Next Article in Journal
Possible Arbovirus Found in Virome of Melophagus ovinus
Previous Article in Journal
Retrospective Characterization of Initial Peste des petits ruminants Outbreaks (2008–2012) in the Democratic Republic of the Congo
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptome Sequencing of the Spleen Reveals Antiviral Response Genes in Chickens Infected with CAstV

by
Joanna Sajewicz-Krukowska
1,*,
Jan Paweł Jastrzębski
2,
Maciej Grzybek
3,
Katarzyna Domańska-Blicharz
1,
Karolina Tarasiuk
1 and
Barbara Marzec-Kotarska
4
1
Department of Poultry Diseases, National Veterinary Research Institute, 24-100 Puławy, Poland
2
Department of Plant Physiology, Genetics and Biotechnology, Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, 10-719 Olsztyn, Poland
3
Department of Tropical Parasitology, Institute of Maritime and Tropical Medicine, Medical University of Gdansk, 81-519 Gdynia, Poland
4
Department of Clinical Pathomorphology, The Medical University of Lublin, 20-090 Lublin, Poland
*
Author to whom correspondence should be addressed.
Viruses 2021, 13(12), 2374; https://doi.org/10.3390/v13122374
Submission received: 11 October 2021 / Revised: 19 November 2021 / Accepted: 22 November 2021 / Published: 26 November 2021
(This article belongs to the Topic Veterinary Infectious Diseases)

Abstract

Astrovirus infections pose a significant problem in the poultry industry, leading to multiple adverse effects such as a decreased egg production, breeding disorders, poor weight gain, and even increased mortality. The commonly observed chicken astrovirus (CAstV) was recently reported to be responsible for the “white chicks syndrome” associated with an increased embryo/chick mortality. CAstV-mediated pathogenesis in chickens occurs due to complex interactions between the infectious pathogen and the immune system. Many aspects of CAstV–chicken interactions remain unclear, and there is no information available regarding possible changes in gene expression in the chicken spleen in response to CAstV infection. We aim to investigate changes in gene expression triggered by CAstV infection. Ten 21-day-old SPF White Leghorn chickens were divided into two groups of five birds each. One group was inoculated with CAstV, and the other used as the negative control. At 4 days post infection, spleen samples were collected and immediately frozen at −70 °C for RNA isolation. We analyzed the isolated RNA, using RNA-seq to generate transcriptional profiles of the chickens’ spleens and identify differentially expressed genes (DEGs). The RNA-seq findings were verified by quantitative reverse-transcription PCR (qRT-PCR). A total of 31,959 genes was identified in response to CAstV infection. Eventually, 45 DEGs (p-value < 0.05; log2 fold change > 1) were recognized in the spleen after CAstV infection (26 upregulated DEGs and 19 downregulated DEGs). qRT-PCR performed on four genes (IFIT5, OASL, RASD1, and DDX60) confirmed the RNA-seq results. The most differentially expressed genes encode putative IFN-induced CAstV restriction factors. Most DEGs were associated with the RIG-I-like signaling pathway or more generally with an innate antiviral response (upregulated: BLEC3, CMPK2, IFIT5, OASL, DDX60, and IFI6; downregulated: SPIK5, SELENOP, HSPA2, TMEM158, RASD1, and YWHAB). The study provides a global analysis of host transcriptional changes that occur during CAstV infection in vivo and proves that, in the spleen, CAstV infection in chickens predominantly affects the cell cycle and immune signaling.

