SARS-CoV-2 Variants of Concern Infect the Respiratory Tract and Induce Inflammatory Response in Wild-Type Laboratory Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Infection Experiments
2.2. Quantification of the Virus Load
2.3. Analysis of Cytokines and Chemokines
2.4. Histopathological Analysis
2.5. Immunoblot Analysis
2.6. Statistical Analysis
3. Results
3.1. B.1.1.7 and B.1.351 Variants Replicate in the Lungs of C57BL/6 Mice
3.2. B.1.1.7 and B.1.351 Variants Induce an Inflammatory Response in the Lungs
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rothan, H.A.; Byrareddy, S.N. The epidemiology and pathogenesis of coronavirus disease (COVID-19) outbreak. J. Autoimmun. 2020, 109, 102433. [Google Scholar] [CrossRef]
- Kumar, M.; Iyer, S.S. ASSURED-SQVM diagnostics for COVID-19: Addressing the why, when, where, who, what and how of testing. Expert Rev. Mol. Diagn. 2021, 21, 349–362. [Google Scholar] [CrossRef]
- Rothan, H.A.; Acharya, A.; Reid, S.P.; Kumar, M.; Byrareddy, S.N. Molecular Aspects of COVID-19 Differential Pathogenesis. Pathogens 2020, 9, 538. [Google Scholar] [CrossRef]
- Walensky, R.P.; Walke, H.T.; Fauci, A.S. SARS-CoV-2 Variants of Concern in the United States-Challenges and Opportunities. JAMA 2021, 325, 1037–1038. [Google Scholar] [CrossRef]
- SARS-CoV-2 Variant Classifications and Definitions. Available online: https://www.cdc.gov/coronavirus/2019-ncov/variants/variant-info.html (accessed on 10 December 2021).
- Ramanathan, M.; Ferguson, I.D.; Miao, W.; Khavari, P.A. SARS-CoV-2 B.1.1.7 and B.1.351 spike variants bind human ACE2 with increased affinity. Lancet Infect. Dis. 2021, 21, 1070. [Google Scholar] [CrossRef]
- Khan, A.; Zia, T.; Suleman, M.; Khan, T.; Ali, S.S.; Abbasi, A.A.; Mohammad, A.; Wei, D.Q. Higher infectivity of the SARS-CoV-2 new variants is associated with K417N/T, E484K, and N501Y mutants: An insight from structural data. J. Cell Physiol. 2021, 236, 7045–7057. [Google Scholar] [CrossRef]
- Jia, W.; Wang, J.; Sun, B.; Zhou, J.; Shi, Y.; Zhou, Z. The Mechanisms and Animal Models of SARS-CoV-2 Infection. Front. Cell Dev. Biol. 2021, 9, 578825. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Yang, X.L.; Wang, X.G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.R.; Zhu, Y.; Li, B.; Huang, C.L.; et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dinnon, K.H., 3rd; Leist, S.R.; Schafer, A.; Edwards, C.E.; Martinez, D.R.; Montgomery, S.A.; West, A.; Yount, B.L., Jr.; Hou, Y.J.; Adams, L.E.; et al. A mouse-adapted model of SARS-CoV-2 to test COVID-19 countermeasures. Nature 2020, 586, 560–566. [Google Scholar] [CrossRef] [PubMed]
- Leist, S.R.; Dinnon, K.H., 3rd; Schafer, A.; Tse, L.V.; Okuda, K.; Hou, Y.J.; West, A.; Edwards, C.E.; Sanders, W.; Fritch, E.J.; et al. A Mouse-Adapted SARS-CoV-2 Induces Acute Lung Injury and Mortality in Standard Laboratory Mice. Cell 2020, 183, 1070–1085. [Google Scholar] [CrossRef] [PubMed]
- Munoz-Fontela, C.; Dowling, W.E.; Funnell, S.G.P.; Gsell, P.S.; Riveros-Balta, A.X.; Albrecht, R.A.; Andersen, H.; Baric, R.S.; Carroll, M.W.; Cavaleri, M.; et al. Animal models for COVID-19. Nature 2020, 586, 509–515. [Google Scholar] [CrossRef]
