Type II Grass Carp Reovirus Infects Leukocytes but Not Erythrocytes and Thrombocytes in Grass Carp (Ctenopharyngodon idella)
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Blood Samples, Isolation of Peripheral Blood Cells of Grass Carp
2.3. Cell Culture, Viral Infection, and Antibodies
2.4. Hemocyte Morphologic Observation and Giemsa stain
2.5. RNA isolation, Polymerase Chain Reaction (PCR) Detection and Western Blotting Analysis
2.6. Flow Cytometry Analysis
2.7. Immunofluorescence Microscopy
2.8. Transmission Electron Microscope
2.9. Quantitative Real-Time PCR Assay
2.10. Statistical Analysis
3. Results
3.1. Isolation and Identification of Peripheral Blood Cells of Grass Carp
3.2. Grass Carp Reovirus (GCRV) Load in Grass Carp Leukocytes
3.3. Ex Vivo Infected Leukocytes Trigger an Antiviral Immune Response
3.4. GCRV Virus Particle Morphology Observed by Transmission Electron Microscopy (TEM)
3.5. Viral Inclusions Detected by Indirect Immunofluorescence
3.6. High Numbers of GCRV-Positive Leukocytes Detected by Flow Cytometry
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Su, H.; Su, J.-G. Cyprinid viral diseases and vaccine development. Fish Shellfish Immunol. 2018, 83, 84–95. [Google Scholar] [CrossRef]
- Su, H.; Liao, Z.-W.; Yuan, G.-L.; Su, J.-G. A plasmid containing CpG ODN as vaccine adjuvant against grass carp reovirus in grass carp Ctenopharyngodon idella. Oncotarget 2017, 8, 86576–86591. [Google Scholar] [CrossRef] [PubMed]
- Su, H.; Yuan, G.-L.; Su, J.-G. A specific CpG oligodeoxynucleotide induces protective antiviral responses against grass carp reovirus in grass carp Ctenopharyngodon idella. Dev. Comp. Immunol. 2016, 60, 218–227. [Google Scholar] [CrossRef]
- Jaafar, F.M.; Goodwin, A.E.; Belhouchet, M.; Merry, G.; Fang, Q.; Cantaloube, J.F.; Biagini, P.; Micco, P.; Mertens, P.P.C.; Attoui, H. Complete characterisation of the American grass carp reovirus genome (genus Aquareovirus: Family Reoviridae) reveals an evolutionary link between aquareoviruses and coltiviruses. Virology 2008, 373, 310–321. [Google Scholar] [CrossRef]
- Yu, F.; Wang, L.-L.; Li, W.-J.; Lu, L.-Q. Identification of a novel membrane-associated protein from the S7 segment of grass carp reovirus. J. Gen. Virol. 2019, 100, 369–379. [Google Scholar] [CrossRef]
- Wang, Q.; Zeng, W.-W.; Liu, C.; Zhang, C.; Wang, Y.-Y.; Shi, C.-B.; Wu, S.-Q. Complete genome sequence of a reovirus isolated from grass carp, indicating different genotypes of GCRV in China. J. Virol. 2012, 86, 12466. [Google Scholar] [CrossRef]
- Ye, X.; Tian, Y.-Y.; Deng, G.-C.; Chi, Y.-Y.; Jiang, X.-Y. Complete genomic sequence of a reovirus isolated from grass carp in China. Virus Res. 2012, 163, 275–283. [Google Scholar] [CrossRef]
- Nibert, M.L.; Duncan, R. Bioinformatics of recent aqua- and orthoreovirus isolates from fish: Evolutionary gain or loss of FAST and fiber proteins and taxonomic implications. PLoS ONE 2013, 8, e68607. [Google Scholar] [CrossRef] [PubMed]
- Danthi, P.; Guglielmi, K.M.; Kirchner, E.; Mainou, B.; Stehle, T.; Dermody, T.S. From touchdown to transcription: The reovirus cell entry pathway. Curr. Top. Microbiol. Immunol. 2010, 343, 91–119. [Google Scholar]
