Infectious Aerosol Capture Mask as Environmental Control to Reduce Spread of Respiratory Viral Particles
Abstract
:1. Introduction
2. Materials and Methods
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention CDC Science Brief: SARS-CoV-2 and Potential Airborne Transmission. Available online: https://www.cdc.gov/coronavirus/2019-ncov/science/science-briefs/sars-cov-2-transmission.html (accessed on 6 October 2021).
- Sommerstein, R.; Fux, C.A.; Vuichard-Gysin, D.; Abbas, M.; Marschall, J.; Balmelli, C.; Troillet, N.; Harbarth, S.; Schlegel, M.; Widmer, A.; et al. Risk of SARS-CoV-2 Transmission by Aerosols, the Rational Use of Masks, and Protection of Healthcare Workers from COVID-19. Antimicrob. Resist. Infect. Control 2020, 9, 100. [Google Scholar] [CrossRef] [PubMed]
- Ryu, B.H.; Cho, Y.; Cho, O.H.; Hong, S.I.; Kim, S.; Lee, S. Environmental Contamination of SARS-CoV-2 during the COVID-19 Outbreak in South Korea. Am. J. Infect. Control. 2020, 48, 875–879. [Google Scholar] [CrossRef]
- Chia, P.Y.; Coleman, K.K.; Tan, Y.K.; Ong, S.W.X.; Gum, M.; Lau, S.K.; Lim, X.F.; Lim, A.S.; Sutjipto, S.; Lee, P.H.; et al. Detection of Air and Surface Contamination by SARS-CoV-2 in Hospital Rooms of Infected Patients. Nat. Commun. 2020, 11, 2800. [Google Scholar] [CrossRef] [PubMed]
- Birgand, G.; Peiffer-Smadja, N.; Fournier, S.; Kerneis, S.; Lescure, F.X.; Lucet, J.C. Assessment of Air Contamination by SARS-CoV-2 in Hospital Settings. JAMA Netw. Open 2020, 3, e2033232. [Google Scholar] [CrossRef]
- Delikhoon, M.; Guzman, M.I.; Nabizadeh, R.; Baghani, A.N. Modes of Transmission of Severe Acute Respiratory Syndrome-Coronavirus-2 (Sars-CoV-2) and Factors Influencing on the Airborne Transmission: A Review. Int. J. Environ. Res. Public Health 2021, 18, 395. [Google Scholar] [CrossRef] [PubMed]
- Infection Control: Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)|CDC. Available online: https://www.cdc.gov/coronavirus/2019-ncov/hcp/infection-control.html (accessed on 6 October 2021).
- Chan, V.W.M.; So, S.Y.C.; Chen, J.H.K.; Yip, C.C.Y.; Chan, K.H.; Chu, H.; Chung, T.W.H.; Sridhar, S.; To, K.K.W.; Chan, J.F.W.; et al. Air and Environmental Sampling for SARS-CoV-2 around Hospitalized Patients with Coronavirus Disease 2019 (COVID-19). Infect. Control. Hosp. Epidemiol. 2020, 41, 1258–1265. [Google Scholar] [CrossRef]
- Park, S.Y.; Kim, Y.M.; Yi, S.; Lee, S.; Na, B.J.; Kim, C.B.; Kim, J.I.; Kim, H.S.; Kim, Y.B.; Park, Y.; et al. Coronavirus Disease Outbreak in Call Center, South Korea. Emerg. Infect. Dis. 2020, 26, 1666–1670. [Google Scholar] [CrossRef]
- Liu, Y.; Ning, Z.; Chen, Y.; Guo, M.; Liu, Y.; Gali, N.K.; Sun, L.; Duan, Y.; Cai, J.; Westerdahl, D.; et al. Aerodynamic Analysis of SARS-CoV-2 in Two Wuhan Hospitals. Nature 2020, 582, 557–560. [Google Scholar] [CrossRef]
- Song, Z.G.; Chen, Y.M.; Wu, F.; Xu, L.; Wang, B.F.; Shi, L.; Chen, X.; Dai, F.H.; She, J.L.; Chen, J.M.; et al. Identifying the Risk of SARS-CoV-2 Infection and Environmental Monitoring in Airborne Infectious Isolation Rooms (AIIRs). Virol. Sin. 2020, 35, 785–792. [Google Scholar] [CrossRef]
