Small RNA Analyses of a Ceratobasidium Isolate Infected with Three Endornaviruses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Isolate
2.2. Virus-Infected and Virus-Free Isogenic Fungal Lines
2.3. Fungal Genome Sequencing and Annotation
2.4. Annotation of the Ceratobasidium Genome Assembly
2.5. RNA Extraction and Small RNA Sequencing
2.6. Differentially Expressed Small RNA
2.7. Conserved miRNAs Screening and Novel milRNA Candidate Analysis
3. Results
3.1. Ceratobasidium Genome Assembly and Annotation
3.2. Small RNA Analysis
3.3. Global Differential Expression of Small RNAs
3.4. Differentially Expressed miRNA-like Small RNAs
3.5. In Silico Target Gene Prediction of Differentially Expressed Ceratobasididum milRNAs
4. Discussion
4.1. Evidence of RNAi Machinery in Ceratobasidium sp.
4.2. Influence of Endornavirus on the Ceratobasidium Small RNA Population
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ong, J.W.; Li, H.; Sivasithamparam, K.; Dixon, K.W.; Jones, M.G.; Wylie, S.J. Novel Endorna-like viruses, including three with two open reading frames, challenge the membership criteria and taxonomy of the Endornaviridae. Virology 2016, 499, 203–211. [Google Scholar] [CrossRef] [PubMed]
- Axtell, M.J. Classification and Comparison of Small RNAs from Plants. Annu. Rev. Plant Biol. 2013, 64, 137–159. [Google Scholar] [CrossRef] [Green Version]
- Chapman, E.J.; Carrington, J. Specialization and evolution of endogenous small RNA pathways. Nat. Rev. Genet. 2007, 8, 884–896. [Google Scholar] [CrossRef] [PubMed]
- Carthew, R.W.; Sontheimer, E.J. Origins and Mechanisms of miRNAs and siRNAs. Cell 2009, 136, 642–655. [Google Scholar] [CrossRef] [Green Version]
- Xie, Z.; Johansen, L.K.; Gustafson, A.M.; Kasschau, K.D.; Lellis, A.D.; Zilberman, D.; Jacobsen, S.E.; Carrington, J.C. Genetic and Functional Diversification of Small RNA Pathways in Plants. PLOS Biol. 2004, 2, e104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Romano, N.; Macino, G. Quelling: Transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Mol. Microbiol. 1992, 6, 3343–3353. [Google Scholar] [CrossRef] [PubMed]
- Kadotani, N.; Nakayashiki, H.; Tosa, Y.; Mayama, S. RNA Silencing in the Phytopathogenic Fungus Magnaporthe oryzae. Mol. Plant-Microbe Interact. 2003, 16, 769–776. [Google Scholar] [CrossRef] [Green Version]
- McDonald, T.; Brown, D.; Keller, N.P.; Hammond, T.M. RNA Silencing of Mycotoxin Production in Aspergillus and Fusarium Species. Mol. Plant-Microbe Interact. 2005, 18, 539–545. [Google Scholar] [CrossRef] [Green Version]
- Bai, Y.; Lan, F.; Yang, W.; Zhang, F.; Yang, K.; Li, Z.; Gao, P.; Wang, S. sRNA profiling in Aspergillus flavus reveals differentially expressed miRNA-like RNAs response to water activity and temperature. Fungal Genet. Biol. 2015, 81, 113–119. [Google Scholar] [CrossRef]
- Weiberg, A.; Wang, M.; Lin, F.-M.; Zhao, H.; Zhang, Z.; Kaloshian, I.; Huang, H.-D.; Jin, H. Fungal Small RNAs Suppress Plant Immunity by Hijacking Host RNA Interference Pathways. Science 2013, 342, 118–123. [Google Scholar] [CrossRef]
- Chen, R.; Jiang, N.; Jiang, Q.; Sun, X.; Wang, Y.; Zhang, H.; Hu, Z. Exploring microRNA-like small RNAs in the filamentous fungus Fusarium oxysporum. PLoS ONE 2014, 9, e104956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.; Gao, Q.; Huang, M.; Liu, Y.; Liu, Z.; Liu, X.; Ma, Z. Characterization of RNA silencing components in the plant pathogenic fungus Fusarium graminearum. Sci. Rep. 2015, 5, srep12500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, J.; Fu, Y.; Xie, J.; Li, B.; Jiang, D.; Li, G.; Cheng, J. Identification of microRNA-like RNAs in a plant pathogenic fungus Sclerotinia sclerotiorum by high-throughput sequencing. Mol. Genet. Genom. 2012, 287, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Kang, K.; Zhong, J.; Jiang, L.; Liu, G.; Gou, C.Y.; Wu, Q.; Wang, Y.; Luo, J.; Gou, D. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing. PLoS ONE 2013, 8, e76288. [Google Scholar] [CrossRef] [PubMed]
- Segers, G.C.; Zhang, X.; Deng, F.; Sun, Q.; Nuss, D.L. Evidence that RNA silencing functions as an antiviral defense mechanism in fungi. Proc. Natl. Acad. Sci. USA 2007, 104, 12902–12906. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, C.; Li, H.; Jones, M.G.K.; Wylie, S.J. Challenges to elucidating how endornaviruses influence fungal hosts: Creating mycovirus-free isogenic fungal lines and testing them. J. Virol. Methods 2019, 274, 113745. [Google Scholar] [CrossRef] [PubMed]
- Smit, A.F.A.; Hubley, R. RepeatModeler Open-1.0. 2008–2015. Available online: http://www.repeatmasker.org (accessed on 1 September 2022).