- Dahle, M.K.; Jorgensen, J.B. Antiviral defense in salmonids—Mission made possible? Fish Shellfish Immunol. 2019, 87, 421–437. [Google Scholar] [CrossRef]
- Polinski, M.P.; Vendramin, N.; Cuenca, A.; Garver, K.A. Piscine orthoreovirus: Biology and distribution in farmed and wild fish. J. Fish Dis. 2020, 43, 1331–1352. [Google Scholar] [CrossRef]
- Yousaf, M.N.; Koppang, E.O.; Skjodt, K.; Hordvik, I.; Zou, J.; Secombes, C.; Powell, M.D. Comparative cardiac pathological changes of Atlantic salmon (Salmo salar L.) affected with heart and skeletal muscle inflammation (HSMI), cardiomyopathy syndrome (CMS) and pancreas disease (PD). Vet. Immunol. Immunopathol. 2013, 151, 49–62. [Google Scholar] [CrossRef]
- Finstad, Ø.W.; Falk, K.; Løvoll, M.; Evensen, Ø.; Rimstad, E. Immunohistochemical detection of piscine reovirus (PRV) in hearts of Atlantic salmon coincide with the course of heart and skeletal muscle inflammation (HSMI). Vet. Res. 2012, 43, 27. [Google Scholar] [CrossRef] [PubMed]
- Bjorgen, H.; Wessel, O.; Fjelldal, P.G.; Hansen, T.; Sveier, H.; Saebo, H.R.; Enger, K.B.; Monsen, E.; Kvellestad, A.; Rimstad, E.; et al. Piscine orthoreovirus (PRV) in red and melanised foci in white muscle of Atlantic salmon (Salmo salar). Vet. Res. 2015, 46, 89. [Google Scholar] [CrossRef] [PubMed]
- Finstad, O.W.; Dahle, M.K.; Lindholm, T.H.; Nyman, I.B.; Løvoll, M.; Wallace, C.; Olsen, C.M.; Storset, A.K.; Rimstad, E. Piscine orthoreovirus (PRV) infects Atlantic salmon erythrocytes. Vet. Res. 2014, 45, 35. [Google Scholar] [CrossRef] [PubMed]
- Biacchesi, S.; Jouvion, G.; Merour, E.; Boukadiri, A.; Desdouits, M.; Ozden, S.; Huerre, M.; Ceccaldi, P.E.; Bremont, M. Rainbow trout (Oncorhynchus mykiss) muscle satellite cells are targets of salmonid alphavirus infection. Vet. Res. 2016, 47, 9. [Google Scholar] [CrossRef]
- Wessel, O.; Olsen, C.M.; Rimstad, E.; Dahle, M.K. Piscine orthoreovirus (PRV) replicates in Atlantic salmon (Salmo salar L.) erythrocytes ex vivo. Vet. Res. 2015, 46, 26. [Google Scholar] [CrossRef]
- Wessel, Ø.; Braaen, S.; Alarcon, M.; Haatveit, H.; Roos, N.; Markussen, T.; Tengs, T.; Dahle, M.K.; Rimstad, E. Infection with purified Piscine orthoreovirus demonstrates a causal relationship with heart and skeletal muscle inflammation in Atlantic salmon. PLoS ONE 2017, 12, e0183781. [Google Scholar] [CrossRef] [PubMed]
- Rao, Y.-L.; Su, J.-G. Insights into the antiviral immunity against grass carp (Ctenopharyngodon idella) reovirus (GCRV) in grass carp. J. Immunol. Res. 2015, 2015, 670437. [Google Scholar] [CrossRef]
- Wu, M.-L.; Li, H.-Y.; Chen, X.-W.; Jiang, Y.-Y.; Jiang, W. Studies on the clinical symptoms, virus distribution, and mRNA expression of several antiviral immunity-related genes in grass carp after infection with genotype II grass carp reovirus. Arch. Virol. 2020, 165, 1599–1609. [Google Scholar] [CrossRef]
- Yang, Y.; Yu, H.; Gu, Y.-M. Research progress on grass carp reovirus. Guangdong Agric. Sci. 2015, 15, 4. [Google Scholar]