- Santarpia, J.L.; Rivera, D.N.; Herrera, V.L.; Morwitzer, M.J.; Creager, H.M.; Santarpia, G.W.; Crown, K.K.; Brett-Major, D.M.; Schnaubelt, E.R.; Broadhurst, M.J.; et al. Aerosol and Surface Contamination of SARS-CoV-2 Observed in Quarantine and Isolation Care. Sci. Rep. 2020, 10, 12732. [Google Scholar] [CrossRef]
- Santarpia, J.L.; Herrera, V.L.; Rivera, D.N.; Ratnesar-Shumate, S.; Reid, S.P.; Ackerman, D.N.; Denton, P.W.; Martens, J.W.S.; Fang, Y.; Conoan, N.; et al. The Size and Culturability of Patient-Generated SARS-CoV-2 Aerosol. J. Expo. Sci. Environ. Epidemiol. 2021. [Google Scholar] [CrossRef] [PubMed]
- Almstrand, A.C.; Bake, B.; Ljungström, E.; Larsson, P.; Bredberg, A.; Mirgorodskaya, E.; Olin, A.C. Effect of Airway Opening on Production of Exhaled Particles. J. Appl. Physiol. 2010, 108, 584–588. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Li, Y. Airborne Spread of Infectious Agents in the Indoor Environment. Am. J. Infect. Control 2016, 44, S102–S108. [Google Scholar] [CrossRef]
- Ijaz, M.K.; Zargar, B.; Wright, K.E.; Rubino, J.R.; Sattar, S.A. Generic Aspects of the Airborne Spread of Human Pathogens Indoors and Emerging Air Decontamination Technologies. Am. J. Infect. Control. 2016, 44, S109–S120. [Google Scholar] [CrossRef]
- Miller, S.L.; Mukherjee, D.; Wilson, J.; Clements, N.; Steiner, C. Implementing a Negative Pressure Isolation Space within a Skilled Nursing Facility to Control SARS-CoV-2 Transmission. Am. J. Infect. Control. 2021, 49, 438–446. [Google Scholar] [CrossRef] [PubMed]
- Phua, J.; Weng, L.; Ling, L.; Egi, M.; Lim, C.M.; Divatia, J.V.; Shrestha, B.R.; Arabi, Y.M.; Ng, J.; Gomersall, C.D.; et al. Intensive Care Management of Coronavirus Disease 2019 (COVID-19): Challenges and Recommendations. Lancet Respir. Med. 2020, 8, 506–517. [Google Scholar] [CrossRef]
- CDC. Interim Infection Prevention and Control Recommendations for Healthcare Personnel During the Coronavirus Disease 2019 (COVID-19) Pandemic. CDC 2020, 2. Available online: https://www.cdc.gov/coronavirus/2019-ncov/hcp/infection-control-recommendations.html (accessed on 6 October 2021).
- Milton, D.K.; Fabian, M.P.; Cowling, B.J.; Grantham, M.L.; McDevitt, J.J. Influenza Virus Aerosols in Human Exhaled Breath: Particle Size, Culturability, and Effect of Surgical Masks. PLoS Pathog. 2013, 9, e1003205. [Google Scholar] [CrossRef]
- Leung, N.H.L.; Chu, D.K.W.; Shiu, E.Y.C.; Chan, K.H.; McDevitt, J.J.; Hau, B.J.P.; Yen, H.L.; Li, Y.; Ip, D.K.M.; Peiris, J.S.M.; et al. Respiratory Virus Shedding in Exhaled Breath and Efficacy of Face Masks. Nat. Med. 2020, 26, 676–680. [Google Scholar] [CrossRef]
- Kinahan, S.M.; Silcott, D.B.; Silcott, B.E.; Silcott, R.M.; Silcott, P.J.; Silcott, B.J.; Distelhorst, S.L.; Herrera, V.L.; Rivera, D.N.; CrownID, K.K.; et al. Aerosol Tracer Testing in Boeing 767 and 777 Aircraft to Simulate Exposure Potential of Infectious Aerosol Such as SARS-CoV-2. PLoS ONE 2021, 16, e0246916. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.W.; Nicolle, A.D.; Klettner, C.A.; Pantelic, J.; Wang, L.; Suhaimi, A.B.; Tan, A.Y.L.; Ong, G.W.X.; Su, R.; Sekhar, C.; et al. Airflow Dynamics of Human Jets: Sneezing and Breathing—Potential Sources of Infectious Aerosols. PLoS ONE 2013, 8, e59970. [Google Scholar] [CrossRef]
