Characterization of CRISPR Spacer and Protospacer Sequences in Paenibacillus larvae and Its Bacteriophages
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Distribution of CRISPR Spacer Sequences in P. larvae Strains
3.2. CRISPR Spacer Sequence Identification in P. larvae Phage Genomes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Genersch, E. American Foulbrood in honeybees and its causative agent, Paenibacillus larvae. J. Invertebr. Pathol. 2010, 103, S10–S19. [Google Scholar] [CrossRef] [PubMed]
- Genersch, E.; Ashiralieva, A.; Fries, I. Strain- and genotype-specific differences in virulence of Paenibacillus larvae subsp. larvae, a bacterial pathogen causing American foulbrood disease in honeybees. Appl. Environ. Microbiol. 2005, 71, 7551–7555. [Google Scholar]
- Yue, D.; Nordhoff, M.; Wieler, L.H.; Genersch, E. Fluorescence in situ hybridization (FISH) analysis of the interactions between honeybee larvae and Paenibacillus larvae, the causative agent of American foulbrood of honeybees (Apis mellifera). Environ. Microbiol. 2008, 10, 1612–1620. [Google Scholar] [CrossRef] [PubMed]
- Lindström, A.; Korpela, S.; Fries, I. The distribution of Paenibacillus larvae spores in adult bees and honey and larval mortality, following the addition of American foulbrood diseased brood or spore-contaminated honey in honey bee (Apis mellifera) colonies. J. Invertebr. Pathol. 2008, 99, 82–86. [Google Scholar] [CrossRef] [PubMed]
- Genersch, E.; Forsgren, E.; Pentikäinen, J.; Ashiralieva, A.; Rauch, S.; Kilwinski, J.; Fries, I. Reclassification of Paenibacillus larvae subsp. pulvifaciens and Paenibacillus larvae subsp. larvae as Paenibacillus larvae without subspecies differentiation. Int. J. Syst. Evol. Microbiol. 2006, 56, 501–511. [Google Scholar] [PubMed] [Green Version]
- Beims, H.; Bunk, B.; Erler, S.; Mohr, K.I.; Spröer, C.; Pradella, S.; Günther, G.; Rohde, M.; von der Ohe, W.; Steinert, M. Discovery of Paenibacillus larvae ERIC V: Phenotypic and genomic comparison to genotypes ERIC I-IV reveal different inventories of virulence factors which correlate with epidemiological prevalences of American Foulbrood. Int. J. Med. Microbiol. 2020, 310, 151394. [Google Scholar] [CrossRef] [PubMed]
- Murray, K.D.; Aronstein, K.A. Oxytetracycline-resistance in the honey bee pathogen Paenibacillus larvae is encoded on novel plasmid pMA67. J. Apic. Res. 2006, 45, 207–214. [Google Scholar] [CrossRef]
- Miyagi, T.; Peng, C.Y.; Chuang, R.Y.; Mussen, E.C.; Spivak, M.S.; Doi, R.H. Verification of oxytetracycline-resistant American foulbrood pathogen Paenibacillus larvae in the United States. J. Invertebr. Pathol. 2000, 75, 95–96. [Google Scholar] [CrossRef]
- Tian, B.; Fadhil, N.H.; Powell, J.E.; Kwong, W.K.; Moran, N.A. Long-term exposure to antibiotics has caused accumulation of resistance determinants in the gut microbiota of honeybees. mBio 2010, 3, e00377–e00412. [Google Scholar] [CrossRef] [Green Version]
- Hasemann, L. How long can spores of American foulbrood live? Am. Bee J. 1961, 101, 298–299. [Google Scholar]