1. Introduction

Astroviruses cause enteritis in humans and other animals such as chickens, turkeys, sheep, cattle, swine, dogs, cats, and mice. In poultry, they cause enteritis combined with growth depression and a higher mortality, but their presence has also been described in healthy flocks [1]. The cause of such a phenomenon may be the existence of astroviruses of various virulence, but also the possibility of inducing a disease through the synergistic effect of several viruses simultaneously, e.g., astroviruses with rotaviruses or parvoviruses [2]. Furthermore, other enteric pathogens such as avian nephritis virus (ANV), avian orthoreoviruses, and fowl adenoviruses are often detected in co-infections with CAstV. CAstV infections spread mainly horizontally via the fecal–oral route. However, CAstV strains also transmit vertically from naive parent birds to chicks [3].
Astroviruses detected in various bird species belong to the Astroviridae family, genus Avastrovirus. Initially, they were classified into separate species depending on the host from which they were isolated. Since astroviruses may cross species barriers [4], the principles of their classification have been changed based on the amino acid structure of the viral capsid protein. Astroviruses detected in birds belong to three official species of astroviruses: one, two, and three [5].
Two different types of astroviruses, ANV and CAstV, have been identified in broiler chickens. ANV infection causes diarrhea, growth retardation, kidney damage, and gout, resulting in an increased mortality, especially in young chickens [6,7]. CAstV infections are associated with malabsorption syndrome/runting stunting syndrome [8,9,10,11]. CAstV can also cause pathology of the gastrointestinal tract (enteropathy), lameness, kidney inflammation, and embryo death. Astrovirus infections can significantly impact the poultry industry through a decreased egg production, breeding disorders, poor weight gain relative to feed intake, and increased mortality [12]. Relatively recently, CAstV has also been indicated as the causal factor of “white chicks syndrome” (WCS) affecting broiler chicks [13,14,15,16,17,18,19]. WCS is associated with an increased embryo/chick mortality, delayed hatching, weakness, and white plumage on hatched chicks. WCS can also induce subcutaneous edema and severe lesions in organs (mainly liver). To date, many aspects of CAstV–chicken interactions remain unclear, and there is no information available regarding gene expression changes in chicken spleen in response to CAstV infection.
The host’s ability to recognize and eliminate harmful pathogens is essential to its survival. These host–pathogen interactions are crucial in the disease course and are the subject of several studies that underline the essential role of the immune response and its antiviral receptors [20,21,22,23]. Virus–host interactions are determined mainly by pathogen virulence and host immune responses, which lead to changes in host gene expression [24]. Thus, pathogenesis involves complex interactions between the infectious pathogen and the immune system.
To activate an antiviral response, pattern recognition receptors (PRRs) must recognize specific pathogen-associated molecular patterns [25,26,27]. PRR activation leads to type I interferon (IFN) induction, cytokine secretion, and the activation of antigen-presenting cells. These, in turn, promote adaptive immune responses [28,29]. PRRs fall into four categories: the retinoic acid-inducible gene I (RIG-I)-like receptors, the Toll-like receptors, the NOD-like receptor, and the C-type lectin receptors. RIG-I-like receptors are ubiquitously expressed in the cytoplasm and comprise RIG-I, melanoma differentiation-associated gene 5 (MDA5), and the laboratory of genetics and physiology 2 (LGP2). RIG-I and MDA5 interact with the mitochondrial antiviral signaling gene MAVS [30], leading to transcriptional factor nuclear factor kappa B (NF-κB) activation and the production of type I IFNs and proinflammatory cytokines [31]. This condition then induces IFN-stimulated gene (ISG) expression to elicit antiviral effects. RIG-I and MDA5 are two key pattern recognition receptors that sense an RNA virus invasion, but RIG-I is absent in chickens. Although chickens have an intact MDA5 gene, the genes acting downstream of chicken MDA5 that may mediate antiviral responses are not well studied [32].
The essential processes in living cells depend on the actions of proteins and ribonucleic acids (RNAs and DNAs). Knowledge about molecules involved in a particular function is essential to better understand and even modulate cell activity.
To better understand the interactions between the host and CAstV, we analyzed transcriptional profiles of the chickens’ spleens on the fourth day post infection (dpi) using RNA-seq. The sequencing results were compared and screened for differentially expressed genes (DEGs), using the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases in the National Center for Biotechnology Information (NCBI). DEGs were verified by quantitative reverse-transcription PCR (qRT-PCR). Our results provide a foundation for future research on the pathogenesis of CAstV infection and may facilitate the discovery of candidate genes that can respond to and resist CAstV infection in chickens.

2. Materials and Methods

2.1. Virus and Animals

The CAstV strain PL/G059/2014 (GenBank accession no. JF414802), associated with “white chicks syndrome”, was propagated on embryonated specific pathogen-free (SPF) chicken eggs as described previously [16,19]. Internal organs of PL/G059/2014 chicken embryos homogenate were stored at −70 °C until further use.
SPF chicken embryos were obtained from VALO BioMedia (Osterholz-Scharmbeck, Germany) and housed in isolators until use.

