Interspecies Recombination-Led Speciation of a Novel Geminivirus in Pakistan
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Virus Detection
2.2. Infectious Clone Construction and Infectivity
2.3. Target-Specific Primer Construction and PCR Processing
2.4. Nucleotide Sequences and Phylogenetic Analysis
2.5. Recombination Analysis
2.6. Nucleotide Diversity and Haplotype Variability Indices
2.7. Estimation of Gene Genealogies through TCS
3. Results
3.1. Detection of a New Virus in C. album
3.2. Genome Organization and Homology Analysis of Genes
3.3. Infectivity through Infectious Clone Inoculation
3.4. Target-Specific Primer Construction and PCR Analysis
3.5. Phylogenetic and Recombination Analysis
3.6. Nucleotide Diversity and Haplotype Variability Indices
3.7. Estimation of Genealogies through TCS
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Maeso, I.; Roy, S.W.; Irimia, M. Widespread recurrent evolution of genomic features. Genome Biol. Evol. 2012, 4, 486–500. [Google Scholar] [CrossRef] [PubMed]
- Blasio, F.; Prieto, P.; Pradillo, M.; Naranjo, T. Genomic and Meiotic Changes Accompanying Polyploidization. Plants 2022, 11, 125. [Google Scholar] [CrossRef] [PubMed]
- Mason, A.S.; Wendel, J.F. Homoeologous Exchanges, Segmental Allopolyploidy, and Polyploid Genome Evolution. Front. Genet. 2020, 11, 1014. [Google Scholar] [CrossRef] [PubMed]
- Sanjuán, R.; Domingo-Calap, P. Genetic Diversity and Evolution of Viral Populations. Encycl. Virol. 2021, 1, 53–61. [Google Scholar]
- Rubio, L.; Guerri, J.; Moreno, P. Genetic variability and evolutionary dynamics of viruses of the family Closteroviridae. Front. Microbiol. 2013, 4, 151. [Google Scholar] [CrossRef]
- Watt, W.B. Intragenic Recombination as a Source of Population Genetic Variability. Am. Nat. 1972, 106, 737–753. [Google Scholar] [CrossRef]
- Duffy, S.; Shackelton, L.A.; Holmes, E.C. Rates of evolutionary change in viruses: Patterns and determinants. Nat. Rev. Genet. 2008, 9, 267–276. [Google Scholar] [CrossRef]
- Stapley, J.; Feulner, P.G.D.; Johnston, S.E.; Santure, A.W.; Smadja, C.M. Recombination: The good, the bad and the variable. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2017, 372, 20170279. [Google Scholar] [CrossRef]
- Heyer, W.-D.; Kanaar, R. Recombination Mechanisms: Fortieth Anniversary Meeting of the Holliday Model. Mol. Cell 2004, 16, 1–9. [Google Scholar]
- Posada, D.; Crandall, K.A.; Holmes, E.C. Recombination in Evolutionary Genomics. Annu. Rev. Genet. 2002, 36, 75–97. [Google Scholar] [CrossRef]
- Fiallo-Olivé, E.; Trenado, H.P.; Louro, D.; Navas-Castillo, J. Recurrent speciation of a tomato yellow leaf curl geminivirus in Portugal by recombination. Sci. Rep. 2019, 9, 1332. [Google Scholar] [CrossRef] [PubMed]
- Rojas, M.R.; Hagen, C.; Lucas, W.J.; Gilbertson, R.L. Exploiting Chinks in the Plant’s Armor: Evolution and Emergence of Geminiviruses. Annu. Rev. Phytopathol. 2005, 43, 361–394. [Google Scholar] [CrossRef] [PubMed]
- Fiallo-Olivé, E.; Lett, J.-M.; Martin, D.P.; Roumagnac, P.; Varsani, A.; Zerbini, F.M.; Navas-Castillo, J. ICTV Virus Taxonomy Profile: Geminiviridae 2021. J. Gen. Virol. 2021, 102, 001696. [Google Scholar] [CrossRef]