- Beims, H.; Wittman, J.; Bunk, B.; Sproer, C.; Rohde, C.; Gunther, G.; Rohde, M.; von der Ohe, W.; Steinert, M. Paenibacillus larvae-directed bacteriophage HB10c2 and its application in American Foulbrood-affected honey bee larvae. Appl. Environ. Microbiol. 2015, 81, 5411–5419. [Google Scholar] [CrossRef] [Green Version]
- Ghorbani-Nezami, S.; LeBlanc, L.; Yost, D.G.; Amy, P.S. Phage therapy is effective in protecting honeybee larvae from American Foulbrood disease. J. Insect. Sci. 2015, 15, 84–89. [Google Scholar] [CrossRef] [Green Version]
- Yost, D.G.; Tsourkas, P.; Amy, P.S. Experimental bacteriophage treatment of honeybees (Apis mellifera) infected with Paenibacillus larvae, the causative agent of American Foulbrood disease. Bacteriophage 2016, 6, e1122698. [Google Scholar] [CrossRef] [Green Version]
- Brady, T.S.; Merrill, B.D.; Hilton, J.A.; Payne, A.M.; Stephenson, M.B.; Hope, S. Bacteriophages as an alternative to conventional antibiotic use for the prevention or treatment of Paenibacillus larvae in honeybee hives. J. Invert. Pathol. 2017, 150, 94–100. [Google Scholar] [CrossRef]
- Oliveira, A.; Melo, L.D.R.; Kropinski, A.M.; Azeredo, J. Complete genome sequence of the broad-host-range Paenibacillus larvae phage phiIBB_Pl23. Genome Announc. 2013, 1, e00438–e00513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carson, S.; Bruff, E.; DeFoor, W.; Dums, J.; Groth, A.; Hatfield, T.; Iyer, A.; Joshi, K.; McAdams, S.; Miles, D.; et al. Genome sequences of six Paenibacillus larvae Siphoviridae phages. Genome Announc. 2015, 3, e00101–e00115. [Google Scholar] [CrossRef] [Green Version]
- Abraham, J.; Bousquet, A.-C.; Bruff, E.; Carson, N.; Clark, A.; Connell, A.; Davis, Z.; Dums, J.; Everington, C.; Groth, A.; et al. Paenibacillus larvae Phage Tripp Genome Has 378-Base-Pair Terminal Repeats. Genome Announc. 2016, 4, e01498–e01515. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsourkas, P.K.; Yost, D.; Krohn, A.; Leblanc, L.; Zhang, A.; Stamereilers, C.; Amy, P.S. Complete genome sequences of nine phages capable of infecting Paenibacillus larvae, the causative agent of American Foulbrood disease of honeybees. Genome Announc. 2015, 3, e01120–e01215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Walker, J.K.; Merrill, B.D.; Berg, J.A.; Dhalai, A.; Dingman, D.W.; Fajardo, C.P.; Graves, K.; Hill, H.L.; Hilton, J.A.; Imahara, C.; et al. Complete genome sequences of Paenibacillus larvae phages BN12, Dragolir, Kiel007, Leyra, Likha, Pagassa, PBL1c, and Tadhana. Genome Announc. 2018, 6, e01601–e01617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Merrill, B.D.; Fajardo, C.P.; Hilton, J.A.; Payne, A.M.; Ward, A.T.; Walker, J.K.; Dhalai, A.; Imahara, C.; Mangohig, J.; Monk, J.; et al. Complete genome sequences of eighteen Paenibacillus larvae phages. Genome Announc. 2018, 24, e01602–e01617. [Google Scholar]
- Yost, D.; Chang, C.; LeBlanc, C.; Cassin, E.; Peterman, C.; Rai, P.; Salisbury, A.; Barroga, N.; Cisneros, R.; Fersini, J.; et al. Complete genome sequences of Paenibacillus larvae phages Halcyone, Heath, Scottie, and Unity from Las Vegas, Nevada. Genome Announc. 2018, 7, e00977–e01018. [Google Scholar] [CrossRef] [Green Version]