2.2. Animal Experiments

Ten 21-day-old SPF White Leghorn chickens were divided into two groups of five birds each. One group was inoculated with CAstV, and the other was inoculated with sterile phosphate-buffered saline (PBS) and used as the negative control. Inoculations were given per os using 200 μL of a supernatant obtained after centrifugation of internal organs of PL/G059/2014 chicken embryos homogenized in PBS (20% wt/vol). Cloacal swabs were collected from infected chicks on the second and fourth days post inoculation to check for the presence of virus, as described in [33].
Chickens from each group were taken for necropsy at 4 dpi. Spleen samples were collected and immediately frozen at −70 °C for RNA isolation. Tissue samples were homogenized in RLT buffer containing β-mercaptoethanol, by use of an MP FastPrep-24 Tissue and Cell Homogenizer. Total RNA was extracted from 200 μL of tissue homogenate using a commercial kit (RNeasy Mini Kit; QIAGEN, Hilden, Germany) according to the manufacturer’s instructions.

2.3. RNA Quantification and Quality Control

RNA concentrations were measured using a Qubit RNA Assay Kit and a Qubit Fluorometer (Invitrogen, Carlsbad, CA, USA). RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA) for further cDNA synthesis and sequencing. The RNA integrity number (RIN) of each sample exceeded the threshold of 7.

2.4. Library Preparation for Transcriptome Sequencing

Ten cDNA libraries were created, using an external commercial service (Macrogen Europe B.V., Amsterdam, the Netherlands). The sequencing libraries were generated from total RNA, using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the protocol in the TruSeq Stranded mRNA Sample Preparation Guide, Part #15031047 Rev. E. Libraries were sequenced on an Illumina NovaSeq 6000 System and 150 bp paired-end reads were generated.

2.5. Data Analysis

The quality control of both raw reads and trimmed reads was performed using FastQC v0.11.7 software [34]. The adapters and low-quality bases (average PHRED cut-off score < 30, cutting length up to 120 bp, minimal length 50 bp) were trimmed using Trimmomatic v0.38 [35]. The preprocessed paired-end reads were mapped to the reference chicken ENSEMBL genome (ver. GRCg6a.96) with the STAR (v2.7.0d) mapper [36]. The mapping results files were then merged using StringTie v1.3.5 [37], and expression in counts (number of reads aligned to the genome) and FPKM (normalized counts by the gene length and library depth) units were calculated using ballgown v2.14.1 [38].
The DEG analyses were performed using DESeq2 [39] in Bioconductor/R [40]. Only genes of adjusted p-value < 0.05 and absolute value of log2 fold change > 1 were classified as DEGs. The DEGs were subjected to functional enrichment analysis through the use of g:ProfileR [41] based on Gene Ontology (GO) [42] and the Kyoto Encyclopedia of Genes and Genomes (KEGG) [43] databases.

2.6. Accession Number

The raw sequencing data obtained in this study were submitted to the Sequence Read Archive (SRA) database under accession number PRJNA768620. The sequences were released on 30 October 2021.

2.7. qRT-PCR for Confirmation

Four immune-related genes (OASL, IFIT5, RASD1, DDX60) were selected for confirmation of the RNA-seq results. Five control and five infected chickens were subjected to the study. Each sample was analyzed in duplicate. The primers and probes used for qRT-PCR assays are listed in Table 1. qRT-PCR was performed in a reaction volume of 20 μL with the 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), using the QuantiTect Probe RT-PCR Kit (QIAGEN) according to the manufacturer’s instructions. Primers and probes used in the study were previously described or are commercially available [44,45] (Table 1). The PCR cycling conditions were the following: one cycle of 50 °C for 30 min and one cycle of 95 °C for 15 min, followed by 95 °C for 15 s and 60 °C for 60 s for 40 cycles.

2.8. Statistical Analysis of qRT-PCR

The relative levels of expression of the target genes in the infected and control groups were calculated using the 2−ΔΔCt method and quantified relative to β-actin. β-actin was used as a housekeeping gene to normalize the expression levels of the target genes, which were then expressed as the fold change in gene expression.

3. Results

3.1. Clinical Features of the CAstV-infected Chickens

Chickens infected with CAstV showed no symptoms for up to 4 dpi. We also did not observe any visible differences in the spleens between the control and infection groups. However, the CAstV did replicate in the infected chickens, as viral RNA was detected in cloacal swabs at 4 dpi.