- Hubley, R.; Finn, R.; Clements, J.; Eddy, S.R.; Jones, T.A.; Bao, W.; Smit, A.F.A.; Wheeler, T.J. The Dfam database of repetitive DNA families. Nucleic Acids Res. 2016, 44, D81–D89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smit, A.F.A.; Hubley, R.; Green, P. RepeatMasker Open-4.0. 1996–2010. Available online: http://www.repeatmasker.org (accessed on 1 September 2022).
- Ter-Hovhannisyan, V.; Lomsadze, A.; Chernoff, Y.O.; Borodovsky, M. Gene prediction in novel fungal genomes using an ab initio algorithm with unsupervised training. Genome Res. 2008, 18, 1979–1990. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bairoch, A.; Apweiler, R. The SWISS-PROT protein sequence data bank and its new supplement TREMBL. Nucleic Acids Res. 1996, 24, 21–25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Slater, G.S.C.; Birney, E. Automated generation of heuristics for biological sequence comparison. BMC Bioinform. 2005, 6, 31. [Google Scholar] [CrossRef]
- Haas, B.J.; Salzberg, S.L.; Zhu, W.; Pertea, M.; Allen, J.E.; Orvis, J.; White, O.; Buell, C.R.; Wortman, J.R. Automated eukaryotic gene structure annotation using EVidenceModeler and the Program to Assemble Spliced Alignments. Genome Biol. 2008, 9, R7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jones, P.; Binns, D.; Chang, H.-Y.; Fraser, M.; Li, W.; McAnulla, C.; McWilliam, H.; Maslen, J.; Mitchell, A.; Nuka, G.; et al. InterProScan 5: Genome-scale protein function classification. Bioinformatics 2014, 30, 1236–1240. [Google Scholar] [CrossRef] [Green Version]
- Lawrence, M.; Huber, W.; Pagès, H.; Aboyoun, P.; Carlson, M.; Gentleman, R.; Morgan, M.; Carey, V.J. Software for Computing and Annotating Genomic Ranges. PLOS Comput. Biol. 2013, 9, e1003118. [Google Scholar] [CrossRef] [PubMed]
- Nawrocki, E.P.; Eddy, S.R. Infernal 1.1: 100-fold faster RNA homology searches. Bioinformatics 2013, 29, 2933–2935. [Google Scholar] [CrossRef] [Green Version]
- Johnson, N.R.; Yeoh, J.M.; Coruh, C.; Axtell, M.J. Improved Placement of Multi-mapping Small RNAs. G3 Genes Genomes Genet. 2016, 6, 2103–2111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [PubMed]
- Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef] [Green Version]
- Supek, F.; Bošnjak, M.; Škunca, N.; Smuc, T. REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms. PLoS ONE 2011, 6, e21800. [Google Scholar] [CrossRef] [Green Version]
- Lax, C.; Tahiri, G.; Patiño-Medina, J.A.; Cánovas-Márquez, J.T.; Pérez-Ruiz, J.A.; Osorio-Concepción, M.; Navarro, E.; Calo, S. The Evolutionary Significance of RNAi in the Fungal Kingdom. Int. J. Mol. Sci. 2020, 21, 9348. [Google Scholar] [CrossRef]
- Hannon, G.J. RNA interference. Nature 2002, 418, 244–251. [Google Scholar] [CrossRef]
- Li, L.; Chang, S.-S.; Liu, Y. RNA interference pathways in filamentous fungi. Cellular and molecular life sciences. CMLS 2010, 67, 3849–3863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, H.C.; Li, L.; Gu, W.; Xue, Z.; Crosthwaite, S.K.; Pertsemlidis, A.; Lewis, Z.A.; Freitag, M.; Selker, E.U.; Mello, C.C.; et al. diverse pathways generate microRNA-like RNAs and dicer-independent small interfering RNAs in fungi. Mol. Cell 2010, 38, 803–814. [Google Scholar] [CrossRef] [Green Version]
