High Expression of HERV-K (HML-2) Might Stimulate Interferon in COVID-19 Patients
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients and Healthy Donors
2.2. Virus Infection
2.3. Total RNA Extraction
2.4. Reverse Transcription
2.5. Quantitative Reverse Transcription PCR (qRT–PCR)
2.6. Genome-Wide Distribution Map
2.7. Functional Annotation and Classification
2.8. Statistical Analysis
3. Results
3.1. Demographic Characteristics
3.2. SARS-CoV-2 Infection Increased the Expression of HERV-K (HML-2) gag, env, and pol
3.3. SARS-CoV-2 Infection Increased the Expression of Interferon-Related Genes
3.4. Chromosomal Location of Highly Expressed HERV-K (HML-2) gag, env, pol
3.5. Gene Ontology (GO) Classifications
3.6. “Interferon Gamma Signalling” Was Highly Enriched According to KEGG Mapping
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.M.; Wang, W.; Song, Z.G.; Hu, Y.; Tao, Z.W.; Tian, J.H.; Pei, Y.Y.; et al. A new coronavirus associated with human respiratory disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef] [Green Version]
- Jiang, S.; Shi, Z.; Shu, Y.; Song, J.; Gao, G.F.; Tan, W.; Guo, D. A distinct name is needed for the new coronavirus. Lancet 2020, 395, 949. [Google Scholar] [CrossRef]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [Green Version]
- Chen, N.; Zhou, M.; Dong, X.; Qu, J.; Gong, F.; Han, Y.; Qiu, Y.; Wang, J.; Liu, Y.; Wei, Y.; et al. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: A descriptive study. Lancet 2020, 395, 507–513. [Google Scholar] [CrossRef] [Green Version]
- Wang, D.; Hu, B.; Hu, C.; Zhu, F.; Liu, X.; Zhang, J.; Wang, B.; Xiang, H.; Cheng, Z.; Xiong, Y.; et al. Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan, China. JAMA 2020, 323, 1061–1069. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.F.-W.; Yuan, S.; Kok, K.-H.; To, K.K.-W.; Chu, H.; Yang, J.; Xing, F.; Liu, J.; Yip, C.C.-Y.; Poon, R.W.-S.; et al. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: A study of a family cluster. Lancet 2020, 395, 514–523. [Google Scholar] [CrossRef] [Green Version]
- Ksiazek, T.G.; Erdman, D.; Goldsmith, C.S.; Zaki, S.R.; Peret, T.; Emery, S.; Tong, S.; Urbani, C.; Comer, J.A.; Lim, W.; et al. A novel coronavirus associated with severe acute respiratory syndrome. N. Engl. J. Med. 2003, 348, 1953–1966. [Google Scholar] [CrossRef]
- Guery, B.; Poissy, J.; el Mansouf, L.; Séjourné, C.; Ettahar, N.; Lemaire, X.; Vuotto, F.; Goffard, A.; Behillil, S.; Enouf, V.; et al. Clinical features and viral diagnosis of two cases of infection with middle east respiratory syndrome coronavirus: A report of nosocomial transmission. Lancet 2013, 381, 2265–2272. [Google Scholar] [CrossRef] [Green Version]
- Zebin, L.; Qian, F.; Jinlian, M.; Lishi, Z.; Yu, Q.; Tian, C.; Zhenhua, C.; Ping, W.; Bin, L. The nucleocapsid protein of SARS-CoV-2 abolished pluripotency in human induced pluripotent stem cells. SSRN 2020. [Google Scholar] [CrossRef]
