Porcine Epidemic Diarrhea Virus Infection Induces Autophagosome Formation but Inhibits Autolysosome Formation during Replication
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Virus Infection and Titration
2.3. Plasmid and Antibodies
2.4. Western Blot Analysis
2.5. Quantitative Real-Time PCR
2.6. Confocal Microscopy
2.7. Gene Knockdown by siRNA
2.8. Statistical Analysis
3. Results
3.1. Autophagosome Accumulate in PEDV-Infected Cells
3.2. Induction of Autophagy with Rapamycin Upregulates the Replication of PEDV in Vero Cell
3.3. PEDV Infection Suppresses Autophagic Flux in a Time-Dependent Manner
3.4. PEDV Infection Induced Autophagosome Formation but Suppresses Its Fusion with Lysosome
3.5. PEDV Infection Regulated Autophagy-Related Gene mRNA
3.6. PEDV Infection Controls ATG5, ATG12, and LAMP1 Proteins
3.7. Effect of Knockdown of ATG5 and LAMP1 on PEDV Replication
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Song, D.; Park, B. Porcine epidemic diarrhoea virus: A comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes 2012, 44, 167–175. [Google Scholar] [CrossRef] [PubMed]
- Zimmerman, J.J.; Karriker, L.A.; Ramirez, A.; Schwartz, K.J.; Stevenson, G.W.; Jianqiang, Z. Diseases of Swine; John Wiley & Sons, Inc.: Hoboken, NI, USA, 2019. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Vlasova, A.N.; Kenney, S.P.; Saif, L.J. Emerging and re-emerging coronaviruses in pigs. Curr. Opin. Virol. 2019, 34, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Lee, J.M.; Jung, J.; Kim, I.J.; Hyun, B.H.; Kim, H.I.; Park, C.K.; Oem, J.K.; Kim, Y.H.; Lee, M.H.; et al. Genetic characterization of porcine epidemic diarrhea virus in Korea from 1998 to 2013. Arch. Virol. 2015, 160, 1055–1064. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Lee, C. Outbreak-related porcine epidemic diarrhea virus strains similar to US strains, South Korea, 2013. Emerg. Infect. Dis. 2014, 20, 1223–1226. [Google Scholar] [CrossRef]
- Lin, C.M.; Saif, L.J.; Marthaler, D.; Wang, Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res. 2016, 226, 20–39. [Google Scholar] [CrossRef] [Green Version]
- Wang, K.; Lu, W.; Chen, J.; Xie, S.; Shi, H.; Hsu, H.; Yu, W.; Xu, K.; Bian, C.; Fischer, W.B.; et al. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Lett. 2012, 586, 384–391. [Google Scholar] [CrossRef] [Green Version]
- He, C.; Klionsky, D.J. Regulation mechanisms and signaling pathways of autophagy. Annu. Rev. Genet. 2009, 43, 67–93. [Google Scholar] [CrossRef] [Green Version]
- Kroemer, G.; Marino, G.; Levine, B. Autophagy and the integrated stress response. Mol. Cell 2010, 40, 280–293. [Google Scholar] [CrossRef] [Green Version]
- Raben, N.; Roberts, A.; Plotz, P.H. Role of autophagy in the pathogenesis of Pompe disease. Acta Myol. 2007, 26, 45–48. [Google Scholar]
- Kim, H.J.; Lee, S.; Jung, J.U. When autophagy meets viruses: A double-edged sword with functions in defense and offense. Semin. Immunopathol. 2010, 32, 323–341. [Google Scholar] [CrossRef] [Green Version]