- Griffiths-Jones, S.; Saini, H.K.; van Dongen, S.; Enright, A.J. miRBase: Tools for microRNA genomics. Nucleic Acids Res. 2008, 36 (Suppl. S1), D154–D158. [Google Scholar] [CrossRef] [Green Version]
- Nakayashiki, H.; Nguyen, Q.B. RNA interference: Roles in fungal biology. Curr. Opin. Microbiol. 2008, 11, 494–502. [Google Scholar] [CrossRef]
- Bernstein, E.; Caudy, A.A.; Hammond, S.M.; Hannon, G.J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001, 409, 363–366. [Google Scholar] [CrossRef] [PubMed]
- Janus, D.; Hoff, B.; Kück, U. Evidence for Dicer-dependent RNA interference in the industrial penicillin producer Penicillium chrysogenum. Microbiology 2009, 155, 3946–3956. [Google Scholar] [CrossRef] [Green Version]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef] [Green Version]
- Mi, S.; Cai, T.; Hu, Y.; Chen, Y.; Hodges, E.; Ni, F.; Wu, L.; Li, S.; Zhou, H.; Long, C.; et al. Sorting of Small RNAs into Arabidopsis Argonaute Complexes Is Directed by the 5′ Terminal Nucleotide. Cell 2008, 133, 116–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, H.-C.; Chang, S.-S.; Choudhary, S.; Aalto, A.P.; Maiti, M.; Bamford, D.H.; Liu, Y. qiRNA is a new type of small interfering RNA induced by DNA damage. Nature 2009, 459, 274–277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takeda, A.; Iwasaki, S.; Watanabe, T.; Utsumi, M.; Watanabe, Y. The Mechanism Selecting the Guide Strand from Small RNA Duplexes is Different Among Argonaute Proteins. Plant Cell Physiol. 2008, 49, 493–500. [Google Scholar] [CrossRef] [PubMed]
- Ghildiyal, M.; Xu, J.; Seitz, H.; Weng, Z.; Zamore, P.D. Sorting of Drosophila small silencing RNAs partitions microRNA* strands into the RNA interference pathway. RNA 2009, 16, 43–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baulcombe, D. RNA silencing in plants. Nature 2004, 431, 356–363. [Google Scholar] [CrossRef]
- Lau, S.K.; Chow, W.N.; Wong, A.Y.; Yeung, J.M.; Bao, J.; Zhang, N.; Lok, S.; Woo, P.C.; Yuen, K.Y. Identification of microRNA-like RNAs in mycelial and yeast phases of the thermal dimorphic fungus Penicillium marneffei. PLoS Negl. Trop. Dis. 2013, 7, e2398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McHale, L.; Tan, X.; Koehl, P.; Michelmore, R.W. Plant NBS-LRR proteins: Adaptable guards. Genome Biol. 2006, 7, 212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ng, A.; Xavier, R.J. Leucine-rich repeat (LRR) proteins: Integrators of pattern recognition and signaling in immunity. Autophagy 2011, 7, 1082–1084. [Google Scholar] [CrossRef] [Green Version]
- Liu, T.-B.; Xue, C. The Ubiquitin-Proteasome System and F-box Proteins in Pathogenic Fungi. Mycobiology 2011, 39, 243–248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sadat, M.; Ullah, M.; Bashar, K.K.; Hossen, Q.M.; Tareq, M.; Islam, M. Genome-wide identification of F-box proteins in Macrophomina phaseolina and comparison with other fungi. J. Genet. Eng. Biotechnol. 2021, 19, 46. [Google Scholar] [CrossRef] [PubMed]
- Law, J.A.; Jacobsen, S.E. Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat. Rev. Genet. 2010, 11, 204–220. [Google Scholar] [CrossRef]
- Creasey, K.M.; Zhai, J.; Borges, F.; Van Ex, F.; Regulski, M.; Meyers, B.C.; Martienssen, R.A. miRNAs trigger widespread epigenetically activated siRNAs from transposons in Arabidopsis. Nature 2014, 508, 411–415. [Google Scholar] [CrossRef] [Green Version]