- Karki, R.; Sharma, B.R.; Tuladhar, S.; Williams, E.P.; Zalduondo, L.; Samir, P.; Zheng, M.; Sundaram, B.; Banoth, B.; Malireddi, R.K.S.; et al. Synergism of TNF-α and IFN-γ triggers inflammatory cell death, tissue damage, and mortality in SARS-CoV-2 infection and cytokine shock syndromes. Cell 2021, 184, 149–168. [Google Scholar] [CrossRef]
- Liu, H.; Golji, J.; Brodeur, L.K.; Chung, F.S.; Chen, J.T.; de Beaumont, R.S.; Bullock, C.P.; Jones, M.D.; Kerr, G.; Li, L.; et al. Tumor-derived IFN triggers chronic pathway agonism and sensitivity to ADAR loss. Nat. Med. 2019, 25, 95–102. [Google Scholar] [CrossRef] [PubMed]
- Der, S.D.; Zhou, A.; Williams, B.R.; Silverman, R.H. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc. Natl. Acad. Sci. USA 1998, 95, 15623–15628. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Raychoudhuri, A.; Shrivastava, S.; Steele, R.; Kim, H.; Ray, R.; Ray, R.B. ISG56 and IFITM1 proteins inhibit hepatitis C virus replication. J. Virol. 2011, 85, 12881–12889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pichlmair, A.; Lassnig, C.; Eberle, C.-A.; Górna, M.W.; Baumann, C.L.; Burkard, T.R.; Bürckstümmer, T.; Stefanovic, A.; Krieger, S.; Bennett, K.L.; et al. IFIT1 is an antiviral protein that recognizes 5′-triphosphate RNA. Nat. Immunol. 2011, 12, 624–630. [Google Scholar] [CrossRef] [PubMed]
- Trouillet-Assant, S.; Viel, S.; Gaymard, A.; Pons, S.; Richard, J.-C.; Perret, M.; Villard, M.; Brengel-Pesce, K.; Lina, B.; Mezidi, M.; et al. Type I IFN immunoprofiling in COVID-19 patients. J. Allergy Clin. Immunol. 2020, 146, 206–208. [Google Scholar] [CrossRef] [PubMed]
- Acharya, D.; Liu, G.; Gack, M.U. Dysregulation of type I interferon responses in COVID-19. Nat. Rev. Immunol. 2020, 20, 397–398. [Google Scholar] [CrossRef] [PubMed]
- Krämer, B.; Knoll, R.; Bonaguro, L.; ToVinh, M.; Raabe, J.; Astaburuaga-García, R.; Schulte-Schrepping, J.; Kaiser, K.M.; Rieke, G.J.; Bischoff, J.; et al. Early IFN-α signatures and persistent dysfunction are distinguishing features of NK cells in severe COVID-19. Immunity 2021, 54, 2650–2669. [Google Scholar] [CrossRef]
- Guo, Y.; Li, T.; Xia, X.; Su, B.; Li, H.; Feng, Y.; Han, J.; Wang, X.; Jia, L.; Bao, Z.; et al. Different profiles of antibodies and cytokines were found between severe and moderate COVID-19 patients. Front. Immunol. 2021, 12, 723585. [Google Scholar] [CrossRef]
- Lima-Junior, D.S.; Krishnamurthy, S.R.; Bouladoux, N.; Collins, N.; Han, S.-J.; Chen, E.Y.; Constantinides, M.G.; Link, V.M.; Lim, A.I.; Enamorado, M.; et al. Endogenous retroviruses promote homeostatic and inflammatory responses to the microbiota. Cell 2021, 184, 3794–3811. [Google Scholar] [CrossRef]
- Griffiths, D.J. Endogenous retroviruses in the human genome sequence. Genome. Biol. 2001, 2, REVIEWS1017. [Google Scholar] [CrossRef]
- Medstrand, P.; Mager, D.L. Human-specific integrations of the HERV-K endogenous retrovirus family. J. Virol. 1998, 72, 9782–9787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buzdin, A.; Ustyugova, S.; Khodosevich, K.; Mamedov, I.; Lebedev, Y.; Hunsmann, G.; Sverdlov, E. Human-specific subfamilies of HERV-K (HML-2) long terminal repeats: Three master genes were active simultaneously during branching of hominoid lineages. Genomics 2003, 81, 149–156. [Google Scholar] [CrossRef]