- Ribeiro, H.G.; Melo, L.D.R.; Oliveira, H.; Boon, M.; Lavigne, R.; Noben, J.P.; Azeredo, J.; Oliveira, A. Characterization of a new podovirus infecting Paenibacillus larvae. Sci. Rep. 2019, 9, 20355. [Google Scholar] [CrossRef] [PubMed]
- Ebeling, J.; Fünfhaus, A.; Genersch, E. The buzz about ADP-Ribosylation toxins from Paenibacillus larvae, the causative agent of American Foulbrood in honey bees. Toxins 2021, 13, 151. [Google Scholar] [CrossRef] [PubMed]
- Stamereilers, C.; LeBlanc, L.; Yost, D.; Amy, P.S.; Tsourkas, P.K. Comparative genomics of 9 novel Paenibacillus larvae bacteriophages. Bacteriophage 2016, 6, e1220349. [Google Scholar] [CrossRef] [Green Version]
- Stamereilers, C.; Fajardo, C.; Walker, J.; Grose, J.H.; Hope, S.; Tsourkas, P.K. Genomic analysis of 48 Paenibacillus larvae bacteriophages. Viruses 2018, 10, 377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oliveira, A.; Leite, M.; Kluskens, L.D.; Santos, S.B.; Melo, L.D.R.; Azeredo, J. The first Paenibacillus larvae bacteriophage endolysin (PlyPl123) with high potential to control American Foulbrood. PLoS ONE 2015, 11, e0150157. [Google Scholar]
- LeBlanc, L.; Nezami, S.; Yost, D.; Tsourkas, P.; Amy, P.S. Isolation and characterization of a novel phage lysin active against Paenibacillus larvae, a honeybee pathogen. Bacteriophage 2015, 5, e1080787. [Google Scholar] [CrossRef]
- Santos, S.B.; Oliveira, A.; Melo, L.D.R.; Azeredo, J. Identification of the first endolysin Cell Binding Domain (CBD) targeting Paenibacillus larvae. Sci. Rep. 2019, 9, 2568. [Google Scholar] [CrossRef] [Green Version]
- Tsourkas, P.K. Paenibacillus larvae bacteriophages: Obscure past, promising future. Microb. Genom 2020, 6, e000329. [Google Scholar] [CrossRef]
- Heler, R.; Marraffini, L.A.; Bikard, D. Adapting to new threats: The generation of memory by CRISPR-Cas immune systems. Mol. Microbiol. 2014, 93, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Marraffini, L.A. CRISPR-Cas immunity in prokaryotes. Nature 2015, 526, 55–61. [Google Scholar] [CrossRef]
- Mojica, F.J.M.; Rodriguez-Valera, F. The discovery of CRISPR in archaea and bacteria. FEBS J. 2016, 283, 3162–3169. [Google Scholar] [CrossRef]
- Amitai, G.; Sorek, R. CRISPR-Cas adaptation: Insights into the mechanism of action. Nat. Rev. Microbiol. 2016, 14, 67–76. [Google Scholar] [CrossRef] [PubMed]
- Bolotin, A.; Quinquis, B.; Sorokin, A.; Ehrlich, S.D. Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 2005, 151, 2551–2556. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deveau, H.; Barrangou, R.; Garneau, J.E.; Labonté, J.; Fremaux, C.; Boyaval, P.; Romero, D.A.; Horvath, P.; Moineau, S. Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J. Bacteriol. 2008, 190, 1390–1400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horvath, P.; Romero, D.A.; Coûté-Monvoisin, A.-C.; Richards, M.; Deveau, H.; Moineau, S.; Boyaval, P.; Fremaux, C.; Barrangou, R. Diversity, activity, and evolution of CRISPR loci in Streptococcus thermophilus. J. Bacteriol. 2008, 190, 1401–1412. [Google Scholar] [CrossRef] [Green Version]