- Kwon, S.B.; Park, J.; Jang, J.; Cho, Y.; Park, D.S.; Kim, C.; Bae, G.N.; Jang, A. Study on the Initial Velocity Distribution of Exhaled Air from Coughing and Speaking. Chemosphere 2012, 87, 1260–1264. [Google Scholar] [CrossRef] [PubMed]
- Lednicky, J.A.; Lauzardo, M.; Alam, M.M.; Elbadry, M.A.; Stephenson, C.J.; Gibson, J.C.; Morris, J.G. Isolation of SARS-CoV-2 from the Air in a Car Driven by a COVID Patient with Mild Illness. Int. J. Infect. Dis. 2021, 108, 212–216. [Google Scholar] [CrossRef] [PubMed]
- Nishiura, H.; Ito, K.; Anzai, A.; Kobayashi, T.; Piantham, C.; Rodríguez-Morales, A.J. Relative Reproduction Number of SARS-CoV-2 Omicron (B.1.1.529) Compared with Delta Variant in South Africa. J. Clin. Med. 2021, 11, 30. [Google Scholar] [CrossRef]
- Pressroom Schedule Executive Orders Legislation About Contact. 2022. Available online: https://www.governor.ny.gov/news/governor-hochul-updates-new-yorkers-states-progress-combating-covid-19-131 (accessed on 6 October 2021).
- Burki, T.K. Omicron Variant and Booster COVID-19 Vaccines. Lancet Respir. Med. 2021, 10, e17. [Google Scholar] [CrossRef]
- Ma, J.; Qi, X.; Chen, H.; Li, X.; Zhang, Z.; Wang, H.; Sun, L.; Zhang, L.; Guo, J.; Morawska, L.; et al. Coronavirus Disease 2019 Patients in Earlier Stages Exhaled Millions of Severe Acute Respiratory Syndrome Coronavirus 2 Per Hour. Clin. Infect. Dis. 2021, 72, e652–e654. [Google Scholar] [CrossRef]
Oligo Sequence | Forward Primer | Reverse Primer | Probe | Exponential Fit | R2 |
---|---|---|---|---|---|
ttgttaaacctgtgaccacctgctaatcgtgcaaccttaccattcaggccgtgcgccgagcttacatgggcaattcaagtgtttgaggctcgggggcagg | CCT GTG ACC ACC TGC TAA TC | CCG AGC CTC AAA CAC TTG AA | TG CAA CCT T A CCA TTC AGG CCG T | Beads/mL = 9 × 108 e−0.649(Ct) | 0.9998 |
Sample | Mean Ct | Mean Concentration (beads/L of Air) | Stand. Dev. | Reuction Compared to No Flow | |
---|---|---|---|---|---|
28.3 Lpm | Run 1 Sample 1 | 32.43 | 0.14 | 0.03 | 0.999 |
Run 1 Sample 2 | 33.38 | 0.09 | 0.04 | ||
Run 2 Sample 1 | 32.56 | 0.13 | 0.02 | ||
Run 2 Sample 2 | 30.89 | 0.30 | 0.09 | ||
14.2 Lpm | Run 1 Sample 1 | 33.32 | 0.09 | 0.00 | 0.998 |
Run 1 Sample 2 | 34.28 | 0.06 | 0.00 | ||
Run 2 Sample 1 | 31.00 | 0.41 | 0.46 | ||
Run 2 Sample 2 | 30.97 | 0.43 | 0.50 | ||
0 Lpm | Run 1 Sample 1 | 18.71 | 101.13 | 14.46 | |
Run 1 Sample 1 | 19.20 | 79.44 | 3.07 | ||
Run 1 Sample 2 | 18.39 | 117.72 | 14.09 | ||
Run 2 Sample 1 | 17.12 | 215.44 | 3.92 |
Particles Collected on Filter | ||||||
Simulated Activity | 0.1 µm | 0.5 µm | 1 µm | 5 µm | 10 µm | 20 µm |
Mouth Breathing | 100% | 100% | 100% | 100% | 100% | 99% |
Speaking | 32% | 29% | 29% | 29% | 25% | 16% |
Coughing | 12% | 11% | 11% | 12% | 14% | 8% |
Particles Collected on Mask or Face | ||||||
Mouth Breathing | 0% | 0% | 0% | 0% | 0% | 1% |
Speaking | 68% | 71% | 71% | 71% | 75% | 84% |
Coughing | 75% | 82% | 81% | 84% | 84% | 91% |
Particles Escaped | ||||||