- Lussignol, M.; Queval, C.; Bernet-Camard, M.F.; Cotte-Laffitte, J.; Beau, I.; Codogno, P.; Esclatine, A. The Herpes Simplex Virus 1 Us11 Protein Inhibits Autophagy through Its Interaction with the Protein Kinase PKR. J. Virol. 2013, 87, 859–871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Orvedahl, A.; Alexander, D.; Talloczy, Z.; Sun, Q.; Wei, Y.; Zhang, W.; Burns, D.; Leib, D.A.; Levine, B. HSV-1 ICP34.5 confers neurovirulence by targeting the Beclin 1 autophagy protein. Cell Host Microbe. 2007, 1, 23–35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Killian, M.S. Dual role of autophagy in HIV-1 replication and pathogenesis. AIDS Res. Ther. 2012, 9, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, S.T.; Schiller, J.J.; Kanjanahaluethai, A.; Baker, S.C.; Oh, J.W.; Lai, M.M. Colocalization and membrane association of murine hepatitis virus gene 1 products and De novo-synthesized viral RNA in infected cells. J. Virol. 1999, 73, 5957–5969. [Google Scholar] [CrossRef] [Green Version]
- Suhy, D.A.; Giddings, T.H., Jr.; Kirkegaard, K. Remodeling the endoplasmic reticulum by poliovirus infection and by individual viral proteins: An autophagy-like origin for virus-induced vesicles. J. Virol. 2000, 74, 8953–8965. [Google Scholar] [CrossRef] [Green Version]
- Hagemeijer, M.C.; Rottier, P.J.; de Haan, C.A. Biogenesis and dynamics of the coronavirus replicative structures. Viruses 2012, 4, 3245–3269. [Google Scholar] [CrossRef] [Green Version]
- Miller, K.; McGrath, M.E.; Hu, Z.; Ariannejad, S.; Weston, S.; Frieman, M.; Jackson, W.T. Coronavirus interactions with the cellular autophagy machinery. Autophagy 2020, 16, 2131–2139. [Google Scholar] [CrossRef]
- Ueno, T.; Komatsu, M. Monitoring Autophagy Flux and Activity: Principles and Applications. Bioessays 2020, 42, e2000122. [Google Scholar] [CrossRef]
- Mizushima, N.; Yoshimori, T.; Ohsumi, Y. The role of Atg proteins in autophagosome formation. Annu. Rev. Cell Dev. Biol. 2011, 27, 107–132. [Google Scholar] [CrossRef]
- Mizushima, N.; Yoshimori, T. How to interpret LC3 immunoblotting. Autophagy 2007, 3, 542–545. [Google Scholar] [CrossRef]
- Komatsu, M.; Waguri, S.; Koike, M.; Sou, Y.S.; Ueno, T.; Hara, T.; Mizushima, N.; Iwata, J.; Ezaki, J.; Murata, S.; et al. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell 2007, 131, 1149–1163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, W.J.; Ye, L.; Huang, W.F.; Guo, L.J.; Xu, Z.G.; Wu, H.L.; Yang, C.; Liu, H.F. p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cell Mol. Biol. Lett. 2016, 21, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoshii, S.R.; Mizushima, N. Monitoring and Measuring Autophagy. Int. J. Mol. Sci. 2017, 18, 1865. [Google Scholar] [CrossRef] [PubMed]
- Huynh, K.K.; Eskelinen, E.L.; Scott, C.C.; Malevanets, A.; Saftig, P.; Grinstein, S. LAMP proteins are required for fusion of lysosomes with phagosomes. EMBO J. 2007, 26, 313–324. [Google Scholar] [CrossRef]
- Eskelinen, E.L. Roles of LAMP-1 and LAMP-2 in lysosome biogenesis and autophagy. Mol. Aspects Med. 2006, 27, 495–502. [Google Scholar] [CrossRef]
- Guo, X.; Zhang, M.; Zhang, X.; Tan, X.; Guo, H.; Zeng, W.; Yan, G.; Memon, A.M.; Li, Z.; Zhu, Y.; et al. Porcine Epidemic Diarrhea Virus Induces Autophagy to Benefit Its Replication. Viruses 2017, 9, 53. [Google Scholar] [CrossRef] [Green Version]
- Lin, H.; Li, B.; Liu, M.; Zhou, H.; He, K.; Fan, H. Nonstructural protein 6 of porcine epidemic diarrhea virus induces autophagy to promote viral replication via the PI3K/Akt/mTOR axis. Vet. Microbiol. 2020, 244, 108684. [Google Scholar] [CrossRef]
- Ko, S.; Gu, M.J.; Kim, C.G.; Kye, Y.C.; Lim, Y.; Lee, J.E.; Park, B.C.; Chu, H.; Han, S.H.; Yun, C.H. Rapamycin-induced autophagy restricts porcine epidemic diarrhea virus infectivity in porcine intestinal epithelial cells. Antivir. Res. 2017, 146, 86–95. [Google Scholar] [CrossRef]
