J.; Merits, A.; Schnettler, E.; Kohl, A.; Rudd, P.A.; Taylor, A.; Herrero, L.J.; et al. Chikungunya virus: An update on the biology and pathogenesis of this emerging pathogen. Lancet Infect. Dis. 2017, 17, e107–e117. [Google Scholar] [CrossRef]
- Fernandes, R.S.; Freire, M.C.L.C.; Bueno, R.V.; Godoy, A.S.; Gil, L.H.V.G.; Oliva, G. Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses. Viruses 2020, 12, 598. [Google Scholar] [CrossRef] [PubMed]
- Hannemann, H. Viral replicons as valuable tools for drug discovery. Drug Discov. Today 2020, 25, 1026–1033. [Google Scholar] [CrossRef]
- Pohjala, L.; Utt, A.; Varjak, M.; Lulla, A.; Merits, A. Inhibitors of Alphavirus Entry and Replication Identified with a Stable Chikungunya Replicon Cell Line and Virus-Based Assays. PLoS ONE 2011, 6, 28923. [Google Scholar] [CrossRef] [PubMed]
- Lani, R.; Hassandarvish, P.; Chiam, C.W.; Moghaddam, E.; Chu, J.J.H.; Rausalu, K.; Merits, A.; Higgs, S.; Vanlandingham, D.; Abu Bakar, S.; et al. Antiviral activity of silymarin against chikungunya virus. Sci. Rep. 2015, 5, 1–10. [Google Scholar] [CrossRef]
- Varghese, F.S.; Kaukinen, P.; Gläsker, S.; Bespalov, M.; Hanski, L.; Wennerberg, K.; Kümmerer, B.M.; Ahola, T. Discovery of berberine, abamectin and ivermectin as antivirals against chikungunya and other alphaviruses. Antivir. Res. 2016, 126, 117–124. [Google Scholar] [CrossRef]
- Wichit, S.; Hamel, R.; Bernard, E.; Talignani, L.; Diop, F.; Ferraris, P.; Liegeois, F.; Ekchariyawat, P.; Luplertlop, N.; Surasombatpattana, P.; et al. Imipramine Inhibits Chikungunya Virus Replication in Human Skin Fibroblasts through Interference with Intracellular Cholesterol Trafficking. Sci. Rep. 2017, 7, 3145. [Google Scholar] [CrossRef] [PubMed]
- Fros, J.J.; Liu, W.J.; Prow, N.A.; Geertsema, C.; Ligtenberg, M.; Vanlandingham, D.L.; Schnettler, E.; Vlak, J.M.; Suhrbier, A.; Khromykh, A.A.; et al. Chikungunya virus nonstructural protein 2 inhibits type I/II interferon-stimulated JAK-STAT signaling. J. Virol. 2010, 84, 10877–10887. [Google Scholar] [CrossRef]
- Albulescu, I.C.; White-Scholten, L.; Tas, A.; Hoornweg, T.E.; Ferla, S.; Kovacikova, K.; Smit, J.M.; Brancale, A.; Snijder, E.J.; van Hemert, M.J. Suramin Inhibits Chikungunya Virus Replication by Interacting with Virions and Blocking the Early Steps of Infection. Viruses 2020, 12, 314. [Google Scholar] [CrossRef]
- Varghese, F.S.; Thaa, B.; Amrun, S.N.; Simarmata, D.; Rausalu, K.; Nyman, T.A.; Merits, A.; McInerney, G.M.; Ng, L.F.P.; Ahola, T. The Antiviral Alkaloid Berberine Reduces Chikungunya Virus-Induced Mitogen-Activated Protein Kinase Signaling. J. Virol. 2016, 90, 9743. [Google Scholar] [CrossRef]
- Samby, K.; Besson, D.; Dutta, A.; Patra, B.; Doy, A.; Glossop, P.; Mills, J.; Whitlock, G.; Hooft van Huijsduijnen, R.; Monaco, A.; et al. The Pandemic Response Box─Accelerating Drug Discovery Efforts after Disease Outbreaks. ACS Infect. Dis. 2022, 8, 713–720. [Google Scholar] [CrossRef] [PubMed]
- Coelho, R.A.; Joffe, L.S.; Alves, G.M.; Figueiredo-Carvalho, M.H.G.; Brito-Santos, F.; Amaral, A.C.F.; Rodrigues, M.L.; Almeida-Paes, R. A screening of the MMV Pathogen Box® reveals new potential antifungal drugs against the etiologic agents of chromoblastomycosis. PLoS ONE 2020, 15, e0229630. [Google Scholar] [CrossRef] [PubMed]