- Yang, L.; Su, J.-G. Studies on pathological symptoms and virus distribution in natural and artificial injection infection Ctenopharyngodon idella with grass carp reovirus type II. J. Fish. China 2021, in press. [Google Scholar]
- Tang, Y.-F.; Zeng, W.-W.; Wang, Y.-Y.; Wang, Q.; Yin, J.-Y.; Li, Y.-Y.; Wang, C.-B.; Bergmann, S.M.; Gao, C.-X.; Hu, H.-Z. Comparison of the blood parameters and histopathology between grass carp infected with a virulent and avirulent isolates of genotype II grass carp reovirus. Microb. Pathog. 2020, 139, 103859. [Google Scholar] [CrossRef]
- Zheng, D.-C.; Huang, Q.-Y.; Cai, W.-Q. Histopathological Studies on the Hemorrage Disease of Grass Carp. J. Fish. China 1986, 2, 151–159. [Google Scholar]
- Sun, C.-G.; Liu, Y.; Hu, Y.-S.; Fan, Q.-D.; Yu, X.-J.; Mao, H.-L.; Hu, C.-Y. Gig1 and Gig2 homologs (CiGig1 and CiGig2) from grass carp (Ctenopharyngodon idella) display good antiviral activities in an IFN-independent pathway. Dev. Comp. Immunol. 2013, 41, 477–483. [Google Scholar] [CrossRef] [PubMed]
- Jorgensen, J.B.; Johansen, A.; Hegseth, M.N.; Zou, J.; Robertsen, B.; Collet, B.; Secombes, C.J. A recombinant CHSE-214 cell line expressing an Mx1 promoter-reporter system responds to both interferon type I and type II from salmonids and represents a versatile tool to study the IFN-system in teleost fish. Fish Shellfish Immunol. 2007, 23, 1294–1303. [Google Scholar] [CrossRef]
- Incelas, M.O.; Demirci, R.; Yavuzcan, H.G.; Tanyeri, U.; Veske, E. Seeded region growing based detection of cells in fish blood stained with Natt-Herrick. In Proceedings of the Signal Processing and Communications Applications Conference, Trabzon, Turkey, 23–25 April 2014. [Google Scholar]
- Palmer, L.; Briggs, C.; McFadden, S.; Zini, G.; Burthem, J.; Rozenberg, G.; Proytcheva, M.; Machin, S.J. ICSH recommendations for the standardization of nomenclature and grading of peripheral blood cell morphological features. Int. J. Lab. Hematol. 2015, 37, 287–303. [Google Scholar] [CrossRef]
- Chen, H.-J.; Yuan, G.-L.; Su, J.-G.; Liu, X.-L. Hematological analysis of Ctenopharyngodon idella, Megalobrama amblycephala and Pelteobagrus fulvidraco: Morphology, ultrastructure, cytochemistry and quantification of peripheral blood cells. Fish Shellfish Immunol. 2019, 90, 376–384. [Google Scholar] [CrossRef] [PubMed]
- Israel, S.; Tian, L.-L.; Norbert, G. The red cell immune system. Lancet 1981, 2, 556–559. [Google Scholar]
- Warr, G.W.; DeLuca, D.; Marchalonis, J.J. Phylogenetic Origins of Immune Recognition: Lymphocyte Surface Immunoglobulins in the Goldfish, Carassius auratus. Proc. Natl. Acad. Sci. USA 1976, 73, 2476–2480. [Google Scholar] [CrossRef] [PubMed]
- Stoslk, M.; Deptula, W.; Travnicek, M.; Baldy-Chudzik, K. Phagocytic and bactericidal activity of blood thrombocytes in carps (Cyprinus carpio). Vet. Med. 2002, 63, 21–25. [Google Scholar]
- Kastl, L.; Sasse, D.; Wulf, V.; Hartmann, R.; Mircheski, J.; Ranke, C.; Carregal-Romero, S.; Martínez-López, J.A.; Fernández-Chacón, R.; Parak, W.J.; et al. Multiple internalization pathways of polyelectrolyte multilayer capsules into mammalian cells. ACS Nano 2013, 7, 6605–6618. [Google Scholar] [CrossRef] [PubMed]