- Ng, T.F.F.; Duffy, S.; Polston, J.E.; Bixby, E.; Vallad, G.E.; Breitbart, M. Exploring the Diversity of Plant DNA Viruses and Their Satellites Using Vector-Enabled Metagenomics on Whiteflies. PLoS ONE 2011, 6, e19050. [Google Scholar] [CrossRef] [PubMed]
- Briddon, R.W.; Bedford, I.D.; Tsai, J.H.; Markham, P.G. Analysis of the nucleotide sequence of the treehopper-transmitted geminivirus, tomato pseudo-curly top virus, suggests a recombinant origin. Virology 1996, 219, 387–394. [Google Scholar] [CrossRef] [PubMed]
- Sanz, A.I.; Fraile, A.; García-Arenal, F.; Zhou, X.; Robinson, D.J.; Khalid, S.; Butt, T.; Harrison, B.D. Multiple infection, recombination and genome relationships among begomovirus isolates found in cotton and other plants in Pakistan. J. Gen. Virol. 2000, 81, 1839–1849. [Google Scholar] [CrossRef] [PubMed]
- Padidam, M.; Sawyer, S.; Fauquet, C.M. Possible Emergence of New Geminiviruses by Frequent Recombination. Virology 1999, 265, 218–225. [Google Scholar] [CrossRef]
- Mansoor, S.; Briddon, R.W.; Zafar, Y.; Stanley, J. Geminivirus disease complexes: An emerging threat. Trends Plant Sci. 2003, 8, 128–134. [Google Scholar] [CrossRef]
- Varma, A.; Malathi, V.G. Emerging geminivirus problems: A serious threat to crop production. Ann. Appl. Biol. 2003, 142, 145–164. [Google Scholar] [CrossRef]
- Fauquet, C.M.; Bisaro, D.; Briddon, R.; Brown, J.; Harrison, B.; Rybicki, E.; Stenger, D.; Stanley, J. Revision of taxonomic criteria for species demarcation in the family Geminiviridae, and an updated list of begomovirus species. Arch. Virol. 2003, 148, 405–420. [Google Scholar] [CrossRef]
- Zhang, W.; Olson, N.H.; Baker, T.S.; Faulkner, L.; Agbandje-McKenna, M.; Boulton, M.I.; Davies, J.W.; McKenna, R. Structure of the Maize streak virus geminate particle. Virology 2001, 279, 471–477. [Google Scholar] [CrossRef] [PubMed]
- Lazarowitz, S.G.; Shepherd, R. Geminiviruses: Genome structure and gene function. Crit. Rev. Plant Sci 1992, 11, 327–349. [Google Scholar] [CrossRef]
- Fauquet, C.M.; Mayo, M.A.; Maniloff, J.; Desselberger, U.; Ball, L.A. Virus Taxonomy: VIIIth Report of the International Committee on Taxonomy of Viruses; Academic Press: Cambridge, MA, USA, 2005. [Google Scholar]
- Brown, J. Current status of Bemisia tabaci as a plant pest and virus vector in agroecosystems worldwide. FAO Plant Prot. Bull. 1994, 42, 3–32. [Google Scholar]
- Roumagnac, P.; Granier, M.; Bernardo, P.; Deshoux, M.; Ferdinand, R.; Galzi, S.; Fernandez, E.; Julian, C.; Abt, I.; Filloux, D.; et al. Alfalfa Leaf Curl Virus: An Aphid-Transmitted Geminivirus. Virology 2015, 89, 9683–9688. [Google Scholar] [CrossRef]
- Zerbini, F.M.; Briddon, R.W.; Idris, A.; Martin, D.P.; Moriones, E.; Navas-Castillo, J.; Rivera-Bustamante, R.; Roumagnac, P.; Varsani, A. ICTV Virus Taxonomy Profile: Geminiviridae. J. Gen. Virol. 2017, 98, 131–133. [Google Scholar] [CrossRef] [PubMed]
- Chiumenti, M.; Greco, C.; De Stradis, A.; Loconsole, G.; Cavalieri, V.; Altamura, G.; Zicca, S.; Saldarelli, P.; Saponari, M. A Novel Bipartite Geminivirid Infecting Olive Trees. Viruses 2021, 13, 481. [Google Scholar] [CrossRef]
- Lal, A.; Kim, Y.-H.; Vo, T.T.B.; Wira Sanjaya, I.G.N.P.; Ho, P.T.; Byun, H.-S.; Choi, H.-S.; Kil, E.-J.; Lee, S. Identification of a Novel Geminivirus in Fraxinus rhynchophylla in Korea. Viruses 2021, 13, 2385. [Google Scholar] [CrossRef]