- Choi, R.; Zhou, M.; Shek, R.; Wilson, J.W.; Tillery, L.; Craig, J.K.; Salukhe, I.A.; Hickson, S.E.; Kumar, N.; James, R.M.; et al. High-throughput screening of the ReFRAME, Pandemic Box, and COVID Box drug repurposing libraries against SARS-CoV-2 nsp15 endoribonuclease to identify small-molecule inhibitors of viral activity. PLoS ONE 2021, 16, e0250019. [Google Scholar] [CrossRef] [PubMed]
- Matkovic, R.; Bernard, E.; Fontanel, S.; Eldin, P.; Chazal, N.; Hassan Hersi, D.; Merits, A.; Péloponèse, J.-M.; Briant, L. The Host DHX9 DExH-Box Helicase Is Recruited to Chikungunya Virus Replication Complexes for Optimal Genomic RNA Translation. J. Virol. 2019, 93, e01764-18. [Google Scholar] [CrossRef]
- De Oliveira, D.M.; de Andrade Santos, I.; Martins, D.O.S.; Gonçalves, Y.G.; Cardoso-Sousa, L.; Sabino-Silva, R.; Von Poelhsitz, G.; de Faria Franca, E.; Nicolau-Junior, N.; Pacca, C.C. Organometallic complex strongly impairs chikungunya virus entry to the host cells. Front. Microbiol. 2020, 11, 608924. [Google Scholar] [CrossRef]
- Santos, I.A.; Shimizu, J.F.; de Oliveira, D.M.; Martins, D.O.S.; Cardoso-Sousa, L.; Cintra, A.C.O.; Aquino, V.H.; Sampaio, S.V.; Nicolau-Junior, N.; Sabino-Silva, R.; et al. Chikungunya virus entry is strongly inhibited by phospholipase A2 isolated from the venom of Crotalus durissus terrificus. Sci. Rep. 2021, 11, 1–12. [Google Scholar] [CrossRef]
- Finley, R.L.; Brent, R. Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators. Proc. Natl. Acad. Sci. USA. 1994, 91, 12980. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Russel, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001. [Google Scholar]
- Silva, J.V.J.; Arenhart, S.; Santos, H.F.; Almeida-Queiroz, S.R.; Silva, A.N.M.R.; Trevisol, I.M.; Bertani, G.R.; Gil, L.H.V.G. Efficient assembly of full-length infectious clone of Brazilian IBDV isolate by homologous recombination in yeast. Braz. J. Microbiol. 2014, 45, 1555–1563. [Google Scholar] [CrossRef][Green Version]
- Fernandes, R.S.; de Godoy, A.S.; dos Santos, I.A.; Noske, G.D.; de Oliveira, K.I.Z.; Gawriljuk, V.O.; Gomes Jardim, A.C.; Oliva, G. Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening. Virus Res. 2021, 299, 198388. [Google Scholar] [CrossRef]
- Albulescu, I.C.; van Hoolwerff, M.; Wolters, L.A.; Bottaro, E.; Nastruzzi, C.; Yang, S.C.; Tsay, S.-C.; Hwu, J.R.; Snijder, E.J.; van Hemert, M.J. Suramin inhibits chikungunya virus replication through multiple mechanisms. Antivir. Res. 2015, 121, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Santos, J.J.S.; Magalhães, T.; Silva Junior, J.V.J.; Rangel Da Silva, A.N.M.; Cordeiro, M.T.; Gil, L.H.V.G. Full-length infectious clone of a low passage dengue virus serotype 2 from Brazil. Mem. Inst. Oswaldo Cruz. Rio Jan. 2015, 110, 677–683. [Google Scholar] [CrossRef] [PubMed]
- Kassar, T.C.; Magalhães, T.; Júnior, J.V.J.S.; Carvalho, A.G.O.; Da Silva, A.N.M.R.; Queiroz, S.R.A.; Bertani, G.R.; Gil, L.H.V.G.; Vega, L.H.; Gil, G. Construction and characterization of a recombinant yellow fever virus stably expressing Gaussia luciferase. An. Acad. Bras. CiencAnnals Braz. Acad. Sci. 2017, 89, 2119–2130. [Google Scholar] [CrossRef] [PubMed]