- Grow, E.J.; Flynn, R.A.; Chavez, S.L.; Bayless, N.L.; Wossidlo, M.; Wesche, D.J.; Martin, L.; Ware, C.B.; Blish, C.A.; Chang, H.Y.; et al. Intrinsic retroviral reactivation in human preimplantation embryos and pluripotent cells. Nature 2015, 522, 221–225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agoni, L.; Guha, C.; Lenz, J. Detection of human endogenous retrovirus K (HERV-K) transcripts in human prostate cancer cell lines. Front. Oncol. 2013, 3, 180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Argaw-Denboba, A.; Balestrieri, E.; Serafino, A.; Cipriani, C.; Bucci, I.; Sorrentino, R.; Sciamanna, I.; Gambacurta, A.; Sinibaldi-Vallebona, P.; Matteucci, C. HERV-K activation is strictly required to sustain CD133+ melanoma cells with stemness features. J. Exp. Clin. Cancer Res. 2017, 36, 20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, M.; Radvanyi, L.; Yin, B.; Rycaj, K.; Li, J.; Chivukula, R.; Lin, K.; Lu, Y.; Shen, J.; Chang, D.Z.; et al. Downregulation of human endogenous retrovirus type K (HERV-K) viral RNA in pancreatic cancer cells decreases cell proliferation and tumor growth. Clin. Cancer Res. 2017, 23, 5892–5911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia-Montojo, M.; Doucet-O’Hare, T.; Henderson, L.; Nath, A. Human endogenous retrovirus-K (HML-2): A comprehensive review. Crit. Rev. Microbiol. 2018, 44, 715–738. [Google Scholar] [CrossRef]
- Kitsou, K.; Kotanidou, A.; Paraskevis, D.; Karamitros, T.; Katzourakis, A.; Tedder, R.; Hurst, T.; Sapounas, S.; Kotsinas, A.; Gorgoulis, V.; et al. Upregulation of human endogenous retroviruses in bronchoalveolar lavage fluid of COVID-19 patients. Microbiol. Spectr. 2021, 9, e0126021. [Google Scholar] [CrossRef]
- Hao, Z.; Lv, D.; Ge, Y.; Shi, J.; Weijers, D.; Yu, G.; Chen, J. RIdeogram: Drawing SVG graphics to visualize and map genome-wide data on the idiograms. PeerJ Comput. Sci. 2020, 6, e251. [Google Scholar] [CrossRef] [Green Version]
- Xue, B.; Zeng, T.; Jia, L.; Yang, D.; Lin, S.L.; Sechi, L.A.; Kelvin, D.J. Identification of the distribution of human endogenous retroviruses K (HML-2) by PCR-based target enrichment sequencing. Retrovirology 2020, 17, 10. [Google Scholar] [CrossRef]
- Xue, B.; Sechi, L.A.; Kelvin, D.J. Human endogenous retrovirus K (HML-2) in health and disease. Front. Microbiol. 2020, 11, 1690. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Vasaikar, S.; Shi, Z.; Greer, M.; Zhang, B. WebGestalt 2017: A more comprehensive, powerful, flexible and interactive gene set enrichment analysis toolkit. Nucleic Acids Res. 2017, 45, W130–W137. [Google Scholar] [CrossRef] [PubMed]
- Berardini, T.Z.; Mundodi, S.; Reiser, L.; Huala, E.; Garcia-Hernandez, M.; Zhang, P.; Mueller, L.A.; Yoon, J.; Doyle, A.; Lander, G.; et al. Functional annotation of the Arabidopsis genome using controlled vocabularies. Plant Physiol. 2004, 135, 745–755. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanehisa, M.; Goto, S.; Kawashima, S.; Okuno, Y.; Hattori, M. The KEGG resource for deciphering the genome. Nucleic Acids Res. 2004, 32, D277–D280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McNab, F.; Mayer-Barber, K.; Sher, A.; Wack, A.; O’Garra, A. Type I interferons in infectious disease. Nat. Rev. Immunol. 2015, 15, 87–103. [Google Scholar] [CrossRef]