Mouth Breathing | 0% | 0% | 0% | 0% | 0% | 0% |
Speaking | 0% | 0% | 0% | 0% | 0% | 0% |
Coughing | 13% | 7% | 8% | 4% | 2% | 1% |
Time Since First Reported Illness | Time Since First Reported Illness | Reported Symptoms | Talking/Coughing | Air Sample Room ePFU/L of Air in 1000 L Collected | Air Sample Room copies/L of Air in 1000 L Collected | Mask Filter ePFU/h | Mask Filter copies/h | Mask Swab ePFU/h | Mask Swab copies/h |
---|---|---|---|---|---|---|---|---|---|
5435 | ~14 days | Respiratory | no O2, Limited talking, Coughing | ND | ND | 3.11 × 10−2 | 4.21 × 104 | 6.57 × 10−3 | 8.87 × 103 |
5425 | ~5 days | GI, taste | no O2, Talking no cough | ND | ND | ND | ND | ND | ND |
5436 | ~7 days | Respiratory | no O2, Talking no cough | ND | ND | ND | ND | 1.29×10−2 | 1.74 × 104 |
5444 | ~12 h | Respiratory | no O2, Talking, 1 cough | ND | ND | 1.68 × 10−1 | 2.27 × 105 | ND | ND |
5436 | ~24 h | Respiratory | 2 L O2, Talking, 33 coughs | Failed | Failed | 1.36 × 10−2 | 1.84 × 104 | ND | ND |
5450 | ~24 h | Respiratory | 6 L O2, little talking | ND | ND | ND | ND | ND | ND |
7442 | ~24 h | Respiratory | 9 L O2, 10 coughs | ND | ND | ND | ND | 3.37 × 10−3 | 4.55 × 103 |
7480 | ~24 h | Respiratory | 5 L O2, 3 coughs | ND | ND | 2.48 × 10−2 | 3.35 × 104 | 7.96 × 10−1 | 1.07 × 106 |
7468 | 15 days | Respiratory | no O2, talking coughing | 1.31 × 10−3 | 8.51 × 10 | NA | NA | NA | NA |
7472 | 10 days | Respiratory | no O2, talking, no coughing | 5.09 × 10−4 | 3.30 × 10 | NA | NA | NA | NA |
5437 | 4 days | Respiratory | no O2, talking, coughing | 1.34 × 10−3 | 8.67 × 10 | NA | NA | NA | NA |
5450 | 3 days | Respiratory | no O2, talking, coughing | 1.27 × 10−3 | 8.25 × 10 | NA | NA | NA | NA |
5425 | 3 days (2 patients) | Respiratory | no O2, no talking, coughing | 2.05 × 10−3 | 1.33 × 102 | NA | NA | NA | NA |
5436 | 7 days | Respiratory | no O2, no talking, coughing | 6.72 × 10−4 | 4.36 × 10 | NA | NA | NA | NA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Santarpia, J.L.; Markin, N.W.; Herrera, V.L.; Ackerman, D.N.; Rivera, D.N.; Lucero, G.A.; Lisco, S.J. Infectious Aerosol Capture Mask as Environmental Control to Reduce Spread of Respiratory Viral Particles. Viruses 2022, 14, 1275. https://doi.org/10.3390/v14061275
Santarpia JL, Markin NW, Herrera VL, Ackerman DN, Rivera DN, Lucero GA, Lisco SJ. Infectious Aerosol Capture Mask as Environmental Control to Reduce Spread of Respiratory Viral Particles. Viruses. 2022; 14(6):1275. https://doi.org/10.3390/v14061275
Chicago/Turabian StyleSantarpia, Joshua L., Nicholas W. Markin, Vicki L. Herrera, Daniel N. Ackerman, Danielle N. Rivera, Gabriel A. Lucero, and Steven J. Lisco. 2022. "Infectious Aerosol Capture Mask as Environmental Control to Reduce Spread of Respiratory Viral Particles" Viruses 14, no. 6: 1275. https://doi.org/10.3390/v14061275
APA StyleSantarpia, J. L., Markin, N. W., Herrera, V. L., Ackerman, D. N., Rivera, D. N., Lucero, G. A., & Lisco, S. J. (2022). Infectious Aerosol Capture Mask as Environmental Control to Reduce Spread of Respiratory Viral Particles. Viruses, 14(6), 1275. https://doi.org/10.3390/v14061275