- Arenhart, S.; Silva, J.V.J.; Flores, E.F.; Weiblen, R.; Gil, L.H.V.G. Use of homologous recombination in yeast to create chimeric bovine viral diarrhea virus cDNA clones. Braz. J. Microbiol. 2016, 47, 993–999. [Google Scholar] [CrossRef][Green Version]
- Clark, J.W. Rubitecan. Expert Opin. Investig. Drugs 2006, 15, 71–79. [Google Scholar] [CrossRef]
- Hung, C.L.; Doniger, J.; Palini, A.; Snyder, S.W.; Radonovich, M.F.; Brady, J.N.; Pantazis, P.; Reza Sadaie, M. 9-Nitrocamptothecin inhibits HIV-1 replication in human peripheral blood lymphocytes: A potential alternative for HIV-infection/AIDS therapy. J. Med. Virol. 2001, 64, 238–244. [Google Scholar] [CrossRef] [PubMed]
- Deans, R.M.; Morgens, D.W.; Ökesli, A.; Pillay, S.; Horlbeck, M.A.; Kampmann, M.; Gilbert, L.A.; Li, A.; Mateo, R.; Smith, M.; et al. Parallel shRNA and CRISPR-Cas9 screens enable antiviral drug target identification. Nat. Chem. Biol. 2016, 12, 361. [Google Scholar] [CrossRef]
- Battisti, V.; Urban, E.; Langer, T. Antivirals against the Chikungunya Virus. Viruses 2021, 13, 1307. [Google Scholar] [CrossRef] [PubMed]
- Puig-Basagoiti, F.; Deas, T.S.; Ren, P.; Tilgner, M.; Ferguson, D.M.; Shi, P.-Y. High-throughput assays using a luciferase-expressing replicon, virus-like particles, and full-length virus for West Nile virus drug discovery. Antimicrob. Agents Chemother. 2005, 49, 4980–4988. [Google Scholar] [CrossRef] [PubMed]
- Lo, M.K.; Tilgner, M.; Shi, P. Potential High-Throughput Assay for Screening Inhibitors of West Nile Virus Replication. J. Virol. 2003, 77, 12901–12906. [Google Scholar] [CrossRef] [PubMed]
- Hardin, T.C.; Graybill, J.R.; Fetchick, R.; Woestenborghs, R.; Rinaldi, M.G.; Kuhn, J.G. Pharmacokinetics of itraconazole following oral administration to normal volunteers. Antimicrob. Agents Chemother. 1988, 32, 1310. [Google Scholar] [CrossRef] [PubMed]
- Pushpakom, S.; Iorio, F.; Eyers, P.A.; Escott, K.J.; Hopper, S.; Wells, A.; Doig, A.; Guilliams, T.; Latimer, J.; McNamee, C.; et al. Drug repurposing: Progress, challenges and recommendations. Nat. Rev. Drug Discov. 2018, 18, 41–58. [Google Scholar] [CrossRef] [PubMed]
- Gao, Q.; Yuan, S.; Zhang, C.; Wang, Y.; Wang, Y.; He, G.; Zhang, S.; Altmeyer, R.; Zou, G. Discovery of itraconazole with broad-spectrum in vitro antienterovirus activity that targets nonstructural protein 3A. Antimicrob. Agents Chemother. 2015, 59, 2654–2665. [Google Scholar] [CrossRef]
- Lee, J.S.; Choi, H.J.; Song, J.H.; Ko, H.J.; Yoon, K.; Seong, J.M. Antiviral Activity of Itraconazole against Echovirus 30 Infection In Vitro. Osong Public Health Res. Perspect. 2017, 8, 318. [Google Scholar] [CrossRef] [PubMed]
- Van Damme, E.; De Meyer, S.; Bojkova, D.; Ciesek, S.; Cinatl, J.; De Jonghe, S.; Jochmans, D.; Leyssen, P.; Buyck, C.; Neyts, J.; et al. In vitro activity of itraconazole against SARS-CoV-2. J. Med. Virol. 2021, 93, 4454–4460. [Google Scholar] [CrossRef] [PubMed]
- Meutiawati, F.; Bezemer, B.; Strating, J.R.P.M.; Overheul, G.J.; Žusinaite, E.; van Kuppeveld, F.J.M.; van Cleef, K.W.R.; van Rij, R.P. Posaconazole inhibits dengue virus replication by targeting oxysterol-binding protein. Antivir. Res. 2018, 157, 68–79. [Google Scholar] [CrossRef]