- Sen, G.C. Viruses and interferons. Annu. Rev. Microbiol. 2001, 55, 255–281. [Google Scholar] [CrossRef]
- Busnadiego, I.; Fernbach, S.; Pohl, M.O.; Karakus, U.; Huber, M.; Trkola, A.; Stertz, S.; Hale, B.G. Antiviral activity of type I, II, and III interferons counterbalances ACE2 inducibility and restricts SARS-CoV-2. mBio 2020, 11, e01928-20. [Google Scholar] [CrossRef]
- Chen, Y.; Cai, H.; Pan, J.A.; Xiang, N.; Tien, P.; Ahola, T.; Guo, D. Functional screen reveals SARS coronavirus nonstructural protein nsp14 as a novel cap N7 methyltransferase. Proc. Natl. Acad. Sci. USA 2009, 106, 3484–3489. [Google Scholar] [CrossRef] [Green Version]
- Siu, K.-L.; Kok, K.-H.; Ng, M.-H.J.; Poon, V.K.M.; Yuen, K.-Y.; Zheng, B.-J.; Jin, D.-Y. Severe acute respiratory syndrome coronavirus M protein inhibits type I interferon production by impeding the formation of TRAF3.TANK.TBK1/IKKepsilon complex. J. Biol. Chem. 2009, 284, 16202–16209. [Google Scholar] [CrossRef] [Green Version]
- Wathelet, M.G.; Orr, M.; Frieman, M.B.; Baric, R.S. Severe acute respiratory syndrome coronavirus evades antiviral signaling: Role of nsp1 and rational design of an attenuated strain. J. Virol. 2007, 81, 11620–11633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menachery, V.D.; Yount, B.L.; Josset, L.; Gralinski, L.E.; Scobey, T.; Agnihothram, S.; Katze, M.G.; Baric, R.S. Attenuation and restoration of severe acute respiratory syndrome coronavirus mutant lacking 2′-o-methyltransferase activity. J. Virol. 2014, 88, 4251–4264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xia, H.; Cao, Z.; Xie, X.; Zhang, X.; Chen, J.Y.-C.; Wang, H.; Menachery, V.D.; Rajsbaum, R.; Shi, P.-Y. Evasion of type I interferon by SARS-CoV-2. Cell Rep. 2020, 33, 108234. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.F.-W.; Yao, Y.; Yeung, M.-L.; Deng, W.; Bao, L.; Jia, L.; Li, F.; Xiao, C.; Gao, H.; Yu, P.; et al. Treatment with lopinavir/ritonavir or interferon-β1b improves outcome of MERS-CoV infection in a nonhuman primate model of common marmoset. J. Infect. Dis. 2015, 212, 1904–1913. [Google Scholar] [CrossRef] [PubMed]
- Loutfy, M.R.; Blatt, L.M.; Siminovitch, K.A.; Ward, S.; Wolff, B.; Lho, H.; Pham, D.H.; Deif, H.; LaMere, E.A.; Chang, M.; et al. Interferon alfacon-1 plus corticosteroids in severe acute respiratory syndrome: A preliminary study. JAMA 2003, 290, 3222–3228. [Google Scholar] [CrossRef] [Green Version]
- Mantlo, E.; Bukreyeva, N.; Maruyama, J.; Paessler, S.; Huang, C. Antiviral activities of type I interferons to SARS-CoV-2 infection. Antivir. Res. 2020, 179, 104811. [Google Scholar] [CrossRef]
- Galani, I.E.; Triantafyllia, V.; Eleminiadou, E.-E.; Koltsida, O.; Stavropoulos, A.; Manioudaki, M.; Thanos, D.; Doyle, S.E.; Kotenko, S.V.; Thanopoulou, K.; et al. Interferon-λ mediates non-redundant front-line antiviral protection against Influenza virus infection without compromising host fitness. Immunity 2017, 46, 875–890. [Google Scholar] [CrossRef] [PubMed]