- Antar, A.A.R.; Konopka, J.L.; Campbell, J.A.; Henry, R.A.; Perdigoto, A.L.; Carter, B.D.; Pozzi, A.; Abel, T.W.; Dermody, T.S. Junctional adhesion molecule-A is required for hematogenous dissemination of reovirus. Cell Host Microbe 2009, 5, 59–71. [Google Scholar] [CrossRef]
- Chappell, J.D.; Prota, A.E.; Dermody, T.S.; Stehle, T. Crystal structure of reovirus attachment protein sigma1 reveals evolutionary relationship to adenovirus fiber. EMBO J. 2002, 21, 1–11. [Google Scholar] [CrossRef]
- Rao, Y.-L.; Wan, Q.-Y.; Yang, C.-R.; Su, J.-G. Grass Carp Laboratory of Genetics and Physiology 2 Serves As a Negative Regulator in Retinoic Acid-Inducible Gene I- and Melanoma Differentiation-Associated Gene 5-Mediated Antiviral Signaling in Resting State and Early Stage of Grass Carp Reovirus Infection. Front. Immunol. 2017, 8, 352. [Google Scholar]
- Su, H.; Fan, C.-J.; Liao, Z.-W.; Yang, C.-R.; Clarke, J.L.; Zhang, Y.-A.; Su, J.-G. Grass Carp Reovirus Major Outer Capsid Protein VP4 Interacts with RNA Sensor RIG-I to Suppress Interferon Response. Biomolecules 2020, 10, 560. [Google Scholar] [CrossRef] [PubMed]
- He, R.-N.; Peng, J.-Y.; Yuan, P.-F.; Xu, F.; Wei, W.-S. Divergent roles of BECN1 in LC3 lipidation and autophagosomal function. Autophagy 2015, 11, 740–747. [Google Scholar] [CrossRef]
- Rivas, C.; Noya, M.; Cepeda, C.; Bandín, I.; Barja, J.L.; Dopazo, C.P. Replication and morphogenesis of the turbot aquareovirus (TRV) in cell culture. Aquaculture 1998, 160, 47–62. [Google Scholar] [CrossRef]
- Brookes, S.M.; Hyatt, A.D.; Eaton, B.T. Characterization of virus inclusion bodies in bluetongue virus-infected cells. J. Gen. Virol. 1993, 74, 525–530. [Google Scholar] [CrossRef] [PubMed]
- Su, J.-G.; Zhu, Z.-Y.; Wang, Y.-P.; Zou, J.; Wang, N.; Jang, S.-H. Grass carp reovirus activates RNAi pathway in rare minnow, Gobiocypris rarus. Aquaculture 2009, 289, 1–5. [Google Scholar] [CrossRef]
- Fan, C.; Shao, L.; Fang, Q. Characterization of the nonstructural protein NS80 of grass carp reovirus. Arch. Virol. 2010, 155, 1755–1763. [Google Scholar] [CrossRef]
- Wessel, O.; Hansen, E.F.; Dahle, M.K.; Alarcon, M.; Vatne, N.A.; Nyman, I.B.; Soleim, K.B.; Dhamotharan, K.; Timmerhaus, G.; Markussen, T.; et al. Piscine Orthoreovirus-1 Isolates Differ in Their Ability to Induce Heart and Skeletal Muscle Inflammation in Atlantic Salmon (Salmo salar). Pathogens 2020, 9, 1050. [Google Scholar] [CrossRef] [PubMed]
- Takano, T.; Nawata, A.; Sakai, T.; Matsuyama, T.; Ito, T.; Kurita, J.; Terashima, S.; Yasuike, M.; Nakamura, Y.; Fujiwara, A.; et al. Full-Genome Sequencing and Confirmation of the Causative Agent of Erythrocytic Inclusion Body Syndrome in Coho Salmon Identifies a New Type of Piscine Orthoreovirus. PLoS ONE 2016, 11, e0165424. [Google Scholar] [CrossRef] [PubMed]
- Adamo, S.A. Norepinephrine and octopamine: Linking stress and immune function across phyla. Invertebr. Surviv. J. 2008, 5, 12. [Google Scholar]
- Wang, Y.-T.; Liu, W.; Seah, J.N.; Lam, C.S.; Xiang, J.-H.; Korzh, V.; Kwang, J. White spot syndrome virus (WSSV) infects specific hemocytes of the shrimp Penaeus merguiensis. Dis. Aquat. Org. 2002, 52, 249–259. [Google Scholar] [CrossRef]