- Santana, M.F. Transposable Elements in Fungi: A Genomic Approach. Sci. J. Genet. Gene Ther. 2015, 1, 012–016. [Google Scholar] [CrossRef]
- Grandaubert, J.; Lowe, R.G.; Soyer, J.L.; Schoch, C.L.; Van de Wouw, A.P.; Fudal, I.; Robbertse, B.; Lapalu, N.; Links, M.G.; Ollivier, B.; et al. Transposable element-assisted evolution and adaptation to host plant within the Leptosphaeria macu-lans-Leptosphaeria biglobosa species complex of fungal pathogens. BMC Genomics 2014, 15, 891. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wollenberg, T.; Schirawski, J. Comparative Genomics of Plant Fungal Pathogens: The Ustilago-Sporisorium Paradigm. PLOS Pathog. 2014, 10, e1004218. [Google Scholar] [CrossRef] [PubMed]
Category | miRNA Prediction |
---|---|
N11 | Possible mature miRNA had >5 unpaired bases in predicted precursor secondary structure. |
N12 | Possible mature miRNA was not contained in a single predicted hairpin |
N13 | Possible miRNA/miRNA* duplexes had >2 mismatches and/or >3 mismatched nucleotides |
N14 | Imprecise processing: Reads for possible miRNA, miRNA*, and their 3p variants added up to less than 50% of the total reads at the locus. |
N15 | Maybe. Passed all tests except that the miRNA* was not sequenced. Insufficient evidence to support a de novo annotation of a new miRNA family. |
N5 | Locus size is less than maximum allowed for RNA folding per option --foldsize (default is 300 nucleotides). |
N6 | Locus is not stranded (>20% and <80% of reads aligned to top strand) |
N8 | Strand of possible mature miRNA is opposite to that of the locus |
Sequence and Assembly | |
---|---|
N50 (bp) | 11,539 |
Maximum (bp) | 190,502 |
Average (bp) | 3980 |
Number of contigs | 23,453 |
Number of contigs > 1000 bp with > 100× coverage | 13,085 |
Genome size (bp) | 93,339,198 |
GC content (%) | 50 |
Number of predicted genes | 31,294 |
Average transcript length (bp) | 1353 |
Average number of exons per gene | 5.8 |
Number of exons | 182,873 |
Average exon size (bp) | 226 |
Number of introns | 151,579 |
Average intron size (bp) | 76 |
Number of predicted proteins | 32,405 |
Number of matches to InterPro proteins | 27,593 |
Fungal Culture | Raw Reads | After Quality Control and Size Selection a | Structural RNAs b | Clean Mappable Reads c | % strRNA | % Clean Mappable Reads | Count Mapped Reads d | % Mapped Reads | Count Unmapped Reads | % Unmapped Reads |
---|---|---|---|---|---|---|---|---|---|---|
BCD2 | 12,280,779 | 6354430 | 1210857 | 5143573 | 19.06 | 80.94 | 4387783 | 85.31 | 755790 | 14.69 |
BCD7 | 12,018,693 | 5979763 | 1538344 | 4441419 | 25.73 | 74.27 | 3839643 | 86.45 | 601776 | 13.55 |
BCD8 | 16,243,640 | 7241215 | 2201059 | 5040156 | 30.40 | 69.6 | 4423800 | 87.77 | 616356 | 12.23 |
FREE5 | 13,576,160 | 6657187 | 1234775 | 5422412 | 18.55 | 81.45 | 5134752 | 94.69 | 287660 | 5.31 |
FREE6 | 14,654,508 | 7783981 | 1654271 | 6129710 | 21.25 | 78.75 | 5801256 | 94.64 | 328454 | 5.36 |
FREE8 | 15,329,619 | 7720742 | 1532205 | 6188537 | 19.85 | 80.15 | 5875387 | 94.94 | 313150 | 5.06 |
Codes | miRNA Prediction | Number of Small RNAs | Up-Regulated Small RNAs | Down-Regulated Small RNAs |
---|---|---|---|---|
N11 | Possible mature miRNAs with >5 unpaired bases in a predicted precursor secondary structure. | 154 | 64 | 0 |