- Channappanavar, R.; Fehr, A.R.; Zheng, J.; Wohlford-Lenane, C.; Abrahante, J.E.; Mack, M.; Sompallae, R.; McCray, P.B.; Meyerholz, D.K.; Perlman, S. IFN-I response timing relative to virus replication determines MERS coronavirus infection outcomes. J. Clin. Investig. 2019, 129, 3625–3639. [Google Scholar] [CrossRef]
- Andreakos, E.; Tsiodras, S. COVID-19: Lambda interferon against viral load and hyperinflammation. EMBO Mol. Med. 2020, 12, e12465. [Google Scholar] [CrossRef]
- Vanderheiden, A.; Ralfs, P.; Chirkova, T.; Upadhyay, A.A.; Zimmerman, M.G.; Bedoya, S.; Aoued, H.; Tharp, G.M.; Pellegrini, K.L.; Manfredi, C.; et al. Type I and type III interferons restrict SARS-CoV-2 infection of human airway epithelial cultures. J. Virol. 2020, 94, e00985. [Google Scholar] [CrossRef]
- Ko, E.-J.; Song, K.S.; Ock, M.S.; Choi, Y.H.; Kim, S.; Kim, H.-S.; Cha, H.-J. Expression profiles of human endogenous retrovirus (HERV)-K and HERV-R Env proteins in various cancers. BMB Rep. 2021, 54, 368–373. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Chen, Y.; Zhang, N.; Fan, D. Human endogenous retrovirus K (HERV-K) env in neuronal extracellular vesicles: A new biomarker of motor neuron disease. Amyotroph. Lateral Scler. Front. Degener. 2022, 23, 1–2. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Beltran, W.F.; Lam, E.C.; Astudillo, M.G.; Yang, D.; Miller, T.E.; Feldman, J.; Hauser, B.M.; Caradonna, T.M.; Clayton, K.L.; Nitido, A.D.; et al. COVID-19-neutralizing antibodies predict disease severity and survival. Cell 2021, 184, 476–488. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Mears, J.R.; Shakib, L.; Beynor, J.I.; Shanaj, S.; Korsunsky, I.; Nathan, A.; Donlin, L.T.; Raychaudhuri, S. IFN-γ and TNF-α drive a CXCL10+ CCL2+ macrophage phenotype expanded in severe COVID-19 lungs and inflammatory diseases with tissue inflammation. Genome. Med. 2021, 13, 64. [Google Scholar] [CrossRef]
- Nile, S.H.; Nile, A.; Qiu, J.; Li, L.; Jia, X.; Kai, G. COVID-19: Pathogenesis, cytokine storm and therapeutic potential of interferons. Cytokine Growth Factor Rev. 2020, 53, 66–70. [Google Scholar] [CrossRef]
- Wang, B.X.; Fish, E.N. Global virus outbreaks: Interferons as 1st responders. Semin. Immunol. 2019, 43, 101300. [Google Scholar] [CrossRef]
- Davoudi-Monfared, E.; Rahmani, H.; Khalili, H.; Hajiabdolbaghi, M.; Salehi, M.; Abbasian, L.; Kazemzadeh, H.; Yekaninejad, M.S. A randomized clinical trial of the efficacy and safety of interferon β-1a in treatment of SEVERE COVID-19. Antimicrob. Agents Chemother. 2020, 64, e01061-20. [Google Scholar] [CrossRef]
- Rabbani, M.A.G.; Ribaudo, M.; Guo, J.-T.; Barik, S. Identification of interferon-stimulated gene proteins that inhibit human parainfluenza virus type 3. J. Virol. 2016, 90, 11145–11156. [Google Scholar] [CrossRef] [Green Version]
- Diamond, M.S.; Farzan, M. The broad-spectrum antiviral functions of IFIT and IFITM proteins. Nat. Rev. Immunol. 2013, 13, 46–57. [Google Scholar] [CrossRef]