- Gu, H.; Chen, Q.; Yang, G.; He, L.; Fan, H.; Deng, Y.Q.; Wang, Y.; Teng, Y.; Zhao, Z.; Cui, Y.; et al. Adaptation of SARS-CoV-2 in BALB/c mice for testing vaccine efficacy. Science 2020, 369, 1603–1607. [Google Scholar] [CrossRef]
- Frampton, D.; Rampling, T.; Cross, A.; Bailey, H.; Heaney, J.; Byott, M.; Scott, R.; Sconza, R.; Price, J.; Margaritis, M.; et al. Genomic characteristics and clinical effect of the emergent SARS-CoV-2 B.1.1.7 lineage in London, UK: A whole-genome sequencing and hospital-based cohort study. Lancet Infect. Dis. 2021, 21, 1246–1256. [Google Scholar] [CrossRef]
- Tegally, H.; Wilkinson, E.; Giovanetti, M.; Iranzadeh, A.; Fonseca, V.; Giandhari, J.; Doolabh, D.; Pillay, S.; San, E.J.; Msomi, N.; et al. Detection of a SARS-CoV-2 variant of concern in South Africa. Nature 2021, 592, 438–443. [Google Scholar] [CrossRef]
- Kumari, P.; Rothan, H.A.; Natekar, J.P.; Stone, S.; Pathak, H.; Strate, P.G.; Arora, K.; Brinton, M.A.; Kumar, M. Neuroinvasion and Encephalitis Following Intranasal Inoculation of SARS-CoV-2 in K18-hACE2 Mice. Viruses 2021, 13, 132. [Google Scholar] [CrossRef]
- Rothan, H.A.; Arora, K.; Natekar, J.P.; Strate, P.G.; Brinton, M.A.; Kumar, M. Z-DNA-Binding Protein 1 Is Critical for Controlling Virus Replication and Survival in West Nile Virus Encephalitis. Front. Microbiol. 2019, 10, 2089. [Google Scholar] [CrossRef] [PubMed]
- Rothan, H.A.; Stone, S.; Natekar, J.; Kumari, P.; Arora, K.; Kumar, M. The FDA-approved gold drug auranofin inhibits novel coronavirus (SARS-CoV-2) replication and attenuates inflammation in human cells. Virology 2020, 547, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Natekar, J.P.; Rothan, H.A.; Arora, K.; Strate, P.G.; Kumar, M. Cellular microRNA-155 Regulates Virus-Induced Inflammatory Response and Protects against Lethal West Nile Virus Infection. Viruses 2019, 12, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mangalmurti, N.; Hunter, C.A. Cytokine Storms: Understanding COVID-19. Immunity 2020, 53, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Blanco-Melo, D.; Nilsson-Payant, B.E.; Liu, W.C.; Uhl, S.; Hoagland, D.; Moller, R.; Jordan, T.X.; Oishi, K.; Panis, M.; Sachs, D.; et al. Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19. Cell 2020, 181, 1036–1045. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Wong, L.R.; Li, K.; Verma, A.K.; Ortiz, M.; Wohlford-Lenane, C.; Leidinger, M.R.; Knudson, C.M.; Meyerholz, D.K.; McCray, P.B., Jr.; et al. COVID-19 treatments and pathogenesis including anosmia in K18-hACE2 mice. Nature 2021, 589, 603–607. [Google Scholar] [CrossRef] [PubMed]
- Yi, C.; Sun, X.; Ye, J.; Ding, L.; Liu, M.; Yang, Z.; Lu, X.; Zhang, Y.; Ma, L.; Gu, W.; et al. Key residues of the receptor binding motif in the spike protein of SARS-CoV-2 that interact with ACE2 and neutralizing antibodies. Cell. Mol. Immunol. 2020, 17, 621–630. [Google Scholar] [CrossRef] [PubMed]
- Pearson, C.A.B.; Russell, T.W.; Davies, N.; Kucharski, A.J.; Edmunds, W.J.; Eggo, R.M.; CMMID COVID-19 Working Group. Estimates of Severity and Transmissibility of Novel SARS-CoV-2 Variant 501Y.V2 in South Africa. 2021. Available online: https://cmmid.github.io/topics/covid19/sa-novel-variant.html (accessed on 10 December 2021).