- Brown, J.K.; Zerbini, F.M.; Navas-Castillo, J.; Moriones, E.; Ramos-Sobrinho, R.; Silva, J.C.F.; Fiallo-Olivé, E.; Briddon, R.; Hernández-Zepeda, C.; Idris, A.; et al. Revision of Begomovirus taxonomy based on pairwise sequence comparisons. Arch Virol. 2015, 160, 1593–1619. [Google Scholar] [CrossRef]
- Harrison, B.D.; Swanson, M.M.; Fargette, D. Begomovirus coat protein: Serology, variation and functions. Physiol. Mol 2002, 60, 257–271. [Google Scholar] [CrossRef]
- Hehnle, S.; Wege, C.; Jeske, H. Interaction of DNA with the movement proteins of geminiviruses revisited. J. Virol. 2004, 78, 7698–7706. [Google Scholar] [CrossRef]
- Fondong, V.N. Geminivirus protein structure and function. Mol. Plant Pathol. 2013, 14, 635–649. [Google Scholar] [CrossRef] [PubMed]
- Argüello-Astorga, G.R.; Guevara-González, R.G.; Herrera-Estrella, L.R.; Rivera-Bustamante, R.F. Geminivirus Replication Origins Have a Group-Specific Organization of Iterative Elements: A Model for Replication. Virology 1994, 203, 90–100. [Google Scholar] [CrossRef] [PubMed]
- Sunter, G.; Stenger, D.C.; Bisaro, D.M. Heterologous Complementation by Geminivirus AL2 and AL3 Genes. Virology 1994, 203, 203–210. [Google Scholar] [CrossRef] [PubMed]
- Laufs, J.; Traut, W.; Heyraud, F.; Matzeit, V.; Rogers, S.G.; Schell, J.; Gronenborn, B. In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus. Proc. Natl. Acad. Sci. USA 1995, 92, 3879–3883. [Google Scholar] [CrossRef]
- Fontes, E.P.; Eagle, P.A.; Sipe, P.S.; Luckow, V.A.; Hanley-Bowdoin, L. Interaction between a geminivirus replication protein and origin DNA is essential for viral replication. Int. J. Biol. Chem. 1994, 269, 8459–8465. [Google Scholar] [CrossRef]
- Fondong, V.N. The Ever-Expanding Role of C4/AC4 in Geminivirus Infection: Punching above Its Weight? Mol. Plant 2019, 12, 145–147. [Google Scholar] [CrossRef]
- Altenhofen, L.M.; Dekker, J. Complex regulation of Chenopodium album seed germination. Appl. Ecol. Environ. Sci. 2013, 1, 133–142. [Google Scholar] [CrossRef]
- Scheepens, P.C.; Kempenaar, C.; Andreasen, C.; Eggers, T.H.; Netland, J.; Vurro, M. Biological control of the annual weed Chenopodium album, with emphasis on the application of Ascochyta caulina as a microbial herbicide. J. Integr. Pest Manag. 1997, 2, 71–76. [Google Scholar] [CrossRef]
- Eslami, S.V. Comparative germination and emergence ecology of two populations of common lambsquarters (Chenopodium album) from Iran and Denmark. Weed Sci. 2011, 59, 90–97. [Google Scholar] [CrossRef]
- Matloob, A.; Safdar, M.E.; Abbas, T.; Aslam, F.; Khaliq, A.; Tanveer, A.; Rehman, A.; Chadhar, A.R. Challenges and prospects for weed management in Pakistan: A review. Crop Prot. 2020, 134, 104724. [Google Scholar] [CrossRef]
- Shepherd, D.N.; Martin, D.P.; Lefeuvre, P.; Monjane, A.L.; Owor, B.E.; Rybicki, E.P.; Varsani, A. A protocol for the rapid isolation of full geminivirus genomes from dried plant tissue. J. Virol. Methods 2008, 149, 97–102. [Google Scholar] [CrossRef]
- Crespo-Bellido, A.; Hoyer, J.S.; Dubey, D.; Jeannot, R.B.; Duffy, S.; Simon, A.E. Interspecies Recombination Has Driven the Macroevolution of Cassava Mosaic Begomoviruses. J. Virol. 2021, 95, e00541-21. [Google Scholar] [CrossRef] [PubMed]