- Kiesslich, S.; Kamen, A.A. Vero cell upstream bioprocess development for the production of viral vectors and vaccines. Biotechnol. Adv. 2020, 44, 107608. [Google Scholar] [CrossRef]
- Kiesslich, S.; Kim, G.N.; Shen, C.F.; Kang, C.Y.; Kamen, A.A. Bioreactor production of rVSV-based vectors in Vero cell suspension cultures. Biotechnol. Bioeng. 2021, 118, 2649–2659. [Google Scholar] [CrossRef] [PubMed]
- Fulber, J.P.C.; Farnós, O.; Kiesslich, S.; Yang, Z.; Dash, S.; Susta, L.; Wootton, S.K.; Kamen, A.A. Process development for newcastle disease virus-vectored vaccines in serum-free vero cell suspension cultures. Vaccines 2021, 9, 1335. [Google Scholar] [CrossRef] [PubMed]
- Barrett, P.N.; Mundt, W.; Kistner, O.; Howard, M.K. Vero cell platform in vaccine production: Moving towards cell culture-based viral vaccines. Expert. Rev. Vaccines 2009, 8, 607–618. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, C.; Xue, P.; Zhong, B.; Mao, A.-P.; Ran, Y.; Chen, H.; Wang, Y.-Y.; Yang, F.; Shu, H.-B. ISG56 is a negative-feedback regulator of virus-triggered signaling and cellular antiviral response. Proc. Natl. Acad. Sci. USA 2009, 106, 7945–7950. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Guo, Y.; Li, H.; Huang, X.; Pei, Z.; Wang, X.; Liu, Y.; Jia, L.; Li, T.; Bao, Z.; et al. Infection by diverse HIV-1 subtypes leads to different elevations in HERV-K transcriptional levels in human T cell lines. Front. Microbiol. 2021, 12, 662573. [Google Scholar] [CrossRef]
- Gonzalez-Hernandez, M.J.; Swanson, M.D.; Contreras-Galindo, R.; Cookinham, S.; King, S.R.; Noel, R.J.; Kaplan, M.H.; Markovitz, D.M. Expression of human endogenous retrovirus type K (HML-2) is activated by the Tat protein of HIV-1. J. Virol. 2012, 86, 7790–7805. [Google Scholar] [CrossRef] [Green Version]
- Perl, A.; Fernandez, D.; Telarico, T.; Phillips, P.E. Endogenous retroviral pathogenesis in lupus. Curr. Opin. Rheumatol. 2010, 22, 483–492. [Google Scholar] [CrossRef] [Green Version]
- Sacks, D.; Baxter, B.; Campbell, B.C.V.; Carpenter, J.S.; Cognard, C.; Dippel, D.; Eesa, M.; Fischer, U.; Hausegger, K.; Hirsch, J.A.; et al. Multisociety consensus quality improvement revised consensus statement for endovascular therapy of acute ischemic stroke. Int. J. Stroke 2018, 13, 612–632. [Google Scholar] [CrossRef] [Green Version]
- El-Asmi, F.; McManus, F.P.; Thibault, P.; Chelbi-Alix, M.K. Interferon, restriction factors and SUMO pathways. Cytokine Growth Factor Rev. 2020, 55, 37–47. [Google Scholar] [CrossRef]
- Gilbert, C.; Lefeuvre, C.; Preisser, L.; Pivert, A.; Soleti, R.; Blanchard, S.; Delneste, Y.; Ducancelle, A.; Couez, D.; Jeannin, P. Age-related expression of IFN-λ1 IFN-I and beta-defensins in the nasopharynx of SARS-CoV-2-infected individuals. Front. Immunol. 2021, 12, 750279. [Google Scholar] [CrossRef]
- Pazgier, M.; Hoover, D.M.; Yang, D.; Lu, W.; Lubkowski, J. Human beta-defensins. Cell Mol. Life Sci. 2006, 63, 1294–1313. [Google Scholar] [CrossRef] [PubMed]