- Mojica, F.J.M.; Díez-Villaseñor, C.; García-Martínez, J.; Almendros, C. Short motif sequences determine the targets of the prokaryotic CRISPR defence system. Microbiology 2009, 155, 733–740. [Google Scholar] [CrossRef] [Green Version]
- Marraffini, L.A.; Sontheimer, E.J. Self versus non-self discrimination during CRISPR RNA-directed immunity. Nature 2010, 463, 568–571. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garneau, J.E.; Dupuis, M.-È.; Villion, M.; Romero, D.A.; Barrangou, R.; Boyaval, P.; Fremaux, C.; Horvath, P.; Magadan, A.H.; Moineau, S. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 2010, 468, 67–71. [Google Scholar] [CrossRef]
- Hale, C.R.; Zhao, P.; Olson, S.; Duff, M.O.; Graveley, B.R.; Wells, L.; Terns, R.M.; Terns, M.P. RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex. Cell 2009, 139, 945–956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marraffini, L.A.; Sontheimer, E.J. CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 2008, 322, 1843–1845. [Google Scholar] [CrossRef] [Green Version]
- Jiang, F.; Doudna, J.A. The structural biology of CRISPR-Cas systems. Curr. Opin. Struct. Biol. 2015, 30, 100–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van der Oost, J.; Westra, E.R.; Jackson, R.N.; Wiedenheft, B. Unravelling the structural and mechanistic basis of CRISPR–Cas systems. Nat. Rev. Microbiol. 2014, 12, 479–492. [Google Scholar] [CrossRef]
- Wiedenheft, B.; Sternberg, S.H.; Doudna, J.A. RNA-guided genetic silencing systems in bacteria and archaea. Nature 2012, 482, 331–338. [Google Scholar] [CrossRef] [PubMed]
- Grissa, I.; Vergnaud, G.; Pourcel, C. CRISPRFinder: A web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007, 35, W52–W57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Liang, Y.; Lynch, K.H.; Dennis, J.J.; Wishart, D.S. PHAST: A fast phage search tool. Nucleic Acids Res. 2011, 39, W347–W352. [Google Scholar] [CrossRef] [PubMed]
- Arndt, D.; Grant, J.; Marcu, A.; Sajed, T.; Pon, A.; Liang, Y.; Wishart, D.S. PHASTER: A better, faster version of the PHAST phage search tool. Nucleic Acids Res. 2016, 44, W16–W21. [Google Scholar] [CrossRef] [Green Version]
- Crooks, G.E.; Hon, G.; Chandonia, J.M.; Brenner, S.E. WebLogo: A sequence logo generator. Genome Res. 2004, 14, 1188–1190. [Google Scholar] [CrossRef] [Green Version]
- Hargreaves, K.R.; Flores, C.O.; Lawley, T.D.; Clokie, M.R. Abundant and diverse clustered regularly interspaced short palindromic repeat spacers in Clostridium difficile strains and prophages target multiple phage types within this pathogen. mBio 2014, 5, e01045–e01113. [Google Scholar] [CrossRef] [Green Version]
- Kuno, S.; Yoshida, T.; Kaneko, T.; Sako, Y. Intricate interactions between the bloom-forming cyanobacterium Microcystis aeruginosa and foreign genetic elements, revealed by diversified clustered regularly interspaced short palindromic repeat (CRISPR) signatures. Appl. Environ. Microbiol. 2012, 78, 5353–5360. [Google Scholar] [CrossRef] [Green Version]