3.2. Differential Expression Analysis

A total of 393,831,314 reads was produced, comprising 58.9 Gbp. To ensure the best results for a further analysis, raw reads were filtered to remove low-quality data, with a total of over 338.4 million clean reads acquired, a mean of 90.2% of which was mapped to the chicken reference genome. The statistical metrics for the RNA libraries are listed in Table 2. We analyzed the DEGs with the DESeq R package. A total of 31,959 genes were identified in response to CAstV infection. When comparing the control and virus-infected groups, 204 significantly differentially (p-value < 0.05) expressed transcripts were noted, with 152 up-regulated (log2 fold change > 0) and 52 down-regulated (log2 fold change < 0). Subsequently, the transcripts were filtered using the thresholds of p-value < 0.05 and log2 fold change > 1. Under these criteria, 45 DEGs were identified in the spleen after CAstV infection (26 upregulated DEGs and 19 downregulated DEGs). These results were clearly visualized by clustering the samples by the differential treatment (Figure 1) and by constructing an MA plot of the DEGs (Figure 2). A list of the DEGs is provided in Supplementary File S1.

3.3. GO Analysis of DEGs after CAstV Infection

To identify differentially expressed gene functions, a gene ontology (GO) analysis was performed. This allowed us to categories and annotate DEGs into three groups: biological processes, molecular functions, and cellular components. Different gene functional distributions were noted upon comparing the transcriptional profiles of the CAstV-infected chickens with the control. The most enriched biological processes were those related to the cell cycle, the immune response, and the regulation of biological processes. Among the molecular functions group, the most enriched were processes, with the most significant molecular functions being the binding activity, including ATP binding. The cellular component of the GO analysis showed that the majority of enriched categories was relevant to intracellular components, such as chromosomes, kinetochores, or the microtubule cytoskeleton. A list of all GO terms has been listed in Supplementary File S2.

3.4. Pathway Enrichment after CAstV Infection in the Chicken Spleen

The KEGG database was used to analyze pathways to further define DEG functions in the chicken spleen after CAstV infection. At 4 dpi, there were significant changes in the mRNA levels of a set of genes in distinct pathway categories. We found that the virus elicited the enrichment of genes associated with immune-related pathways, including the NOD-like receptor signaling pathway and influenza A pathway, and the cell cycle. These three significantly enriched KEGG pathways are listed in Table 3 according to their p-values < 0.05.
DEGs belonging to immune-related pathways and those associated with the cell cycle are listed in Table 4.

3.5. Verification of DEGs by qRT-PCR

In order to further confirm the differential gene expression obtained from the transcriptome sequencing data, we used qRT-PCR to analyze the expression levels of four selected genes (OASL, IFIT5, RASD1, DDX60). The gene selection was based not only on their log2 fold change and p-value threshold, but also on their biological relevance.
As shown in Figure 3 and Table 5, the expression of two genes (IFIT, OASL) differed significantly between the two studied groups, while two others (RASD1 and DDX60) showed only a trend, possibly due to the small cohort sizes, toward a difference in both the RNA-seq and qRT-PCR analyses. These results supported the reliability of the differential expression identified using RNA-seq.