- Rezaei, S.D.; Hayward, J.A.; Norden, S.; Pedersen, J.; Mills, J.; Hearps, A.C.; Tachedjian, G. HERV-K gag RNA and protein levels are elevated in malignant regions of the prostate in males with prostate cancer. Viruses 2021, 13, 449. [Google Scholar] [CrossRef] [PubMed]
- Lemaître, C.; Harper, F.; Pierron, G.; Heidmann, T.; Dewannieux, M. The HERV-K human endogenous retrovirus envelope protein antagonizes Tetherin antiviral activity. J. Virol. 2014, 88, 13626–13637. [Google Scholar] [CrossRef] [PubMed] [Green Version]





| Gene Name | Direction | Primer Sequence (5′-3′) |
|---|---|---|
| β-actin-F | Forward | CCACGAAACTACGTTCAACTCC |
| β-actin-R | Reverse | GTGATCTCCTTCTGCATCCTGT |
| HERV-K (HML-2) env-F | Forward | CTGAGGCAATTGCAGGAGTT |
| HERV-K (HML-2) env-R | Reverse | GCTGTCTCTTCGGAGCTGTT |
| HERV-K (HML-2) pol-F | Forward | TCACATGGAAACAGGCAAAA |
| HERV-K (HML-2) pol-R | Reverse | AGGTACATGCGTGACATCCA |
| HERV-K (HML-2) gag-F | Forward | AGCAGGTCAGGTGCCTGTAACATT |
| HERV-K (HML-2) gag-R | Reverse | TGGTGCCGTAGGATTAAGTCTCCT |
| GAPDH-F | Forward | GGCATGGACTGTGGTCATGAG |
| GAPDH-R | Reverse | TGCACCACCAACTGCTTAGC |
| IFNβ-F | Forward | ACGCCGCATTGACCATCTAT |
| IFNβ-R | Reverse | TAGCCAGGAGGTTCTCAACA |
| ISG15-F | Forward | GAGAGGCAGCGAACTCATCT |
| ISG15-R | Reverse | CTTCAGCTCTGACACCGACA |
| IFIT1-F | Forward | TACAGCAACCATGAGTACAA |
| IFIT1-R | Reverse | TCAGGTGTTTCACATAGGC |
| Characteristics | Moderate Patients | Severe Patients | Total |
|---|---|---|---|
| (n = 49) | (n = 23) | (n = 72) | |
| Sex | |||
| Female | 30 | 12 | 42 |
| Male | 19 | 11 | 30 |
| Age, y | |||
| 35–39 | 2 | 1 | 3 |
| 40–49 | 3 | 0 | 3 |
| 50–59 | 10 | 4 | 14 |
| 60–69 | 20 | 13 | 33 |
| 70–79 | 11 | 4 | 15 |
| 80–89 | 3 | 1 | 4 |
| Median (IQR) | 63.6 (58–71) | 64.3 (60.5–69) | 63.8 (58.8–70.2) |
| Days after PCR positivity | |||
| 1–7 | 6 | 3 | 9 |
| 8–14 | 11 | 5 | 16 |
| 15–21 | 2 | 2 | 4 |
| 22–28 | 14 | 4 | 18 |
| 29–35 | 12 | 7 | 19 |
| 36–42 | 3 | 1 | 4 |
| 43–49 | 1 | 1 | 2 |
| Median (IQR) | 22.4 (12–30) | 22.6 (12–32.5) | 22.5 (12–31) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, Y.; Yang, C.; Liu, Y.; Li, T.; Li, H.; Han, J.; Jia, L.; Wang, X.; Zhang, B.; Li, J.; et al. High Expression of HERV-K (HML-2) Might Stimulate Interferon in COVID-19 Patients. Viruses 2022, 14, 996. https://doi.org/10.3390/v14050996
Guo Y, Yang C, Liu Y, Li T, Li H, Han J, Jia L, Wang X, Zhang B, Li J, et al. High Expression of HERV-K (HML-2) Might Stimulate Interferon in COVID-19 Patients. Viruses. 2022; 14(5):996. https://doi.org/10.3390/v14050996
Chicago/Turabian StyleGuo, Yaolin, Caiqin Yang, Yongjian Liu, Tianyi Li, Hanping Li, Jingwan Han, Lei Jia, Xiaolin Wang, Bohan Zhang, Jingyun Li, and et al. 2022. "High Expression of HERV-K (HML-2) Might Stimulate Interferon in COVID-19 Patients" Viruses 14, no. 5: 996. https://doi.org/10.3390/v14050996
APA StyleGuo, Y., Yang, C., Liu, Y., Li, T., Li, H., Han, J., Jia, L., Wang, X., Zhang, B., Li, J., & Li, L. (2022). High Expression of HERV-K (HML-2) Might Stimulate Interferon in COVID-19 Patients. Viruses, 14(5), 996. https://doi.org/10.3390/v14050996