- Niu, Z.; Zhang, Z.; Gao, X.; Du, P.; Lu, J.; Yan, B.; Wang, C.; Zheng, Y. N501Y mutation imparts cross-species transmission of SARS-CoV-2 to mice by enhancing receptor binding. Signal Transduct. Target. Ther. 2021, 6, 284. [Google Scholar] [CrossRef] [PubMed]
- Yao, W.; Wang, Y.; Ma, D.; Tang, X.; Wang, H.; Li, C.; Lin, H.; Li, Y.; Zhong, G. Circulating SARS-CoV-2 variants B.1.1.7, 501Y.V2, and P.1 have gained ability to utilize rat and mouse Ace2 and altered in vitro sensitivity to neutralizing antibodies and ACE2-Ig. BioRxiv 2021. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, J.; Plante, K.S.; Plante, J.A.; Xie, X.; Zhang, X.; Ku, Z.; An, Z.; Scharton, D.; Schindewolf, C.; et al. The N501Y spike substitution enhances SARS-CoV-2 infection and transmission. Nature 2021. [Google Scholar] [CrossRef]
- Weisblum, Y.; Schmidt, F.; Zhang, F.; DaSilva, J.; Poston, D.; Lorenzi, J.C.; Muecksch, F.; Rutkowska, M.; Hoffmann, H.H.; Michailidis, E.; et al. Escape from neutralizing antibodies by SARS-CoV-2 spike protein variants. ELife 2020, 9, e61312. [Google Scholar] [CrossRef]
- Radvak, P.; Kwon, H.J.; Kosikova, M.; Ortega-Rodriguez, U.; Xiang, R.; Phue, J.N.; Shen, R.F.; Rozzelle, J.; Kapoor, N.; Rabara, T.; et al. SARS-CoV-2 B.1.1.7 (alpha) and B.1.351 (beta) variants induce pathogenic patterns in K18-hACE2 transgenic mice distinct from early strains. Nature 2021, 12, 6559. [Google Scholar] [CrossRef]
- Winkler, E.S.; Bailey, A.L.; Kafai, N.M.; Nair, S.; McCune, B.T.; Yu, J.; Fox, J.M.; Chen, R.E.; Earnest, J.T.; Keeler, S.P.; et al. SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function. Nat. Immunol. 2020, 21, 1327–1335. [Google Scholar] [CrossRef]
Gene (Accession No.) | Primer Sequence (5′–3′) |
---|---|
IL-1β (NM_000576) | |
Forward | AGCACCTTCTTTCCCTTCATC |
Reverse | GGACCAGACATCACCAAGC |
IL-6 (NM_000600) | |
Forward | CCAGGAGCCCAGCTATGAAC |
Reverse | CCCAGGGAGAAGGCAACTG |
TNF-α (NM_013693) | |
Forward | CCAGTCTGTATCCTTCTAA |
Reverse | TCTTGTGTTTCTGAGTAGT |
CCL2 (NM_011333) | |
Forward | TCACCTGCTGCTACTCATTCACCA |
Reverse | TACAGCTTCTTTGGGACACCTGCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stone, S.; Rothan, H.A.; Natekar, J.P.; Kumari, P.; Sharma, S.; Pathak, H.; Arora, K.; Auroni, T.T.; Kumar, M. SARS-CoV-2 Variants of Concern Infect the Respiratory Tract and Induce Inflammatory Response in Wild-Type Laboratory Mice. Viruses 2022, 14, 27. https://doi.org/10.3390/v14010027
Stone S, Rothan HA, Natekar JP, Kumari P, Sharma S, Pathak H, Arora K, Auroni TT, Kumar M. SARS-CoV-2 Variants of Concern Infect the Respiratory Tract and Induce Inflammatory Response in Wild-Type Laboratory Mice. Viruses. 2022; 14(1):27. https://doi.org/10.3390/v14010027
Chicago/Turabian StyleStone, Shannon, Hussin Alwan Rothan, Janhavi Prasad Natekar, Pratima Kumari, Shaligram Sharma, Heather Pathak, Komal Arora, Tabassum Tasnim Auroni, and Mukesh Kumar. 2022. "SARS-CoV-2 Variants of Concern Infect the Respiratory Tract and Induce Inflammatory Response in Wild-Type Laboratory Mice" Viruses 14, no. 1: 27. https://doi.org/10.3390/v14010027