- Park, J.E.; Kang, K.J.; Ryu, J.H.; Park, J.Y.; Jang, H.; Sung, D.J.; Kang, J.G.; Shin, H.J. Porcine epidemic diarrhea vaccine evaluation using a newly isolated strain from Korea. Vet. Microbiol. 2018, 221, 19–26. [Google Scholar] [CrossRef]
- Cruz, D.J.; Shin, H.J. Application of a focus formation assay for detection and titration of porcine epidemic diarrhea virus. J. Virol. Methods 2007, 145, 56–61. [Google Scholar] [CrossRef]
- Mao, J.; Lin, E.; He, L.; Yu, J.; Tan, P.; Zhou, Y. Autophagy and Viral Infection. Adv. Exp. Med. Biol. 2019, 1209, 55–78. [Google Scholar] [CrossRef] [PubMed]
- Yordy, B.; Iwasaki, A. Autophagy in the control and pathogenesis of viral infection. Curr. Opin. Virol. 2011, 1, 196–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reggiori, F.; Monastyrska, I.; Verheije, M.H.; Cali, T.; Ulasli, M.; Bianchi, S.; Bernasconi, R.; de Haan, C.A.; Molinari, M. Coronaviruses Hijack the LC3-I-positive EDEMosomes, ER-derived vesicles exporting short-lived ERAD regulators, for replication. Cell Host Microbe. 2010, 7, 500–508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maier, H.J.; Cottam, E.M.; Stevenson-Leggett, P.; Wilkinson, J.A.; Harte, C.J.; Wileman, T.; Britton, P. Visualizing the autophagy pathway in avian cells and its application to studying infectious bronchitis virus. Autophagy 2013, 9, 496–509. [Google Scholar] [CrossRef]
- Guo, L.; Yu, H.; Gu, W.; Luo, X.; Li, R.; Zhang, J.; Xu, Y.; Yang, L.; Shen, N.; Feng, L.; et al. Autophagy Negatively Regulates Transmissible Gastroenteritis Virus Replication. Sci. Rep. 2016, 6, 23864. [Google Scholar] [CrossRef] [Green Version]
- Kudchodkar, S.B.; Levine, B. Viruses and autophagy. Rev. Med. Virol. 2009, 19, 359–378. [Google Scholar] [CrossRef]
- Walczak, M.; Martens, S. Dissecting the role of the Atg12-Atg5-Atg16 complex during autophagosome formation. Autophagy 2013, 9, 424–425. [Google Scholar] [CrossRef] [Green Version]
Primer | Sequence (5′–3′) |
---|---|
qPEDV M F | CGTACAGGTAAGTCAATTAC |
qPEDV M R | GATGAAGCATTGACTGAA |
qATG5 F | ACCTCTGCAGTGGCTGAGTG |
qATG5 R | TCAATCTGTTGGCTGCGGGA |
qATG12 F | ACTTGTGGCCTCAGAACAGTTG |
qATG12 R | ACCATCACTGCCAAAACACTCA |
qLAMP1 F | GTGACCGTAACGCTCCACGA |
qLAMP1 R | AGCCTTGTCACGTCGTGTT |
qGAPDH F | CCTTCCGTGTCCCCACTGCCAAC |
qGAPDH R | GACGCCTGCTTCACCACCTTCT |
siRNA | Sequence (5′–3′) |
---|---|
ATG5 481 F | GACGUUGGUAACUGACAAATT |
ATG5 481 R | UUUGUCAGUUACCAACGUCTT |
LAMP1 605 F | CAGGGCAGAUAUAGAUAAATT |
LAMP1 605 R | UUUAUCUAUAUCUGCCCUGTT |
scramble F | UUCUCCGAACGUGUCACGUTT |
scramble R | ACGUGACACGUUCGGAGAATT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.-Y.; Ryu, J.; Hong, E.-J.; Shin, H.-J. Porcine Epidemic Diarrhea Virus Infection Induces Autophagosome Formation but Inhibits Autolysosome Formation during Replication. Viruses 2022, 14, 1050. https://doi.org/10.3390/v14051050
Park J-Y, Ryu J, Hong E-J, Shin H-J. Porcine Epidemic Diarrhea Virus Infection Induces Autophagosome Formation but Inhibits Autolysosome Formation during Replication. Viruses. 2022; 14(5):1050. https://doi.org/10.3390/v14051050
Chicago/Turabian StylePark, Jae-Yeon, Jihoon Ryu, Eui-Ju Hong, and Hyun-Jin Shin. 2022. "Porcine Epidemic Diarrhea Virus Infection Induces Autophagosome Formation but Inhibits Autolysosome Formation during Replication" Viruses 14, no. 5: 1050. https://doi.org/10.3390/v14051050