- Savitskaya, E.; Semenova, E.; Dedkov, V.; Metlitskaya, A.; Severinov, K. High-throughput analysis of type I-E CRISPR/Cas spacer acquisition in E. coli. RNA Biol. 2013, 10, 716–725. [Google Scholar] [CrossRef] [Green Version]
- Bourgeois, J.; Lazinski, D.W.; Camilli, A. Identification of spacer and protospacer sequence requirements in the Vibrio cholerae Type I-E CRISPR/Cas System. mSphere 2020, 5, e00813–e00820. [Google Scholar] [CrossRef]
- Lopatina, A.; Medvedeva, S.; Artamonova, D.; Kolesnik, M.; Sitnik, V.; Ispolatov, Y.; Severinov, K. Natural diversity of CRISPR spacers of Thermus: Evidence of local spacer acquisition and global spacer exchange. Phil. Trans. R. Soc. Lond. Ser. B Biol. Sci. 2019, 374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yi, H.; Huang, L.; Yang, B.; Gomez, J.; Zhang, H.; Yin, Y. AcrFinder: Genome mining anti-CRISPR operons in prokaryotes and their viruses. Nucleic Acids Res. 2020, 48, W358–W365. [Google Scholar] [CrossRef] [PubMed]
- Westra, E.R.; Semenova, E.; Datsenko, K.A.; Jackson, R.N.; Wiedenheft, B.; Severinov, K.; Brouns, S.J.J. Type I-E CRISPR-Cas systems discriminate target from non-target DNA through base pairing-independent PAM recognition. PLoS Genet. 2013, 9, e1003742. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Semenova, E.; Jore, M.M.; Datsenko, K.A.; Semenova, A.; Westra, E.R.; Wanner, B.; van der Oost, J.; Brouns, S.J.; Severinov, K. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence. Proc. Natl. Acad. Sci. USA 2011, 108, 10098–10103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Philipson, C.W.; Voegtly, L.J.; Lueder, M.R.; Long, K.A.; Rice, G.K.; Frey, K.G.; Biswas, B.; Cer, R.Z.; Hamilton, T.; Bishop-Lilly, K.A. Characterizing phage genomes for therapeutic applications. Viruses 2018, 10, 188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
P. larvae Strain | No. of CRISPR Arrays | No. of Spacers | No. of Unique Spacers | P. larvae Genotype | GenBank Accession Number |
---|---|---|---|---|---|
ATCC 9545 | 4 | 17 | 17 | ERIC I | CP019687 |
DSM 7030 | 4 | 17 | 17 | ERIC I | CP019651 |
DSM 25430 | 1 | 8 | 5 | ERIC II | CP003355 |
SAG 10367 | 7 | 169 | 159 | ERIC II | CP020557 |
LMG 16252 | 6 | 95 | 93 | ERIC III | CP019655 |
ATCC 13537 | 7 | 97 | 95 | ERIC IV | CP019794 |
CCM 38 | 7 | 97 | 95 | ERIC IV | CP020327 |
LMG 16247 | 7 | 98 | 96 | ERIC IV | CP019659 |
DSM 106052 | 6 | 116 | 111 | ERIC V | CP019717 |
1 Strain | 2 Strains | 3 Strains | 4 Strains | 5 Strains | 6 Strains | 8 Strains | |
---|---|---|---|---|---|---|---|
No. of spacers found in | 254 | 30 | 12 | 83 | 2 | 1 | 2 |
% of spacers found in | 66.1% | 7.8% | 3.1% | 21.6% | 0.5% | 0.25% | 0.5% |
P. larvae Strain | No. of Prophages | No. of Spacers Located in Prophages | ||||
---|---|---|---|---|---|---|
Intact | Questionable | Incomplete | Intact | Questionable | Incomplete | |
ATCC 9545 | 5 | 2 | 10 | 0 | 0 | 0 |
DSM 7030 | 5 | 1 | 12 | 0 | 0 | 0 |
DSM 25430 | 2 | 1 | 9 | 0 | 0 | 0 |
SAG 10367 | 5 | 7 | 12 | 0 | 0 | 1 |
LMG 16252 | 8 | 3 | 7 | 0 | 1 | 0 |
ATCC 13537 | 5 | 3 | 6 | 0 | 0 | 1 |
CCM 38 | 6 | 3 | 11 | 0 | 1 | 1 |
LMG 16247 | 4 | 5 | 8 | 0 | 2 | 0 |
DSM 106052 | 5 | 5 | 14 | 0 | 0 | 0 |