- Lal, A.; Kil, E.-J.; Vo, T.T.B.; Fadhila, C.; Ho, P.T.; Shuja, M.N.; Ali, M.; Lee, S. First Report of Duranta leaf curl virus Infecting Ficus virens Showing Leaf Curl Symptoms in Pakistan. Plant Dis. 2020, 104, 2034. [Google Scholar] [CrossRef] [Green Version]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef]
- Briddon, R.W.; Bull, S.E.; Mansoor, S.; Amin, I.; Markham, P.G. Universal primers for the PCR-mediated amplification of DNA β. Mol. Biotechnol. 2002, 20, 315–318. [Google Scholar] [CrossRef]
- Rojas, M. Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Dis. 1993, 77, 340–347. [Google Scholar] [CrossRef]
- Southern, E.M. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 1975, 98, 503–517. [Google Scholar] [CrossRef]
- Kil, E.-J.; Kim, S.; Lee, Y.-J.; Byun, H.-S.; Park, J.; Seo, H.; Kim, C.-S.; Shim, J.-K.; Lee, J.-H.; Kim, J.-K. Tomato yellow leaf curl virus (TYLCV-IL): A seed-transmissible geminivirus in tomatoes. Sci. Rep. 2016, 6, 19013. [Google Scholar] [CrossRef]
- Seol, E.; Jung, Y.; Lee, J.; Cho, C.; Kim, T.; Rhee, Y.; Lee, S. In planta transformation of Notocactus scopa cv. Soonjung by Agrobacterium tumefaciens. Plant Cell Rep. 2008, 27, 1197–1206. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. Evolution, MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. The CIPRES science gateway: A community resource for phylogenetic analyses. In Proceedings of the 2011 TeraGrid Conference: Extreme digital discovery, Salt Lake City, Uath, USA, 18–21 July 2011; pp. 1–8. [Google Scholar]
- Nylander, J. MrModeltest, a Program to Evaluate the Fit of Several Models of Evolution to a Given Data and Unrooted Tree (Version 2.2); Program Distributed by the Author. Evolutionary Biology Centre, Uppsala University: Uppsala, Sweden, 2004. Available online: http://www.abc.se/~nylander (accessed on 21 January 2022).
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 2019, 47, W256–W259. [Google Scholar] [CrossRef] [PubMed]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A Virus Classification Tool Based on Pairwise Sequence Alignment and Identity Calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef] [PubMed]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef]
- Tajima, F. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 1989, 123, 585–595. [Google Scholar] [CrossRef]
- Fu, Y.X.; Li, W.H. Statistical tests of neutrality of mutations. Genetics 1993, 133, 693–709. [Google Scholar] [CrossRef]
- Clement, M.; Posada, D.; Crandall, K.A. TCS: A computer program to estimate gene genealogies. Mol. Ecol. 2000, 9, 1657–1659. [Google Scholar] [CrossRef]
- Leigh, J.W.; Bryant, D. popart: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Zhu, Z.; Meng, K.; Meng, G. Genomic recombination events may reveal the evolution of coronavirus and the origin of SARS-CoV-2. Sci. Rep. 2020, 10, 21617. [Google Scholar] [CrossRef]
- Lefeuvre, P.; Moriones, E. Recombination as a motor of host switches and virus emergence: Geminiviruses as case studies. Curr. Opin. Virol. 2015, 10, 14–19. [Google Scholar] [CrossRef]
- Patil, B.L.; Fauquet, C.M. Cassava mosaic geminiviruses: Actual knowledge and perspectives. Mol. Plant Pathol. 2009, 10, 685–701. [Google Scholar] [CrossRef] [PubMed]