N12 | Possible mature miRNAs not contained in a single predicted hairpin | 18 | 12 | 0 |
N13 | Possible miRNA/miRNA* duplex with >2 bulges and/or >3 bulged nucleotides | 8 | 5 | 0 |
N14 | Imprecise processing: Reads for possible miRNA, miRNA*, and their 3p variants adding up to less than 50% of the total reads at the locus. | 10 | 8 | 0 |
N15 | Maybe. Passed all tests except that the miRNA* was not sequenced. Insufficient evidence to support a de novo annotation of a new miRNA family. | 7 | 2 | 0 |
milRNA Name | Sequence (5’-3’) | Length | milRNAs Location | miRNA | log2FC | padj | Diffexpressed | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Contig | Start | End | Length of Loci | Strand | Complexity | |||||||
Cer-milR-1a | GCACUUGUAGGCACCAAGCCUGUU | 24 | 87 | 13,207 | 13,380 | 174 | − | 0.184 | N14 | 0.928 | 8.20 × 103 | UP |
Cer-milR-1b | 88 | 9916 | 10,089 | 174 | − | 0.150 | N14 | 0.802 | 3.33 × 102 | UP | ||
Cer-milR-2a | UGGAGAUUACUUCAAGCGAA | 20 | 2683 | 14,613 | 14,796 | 184 | + | 0.005 | N14 | 1.666 | 3.91 × 1010 | UP |
Cer-milR-2b | 3215 | 3411 | 3515 | 105 | − | 0.005 | N14 | 1.716 | 1.31 × 1011 | UP | ||
Cer-milR-3 | AGGUGCUCCCAGGCGCUUACGA | 21 | 3197 | 5665 | 5849 | 185 | + | 0.303 | N14 | 0.714 | 3.71 × 102 | UP |
Cer-milR-4a | CCCAAAUUCACAUCCUGACA | 20 | 3301 | 36,270 | 36,384 | 115 | − | 0.002 | N14 | 2.012 | 2.36 × 1026 | UP |
Cer-milR-4b | 4072 | 21,370 | 21,458 | 89 | − | 0.001 | N15 | 2.000 | 4.95 × 1025 | UP | ||
Cer-milR-5 | UCCCGGAGCACACGCUGGC | 19 | 3301 | 38,139 | 38,234 | 96 | − | 0.171 | N14 | 1.937 | 5.21 × 1014 | UP |
Cer-milR-6 | UCCCGGAGCACGCGCUGGC | 19 | 4072 | 23,216 | 23,286 | 71 | − | 0.065 | N14 | 1.550 | 2.43 × 109 | UP |
Cer-milR-7 | UGUCAGUAGGAACAAUUG | 18 | 5923 | 11,559 | 11,668 | 110 | − | 0.199 | N15 | 0.659 | 4.76 × 102 | UP |
Cer-milR-8 | UGGUGACGACUGUGGGAUU | 19 | 2085 | 8992 | 9046 | 55 | − | 0.007 | N15 | 0.272 | 5.10 × 101 | NO |
Cer-milR-9 | ACUCUGUCAAGGCGAACA | 18 | 2882 | 14,558 | 14,672 | 115 | − | 0.033 | N15 | 0.420 | 3.69 × 101 | NO |
Cer-milR-10 | AUAUCCCGACUCAGGAGCUGGUCCG | 25 | 3301 | 36,942 | 37,045 | 104 | − | 0.008 | N14 | −0.278 | 4.84 × 101 | NO |
Cer-milR-11 | AAUUUGAGCUUCCGGUCGAGCA | 22 | 3879 | 1 | 204 | 204 | − | 0.217 | N14 | 0.480 | 1.52 × 101 | NO |
Cer-milR-12 | UACGAGUCAAGAUGGUCAAGUUA | 23 | 7096 | 3700 | 3981 | 282 | + | 0.008 | N15 | 0.230 | 5.45 × 101 | NO |
Cer-milR-13 | UGUCUUCUGCAGUGGCCA | 18 | 11,727 | 7908 | 8131 | 224 | − | 0.046 | N15 | 0.161 | 7.61 × 101 | NO |
Cer-milR-14 | GGGCCAAAGUGCUUCGUA | 18 | 18,920 | 1122 | 1290 | 169 | − | 0.048 | N15 | 0.252 | 5.98 × 101 | NO |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, C.T.H.; Derbyshire, M.C.; Regmi, R.; Li, H.; Jones, M.G.K.; Wylie, S.J. Small RNA Analyses of a Ceratobasidium Isolate Infected with Three Endornaviruses. Viruses 2022, 14, 2276. https://doi.org/10.3390/v14102276
Cao CTH, Derbyshire MC, Regmi R, Li H, Jones MGK, Wylie SJ. Small RNA Analyses of a Ceratobasidium Isolate Infected with Three Endornaviruses. Viruses. 2022; 14(10):2276. https://doi.org/10.3390/v14102276
Chicago/Turabian StyleCao, Chi T. H., Mark C. Derbyshire, Roshan Regmi, Hua Li, Michael G. K. Jones, and Stephen J. Wylie. 2022. "Small RNA Analyses of a Ceratobasidium Isolate Infected with Three Endornaviruses" Viruses 14, no. 10: 2276. https://doi.org/10.3390/v14102276