- Xin, L.-S.; Li, C.; Bai, C.-M.; Wang, C.-M. Ostreid Herpesvirus-1 Infects Specific Hemocytes in Ark Clam, Scapharca broughtonii. Viruses 2018, 10, 529. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.; Jia, Z.-H.; Zhang, T.; Wang, L.-L.; Qiu, L.-M.; Sun, J.-S.; Song, L.-S. Functional characterisation of phagocytes in the Pacific oyster Crassostrea gigas. PeerJ 2016, 4, e2590. [Google Scholar] [CrossRef]
- He, Y.; Jouaux, A.; Ford, S.E.; Lelong, C.; Sourdaine, P.; Mathieu, M.; Guo, X. Transcriptome analysis reveals strong and complex antiviral response in a mollusc. Fish Shellfish Immunol. 2015, 46, 131–144. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.-Q.; Zhou, Z.; Jiang, Q.-F.; Wang, L.-L.; Yi, Q.-L.; Qiu, L.-M.; Song, L.-S. The neuroendocrine immunomodulatory axis-like pathway mediated by circulating haemocytes in pacific oyster Crassostrea gigas. Open Biol. 2017, 7, 160289. [Google Scholar] [CrossRef]
- Claver, J.A.; Quaglia, A.I.E. Comparative Morphology, Development, and Function of Blood Cells in Nonmammalian Vertebrates. J. Exot. Pet. Med. 2009, 18, 87–97. [Google Scholar] [CrossRef]
- Nombela, I.; Carrion, A.; Puente-Marin, S.; Chico, V.; Mercado, L.; Perez, L.; Coll, J.; Ortega-Villaizan, M.d.M. Infectious pancreatic necrosis virus triggers antiviral immune response in rainbow trout red blood cells, despite not being infective. F1000Research 2017, 6, 1968. [Google Scholar] [CrossRef]
Gene Name | Primer Name | Sequence (5′→3′) | Accession Number |
---|---|---|---|
IFN1 | IF590 | AAGCAACGAGTCTTTGAGCCT | DQ357216.1 |
IR591a | CGCTCAATCTTCCATCCCTT | ||
EF1α | EF125 | CGCCAGTGTTGCCTTCGT | GQ266394 |
ER126 | CGCTCAATCTTCCATCCCTT | ||
Mx2 | MF428 | ACATTGACATCGCCACCACT | JF699168.1 |
MF429 | TTCTGACCACCGTCTCCTCC | ||
TNFα | TnfF169 | GCTGCTGTCTGCTTCACGC | HQ696609.1 |
TnfR170 | AGCCTGGTCCTGGTTCACTCT | ||
IL-1β | IL-1βF663 | CAGTGCTCCATTTGTGATCAG | MK942107.1 |
IL-1βR664 | GAAATGGCCAGACACACAGG | ||
VP4 | VF146 | CGAAAACCTACCAGTGGATAATG | MN136091 |
VR147 | CCAGCTAATACGCCAACGAC | ||
VP56 | VF73 | AGCAGGCTATTCATCACCAGT | MK675081 |
VR74 | GTTCTAACGCTCACCGTCTTTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, L.; Su, J. Type II Grass Carp Reovirus Infects Leukocytes but Not Erythrocytes and Thrombocytes in Grass Carp (Ctenopharyngodon idella). Viruses 2021, 13, 870. https://doi.org/10.3390/v13050870
Yang L, Su J. Type II Grass Carp Reovirus Infects Leukocytes but Not Erythrocytes and Thrombocytes in Grass Carp (Ctenopharyngodon idella). Viruses. 2021; 13(5):870. https://doi.org/10.3390/v13050870
Chicago/Turabian StyleYang, Ling, and Jianguo Su. 2021. "Type II Grass Carp Reovirus Infects Leukocytes but Not Erythrocytes and Thrombocytes in Grass Carp (Ctenopharyngodon idella)" Viruses 13, no. 5: 870. https://doi.org/10.3390/v13050870
APA StyleYang, L., & Su, J. (2021). Type II Grass Carp Reovirus Infects Leukocytes but Not Erythrocytes and Thrombocytes in Grass Carp (Ctenopharyngodon idella). Viruses, 13(5), 870. https://doi.org/10.3390/v13050870