- Monci, F.; Sánchez-Campos, S.; Navas-Castillo, J.; Moriones, E. A Natural Recombinant between the Geminiviruses Tomato yellow leaf curl Sardinia virus and Tomato yellow leaf curl virus Exhibits a Novel Pathogenic Phenotype and Is Becoming Prevalent in Spanish Populations. Virology 2002, 303, 317–326. [Google Scholar] [CrossRef] [PubMed]
- Lima, A.T.M.; Silva, J.C.F.; Silva, F.N.; Castillo-Urquiza, G.P.; Silva, F.F.; Seah, Y.M.; Mizubuti, E.S.G.; Duffy, S.; Zerbini, F.M. The diversification of begomovirus populations is predominantly driven by mutational dynamics. Virus Evol. 2017, 3, vex005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lapidot, M.; Gelbart, D.; Gal-On, A.; Sela, N.; Anfoka, G.; Ahmed, F.H.; Abou-Jawada, Y.; Sobh, H.; Mazyad, H.; Aboul-Ata, A.-A.E.; et al. Frequent migration of introduced cucurbit-infecting begomoviruses among Middle Eastern countries. Virology 2014, 11, 181. [Google Scholar] [CrossRef]
- Rashid, K.; Tariq, M.; Briddon, R.W.; Kotta-Loizou, I.; Hussain, K. Identification and molecular characterization of rose leaf curl virus in ornamental pomegranate (Punica granatum L.). Australas. Plant Pathol. 2021, 50, 353–356. [Google Scholar] [CrossRef]
- Ilyas, M.; Nawaz, K.; Shafiq, M.; Haider, M.S.; Shahid, A.A. Complete nucleotide sequences of two begomoviruses infecting Madagascar periwinkle (Catharanthus roseus) from Pakistan. Arch. Virol. 2013, 158, 505–510. [Google Scholar] [CrossRef]
- Tahir, M.; Amin, I.; Haider, M.S.; Mansoor, S.; Briddon, R.W. Ageratum enation virus—A Begomovirus of Weeds with the Potential to Infect Crops. Viruses 2015, 7, 647–665. [Google Scholar] [CrossRef] [Green Version]
Virus | Primer | Sequences 5′-3′ | Product Size (bps) | Targeted Area |
---|---|---|---|---|
AEV | AEVCP-F | TGGTCCCCAGACAAACAACT | 349 | CP |
AEVCP-R | TGGGCTGTCGAAGTTGAGAC | |||
RLCV | RLVREP-F | GTTCCCTAATGACTCTAAGAGC | 384 | Rep |
RLVREP-R | AGAAGAAGCCCTCTATCAATTAC | |||
CYMV | CMREP-F | GCTAAAGCTGCGTCAGCAGA | 375 | Rep |
CMREP-R | AAAGGAGCAAATGCTCGAACTC | |||
PaLCrV | PaLRep-F | CAGGATGTACAGGATGTATAGGAG | 336 | Rep |
PaLRep-R | GTGCTGGGCTCATTATCAAACA | |||
DLCV | DLCREP-F | TAAAGCTGCTTCAGCTGAACC | 365 | Rep |
DLCREP-R | GAGCAAATGCTCGAACTCCTTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lal, A.; Kil, E.-J.; Vo, T.T.B.; Wira Sanjaya, I.G.N.P.; Qureshi, M.A.; Nattanong, B.; Ali, M.; Shuja, M.N.; Lee, S. Interspecies Recombination-Led Speciation of a Novel Geminivirus in Pakistan. Viruses 2022, 14, 2166. https://doi.org/10.3390/v14102166
Lal A, Kil E-J, Vo TTB, Wira Sanjaya IGNP, Qureshi MA, Nattanong B, Ali M, Shuja MN, Lee S. Interspecies Recombination-Led Speciation of a Novel Geminivirus in Pakistan. Viruses. 2022; 14(10):2166. https://doi.org/10.3390/v14102166
Chicago/Turabian StyleLal, Aamir, Eui-Joon Kil, Thuy T. B. Vo, I Gusti Ngurah Prabu Wira Sanjaya, Muhammad Amir Qureshi, Bupi Nattanong, Muhammad Ali, Malik Nawaz Shuja, and Sukchan Lee. 2022. "Interspecies Recombination-Led Speciation of a Novel Geminivirus in Pakistan" Viruses 14, no. 10: 2166. https://doi.org/10.3390/v14102166
APA StyleLal, A., Kil, E.-J., Vo, T. T. B., Wira Sanjaya, I. G. N. P., Qureshi, M. A., Nattanong, B., Ali, M., Shuja, M. N., & Lee, S. (2022). Interspecies Recombination-Led Speciation of a Novel Geminivirus in Pakistan. Viruses, 14(10), 2166. https://doi.org/10.3390/v14102166