4. Discussion

White chicks syndrome (WCS) has recently been associated with CAstV. Ongoing outbreaks of WCS have been reported in Canada, Brazil, and some countries in Europe, including Poland [16,18,46,47]. Studies have described an increased embryo mortality in hatcheries. Hatched birds are sick and characterized by general weakness and white fluff. These birds rarely survive for more than 24 h. Molecular studies have found CAstV RNA in tissues of infected chickens [11].
Many reports have analyzed the transcriptomes of various avian tissues in viral infections [48,49,50,51,52,53], providing primary data for understanding the molecular mechanisms of viral infections in birds. Previous studies on CAstV focused mainly on the molecular characterization of the strains circulating in the field, while the biological processes, including immunological aspects and the cellular impact of WCS, or any CAstV infection, are poorly understood and studied.
Only a few studies on the immunology of TAstV (turkey astrovirus) infection in turkeys [54,55] and cytokine expression in day-old chicks with WCS have been published [46]. Here, to further facilitate investigations into CAstV pathogenesis and chickens’ response to infection, we performed a spleen transcriptome analysis in uninfected chickens and in chickens 4 dpi following infection with a WCS CAstV strain.
The global profile of gene expression in the spleen provided a good overview of the host response to CAstV infection. We chose the spleen because it is a secondary lymphoid organ that can effectively induce innate and adaptive immune responses that are especially important in birds because their lymphatic vessels and lymph nodes are underdeveloped [56].
Using RNA-seq, we identified DEGs in the chicken spleen during infection, focusing on the genes with a differential expression meeting the FC threshold (FC ≥ 1 or ≤ −1) for a further analysis. Numerous genes displayed significantly altered expression levels in the CAstV-infected chickens, including several that may be associated with intracellular responses to infection by chicken astrovirus (BLEC3, CMPK2, IFIT5, OASL, DDX60, AVD, GZMA, LYGL, and IFI6). Most of them are associated with the RIG-I-like signaling pathway or more generally with the innate antiviral response.
Interestingly, BLEC3 is predicted to have immune functions. The exact functions of BLEC3 in the anti-virus response are unknown, but it is probably an early activation antigen that may signal by binding BLEC2 [57]. CMPK2 is involved in HIV restriction in humans [58]. Our results may indicate that CMPK2 upregulation inhibits the virus in infected chickens. The next overexpressed gene, DDX60, has been shown to be involved in both RIG-I activation and in RIG-I independent viral RNA degradation [59]. IFIT5 is another antiviral response gene, with activity against RNA viruses such as orthomyxoviruses (e.g., avian influenza viruses) and paramyxoviruses (e.g., Newcastle disease virus) in chickens and Tembusu virus in ducks [60,61]. OASL is an important and possibly RIG-I-dependent inhibitor of RNA virus replication that prevents the virus from escaping from innate immunity. Ren et al. have reported that the newly described Chinese goose astrovirus, GAstV-GD, can induce a high-level expression of OASL, an essential host factor that limits viral replication in LMH cells (a chicken liver cell line) [62,63]. Our results suggest that CAstV is also effective in increasing OASL mRNA levels in vivo. The AVD gene encodes avidin, a likely host defense factor in chickens [64,65]. It inhibits microbial growth by binding to the biotin required by most bacteria as an essential enzyme cofactor. Lysozyme hydrolyses glycosidic bonds in bacterial peptidoglycan and is used as a natural preservative in meat products [66]. The antiviral spectrum of lysozyme is much less well known and mainly includes HSV1 and HIV-1 [67]. The strongly increased expression of the AVD and LYGL (Lysozyme G-like) genes after CAstV infection may be additional evidence of their antiviral function. Granzyme A is secreted by cytotoxic lymphocytes and mediates cell death and promotes inflammation. It also plays an important role in antiviral immunity, being necessary for the control of viral replication [68], and is significantly increased in the sera of patients and in the NK cells of mice infected with CHIKV [69]. Finally, IFI6 delays apoptosis [70], lowers the titer of yellow fever virus in cell cultures, and strongly regulates Dengue 2 virus and West Nile virus infections [71,72].
Here, we provided in vivo evidence suggesting that these most-overexpressed DEGs were putative IFN-induced CAstV restriction factors. A better understanding of viral restriction may be helpful in developing new targeted therapies capable of controlling CAstV and other viral infections. Future studies should focus on understanding the degree of adaptive pressure these genes exert on CAstV. Their resistance to antiviral agents is probably the best measure of their importance [58].
In our study, we found that CAstV also significantly suppressed the mRNA levels of several genes (SPIK5, SELENOP2, HSPA2 (HSP70), TMEM158, RASD1, and 14-3-3β (YWHAB)).