- Strating, J.R.P.M.; van der Linden, L.; Albulescu, L.; Bigay, J.; Arita, M.; Delang, L.; Leyssen, P.; van der Schaar, H.M.; Lanke, K.H.W.; Thibaut, H.J.; et al. Itraconazole inhibits enterovirus replication by targeting the oxysterol-binding protein. Cell Rep. 2015, 10, 600–615. [Google Scholar] [CrossRef]
- Varghese, F.S.; Meutiawati, F.; Teppor, M.; Jacobs, S.; de Keyzer, C.; Taşköprü, E.; van Woudenbergh, E.; Overheul, G.J.; Bouma, E.; Smit, J.M.; et al. Posaconazole inhibits multiple steps of the alphavirus replication cycle. Antivir. Res. 2022, 197, 105223. [Google Scholar] [CrossRef]




| Oligonucleotide | Sequence (5′-3′) | Amplicon |
|---|---|---|
| pBSC-BamHI-T7Phi2.5- 5′CHIKV-F a | b,cCAAGCATGTAAATATCGTTTGAGTTGGATCCCAGTAATACGACTCACTATTATGGCTGCGTGAGACACACGTAG | Fragment 1 (T7 RNA polymerase promoter; CHIKV 5′UTR and nsP1-nsP4) |
| CHIKV-7515R | GCAAAATAGGTAGCTGTAGTGCGTACCTATTTAGGACCGCCGTACAAG | |
| CHIKV1-GLuc-F | dGTACGCACTACAGCTACCTATTTTGCAAAAGCCGACAGCAGGTACCTAAATACCAATCAGCCATAATGGGAGTCAAAGTTCTGTTTGCCCTG | Fragment 2 (CHIKV subgenomic promoter and Gaussia luciferase gene) |
| GLuc-Ubiq-R | CACGAAGATCTGCATGTTTAAACCGTCACCACCGGCCCCCTTGATC | |
| Ubiq-F | GGTTTAAACATGCAGATCTTCGTGAAG | Fragment 3 (Ubiquitination sequence and neomycin phosphotransferase gene) |
| CHIKV1-Neo-R | CTTTAGGGACGCGTATGCCTTCATACCTAGTTGTCAAGTCAGAAGAACTCGTCAAGAAGGCGATAG | |
| CHIKV-3UTR-F | CTTGACAACTAGGTATGAAGGCATAC | Fragment 4 (CHIKV 3′UTR) |
| pBSC-SpeI-3′CHIKV-R | ATATGCATAGTACCGAGAAACTAGAACTAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAATATTAAAAACAAAATAACATCTCC |
| Compound | GLuc Inhibition | Cell Viability |
|---|---|---|
| Voriconazole | 13.9% | 91.8% |
| Econazole | 43.8% | 81.8% |
| Tioconazole | 54.8% | 68.4% |
| Clotrimazole | 70.7% | 70.2% |
| Ketoconazole | 0% | 100% |
| Fluconazole | 0% | 94.3% |
| Posaconazole | 11.8% | 100% |
| Ravuconazole | 25.4% | 100% |
| Isavuconazole | 28.6% | 100% |
| Miconazole | 27.8% | 100% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Policastro, L.R.; Dolci, I.; Godoy, A.S.; Silva Júnior, J.V.J.; Ruiz, U.E.A.; Santos, I.A.; Jardim, A.C.G.; Samby, K.; Burrows, J.N.; Wells, T.N.C.; et al. The Antifungal Itraconazole Is a Potent Inhibitor of Chikungunya Virus Replication. Viruses 2022, 14, 1351. https://doi.org/10.3390/v14071351
Policastro LR, Dolci I, Godoy AS, Silva Júnior JVJ, Ruiz UEA, Santos IA, Jardim ACG, Samby K, Burrows JN, Wells TNC, et al. The Antifungal Itraconazole Is a Potent Inhibitor of Chikungunya Virus Replication. Viruses. 2022; 14(7):1351. https://doi.org/10.3390/v14071351
Chicago/Turabian StylePolicastro, Lucca R., Isabela Dolci, Andre S. Godoy, José V. J. Silva Júnior, Uriel E. A. Ruiz, Igor A. Santos, Ana C. G. Jardim, Kirandeep Samby, Jeremy N. Burrows, Timothy N. C. Wells, and et al. 2022. "The Antifungal Itraconazole Is a Potent Inhibitor of Chikungunya Virus Replication" Viruses 14, no. 7: 1351. https://doi.org/10.3390/v14071351
APA StylePolicastro, L. R., Dolci, I., Godoy, A. S., Silva Júnior, J. V. J., Ruiz, U. E. A., Santos, I. A., Jardim, A. C. G., Samby, K., Burrows, J. N., Wells, T. N. C., Gil, L. H. V. G., Oliva, G., & Fernandes, R. S. (2022). The Antifungal Itraconazole Is a Potent Inhibitor of Chikungunya Virus Replication. Viruses, 14(7), 1351. https://doi.org/10.3390/v14071351