Protospacer Sequence | Protospacer Length (bp) | Strains Containing Protospacer | Phages Containing Protospacer | Gene Containing Protospacer | |
---|---|---|---|---|---|
1 | AACAATTACAAATATGCAACTGAAGCAGATGTAAAT | 36 | DSM 7030 | Harrison Paisley | ERF superfamily single-stranded DNA binding |
2 | AACGATTTTACAACGATTATAACACGTAAATACAAG | 36 | SAG 10367 | Tripp | Intergenic |
3 | AGAAAAACTGGACGGGTTAAACACACATTTGGCG | 34 | SAG 10367 | Arcticfreeze, Bloom, DevRi, Genki, Gryphonian, HB10c2, Honeybear, Jacopo, Kiel007, Likha, Lucielle, Pagassa, PBL1c, Redbud Saudage, Tadhana Toothless, Xenia, Yerffej | Large Terminase |
4 | AGCACATAAGTAAAGGAATACCCCCGGCTCTGGACATT | 38 | DSM 106052 | Ash C7Cdelta Ley | Hypothetical |
5 | ATCCGGTGCATCAGAGATTGGCTCAACTGTATTTCAA | 37 | ATCC 13537 CCM 38 LMG 16247 LMG 16252 | LincolnB Wanderer | Hypothetical |
6 | CAGAAGTACCCCTTGGGACATATGATGTGAAGATT | 35 | ATCC 13537 CCM 38 LMG 16247 LMG 16252 | LincolnB Wanderer | Hypothetical |
7 | CGAACATATCCGGAGTCAACTATATCAGACTCACTCA | 37 | SAG 10367 | Fern, Kawika, Lily, Lucielle, Saudage, Willow | Replicative DNA helicase |
8 | GAATTTGTAAAAGTTCTACAAGATGAAGATATTAC | 35 | ATCC 13537 CCM 38 LMG 16247 LMG 16252 | Lily | Hypothetical |
9 | GAGCAAGCTGCAACAGAACCGAAATGGACCACT | 33 | DSM 106052 | LincolnB Wanderer | Hypothetical |
10 | GGAAACTGGCGAGCGCATCGTATGGGGGACTGCATCG | 37 | SAG 10367 | Tripp | Hypothetical |
11 | GGAAATGATGGAGAGATACATAGAGCATTTGCCA | 34 | SAG 10367 | API480 | Hypothetical |
12 | GGAAGCTGACCGAAAGAGACTAATCGCCGTACAAGA | 36 | DSM 106052 | Ash, C7Cdelta, Ley, Tripp | DNA polymerase |
13 | GTGCTTGACCACATGGGGGCATTCATGGAAACA | 32 | DSM 106052 | Lily | Baseplate |
14 | GTTAGACGAGCGTGTGAGGAGGCTGCAACAGGCA | 34 | SAG 10367 | Harrison, Paisley | DNA replication |
15 | TCCCTACCAAAAGGAGGGTAGGATTAGTGGAAGTT | 35 | CCM 38 LMG 16247 LMG 16252 | Kawika | Intergenic |
16 | TCTAGAAGCCATTGTCAAAAAAATCACGGAAGTGTT | 36 | SAG 10367 | Lucielle, Genki, Gryphonian, PBL1c | Tail Tape Measure |
17 | TGCGGAGGGCAATCCCAACAGACTGACGAAAGAA | 34 | SAG 10367 | Dragolir, LincolnB Wanderer | Small Terminase |
18 | TTACAGGGGCAGGGAGGTACAGAAGATAGGAGGTAC | 36 | DSM 25430 | Harrison, Paisley | Hypothetical |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stamereilers, C.; Wong, S.; Tsourkas, P.K. Characterization of CRISPR Spacer and Protospacer Sequences in Paenibacillus larvae and Its Bacteriophages. Viruses 2021, 13, 459. https://doi.org/10.3390/v13030459
Stamereilers C, Wong S, Tsourkas PK. Characterization of CRISPR Spacer and Protospacer Sequences in Paenibacillus larvae and Its Bacteriophages. Viruses. 2021; 13(3):459. https://doi.org/10.3390/v13030459
Chicago/Turabian StyleStamereilers, Casey, Simon Wong, and Philippos K. Tsourkas. 2021. "Characterization of CRISPR Spacer and Protospacer Sequences in Paenibacillus larvae and Its Bacteriophages" Viruses 13, no. 3: 459. https://doi.org/10.3390/v13030459
APA StyleStamereilers, C., Wong, S., & Tsourkas, P. K. (2021). Characterization of CRISPR Spacer and Protospacer Sequences in Paenibacillus larvae and Its Bacteriophages. Viruses, 13(3), 459. https://doi.org/10.3390/v13030459