In humans, the SPIK5 gene encodes proteins involved in inhibiting the immune and inflammatory responses in human primary keratinocytes and mucous epithelium [73]. In chickens, the product of the SPIK5 gene, ovoinhibitor, plays a significant role in the antibacterial defense of eggs against Bacillus spp. Moreover, the downregulation of SPIK5 expression after ILTV vaccination induces immune responses [74,75]. We also found a significant downregulation of the expression of the selenoprotein P (SELENOP) gene, which is involved in the antioxidant, anti-inflammatory, and antiviral activities of selenium. RNA viruses, including coxsackievirus B3 and influenza A H3N2, can mutate into more virulent strains in a selenium-deficient host [76,77]. It has also been shown that severe serum selenium and SELENOP deficiency in patients with COVID-19 is associated with a higher risk of dying from COVID-19 [78]. Murai et al. shown that the expression of selenoprotein P mRNA in the liver increases after HCV infection [79]. SELENOP mRNA suppresses the response of type I interferon by inhibiting the properties of RIG-I. Conversely, the downregulation of SELENOP mRNA in our study probably caused a strong induction of the RIG-I-like pathway and, consequently, interferon-stimulated genes [79]. Heat-shock proteins (HSPs), including HSP70, are essential for cell survival during stress. Infection by viruses induces HSP expression and facilitates viral production [80]. HSP70 is involved in viral entry to the cell, uncoating, and genome replication and expression [81,82]. It is associated with the formation of the viral replication–transcription complex and regulates the replication of hepatitis C virus [83], flock house virus [84], and herpes simplex virus type 1 [85]. We also found that the mRNA level of RASD1, which encodes a member of the RAS superfamily of small G-proteins, was decreased. The role of the RASD1 protein in host–virus interactions is not entirely clear. However, there is evidence to suggest that the activation of the Ras pathway is essential for an efficient viral protein synthesis [86]. We did not find examples in the literature describing the action of TMEM158 in viral infection. However, Cheng et al. showed that TMEM158 expression notably inhibits the proliferation, cell cycle progression, adhesion, invasion, and tumorigenicity of ovarian cells [87]. The silencing of TMEM158 in ovarian cancer cells promoted a G1-phase arrest, which may inhibit cell proliferation. Based on the results of our research, it can be assumed that the downregulation of TMEM158 gene expression after astrovirus infection may also lead to the negative regulation of the cell cycle and cell-cycle arrest [88]. The 14-3-3 protein family plays a key role in the regulation of intracellular signaling pathways [89]. They also participate in the control of the cell cycle, metabolism, apoptosis, and gene transcription [90]. They influence a variety of signal transduction pathways and are targeted by viruses that modulate their activity to alter cellular processes and facilitate viral invasion. The 14-3-3 protein interacts with the HIV Vpr protein and regulates the cell cycle by binding to Cdc25C and inducing a G2-M arrest during HIV infection [91]. Moreover, the NS3 protein of dengue, Zika, and West Nile viruses binds to 14-3-3ε/η and prevents RIG-I translocation to the adaptor protein, thereby blocking antiviral signaling in humans [92,93,94]. Little is known about the role of the 14-3-3β protein in chickens, but we can assume that it is analogous to that of other isoforms.
The next step in our study was the enrichment analysis of DEGs. We analyzed the pathway enrichment, the biological functions and the molecular processes in which these pathways are involved. Our goal was to understand the host responded to CAstV infection, so pathway analysis alone might not have been sufficient. The NOD-1 signaling pathway involved extremely dynamic molecular interactions. Detecting alterations in this pathway did not necessarily provide a complete picture of the biological effects. Moreover, the KEGG analysis revealed three enriched pathways, compared with several hundred biological processes.
The GO analysis showed that the most upregulated genes were mainly involved in immunity and defense, and the response to and regulation of viral/biological processes, while the downregulated gene functions were mainly related to the regulation of biological processes. Some were not classified into any biological process.
KEGG signaling pathway annotations to the DEGs showed that the expression of immune response-related genes at 4 dpi mainly involved the NOD-like receptor signaling pathway and influenza A pathway. A third group of DEGs was also enriched in the cell cycle pathway.
We used qRT-PCR to verify the relative expression of four immunity-related genes. The results showed that the expression of these genes was consistent with the transcriptome sequencing results.
Interactions between the host and the virus included cellular and immune responses and the countermeasures used by the viruses themselves. A small viral genome and high replication and mutation rates present a constant challenge to the host. Thus, viruses either evade detection or modulate host physiology to make cellular pathways work to their advantage. To avoid detection, they can impair host cellular processes such as cell cycle regulation, including checkpoint deregulation [95], major histocompatibility complex-restricted antigen presentation, intracellular protein transport, apoptosis, cytokine-mediated signaling, and humoral responses.
The interaction of a virus with the cell cycle can have various effects, such as promoting viral DNA genome replication or a cell cycle delay to allow sufficient time for RNA virus assembly [95]. Cell cycle control is well characterized in DNA viruses and retroviruses, whose primary replication site is the nucleus. Little is known in the case of RNA viruses, and especially the poorly characterized chicken astroviruses, whose primary replication site is the cytoplasm [96]. The RNA virus alteration of the host cell cycle and its mechanisms are not well characterized. It is assumed that a cell cycle arrest can benefit viral replication. For the negative-strand RNA viruses, there are several examples of cell cycle control. For instance, measles virus infection results in a G0 block, and the paramyxovirus simian virus V protein prolongs the cell cycle by delaying cells in G1 and G2 [97,98]. In the case of positive-strand RNA viruses, the avian coronavirus infectious bronchitis virus delays cell growth by inhibiting cytokinesis and also allows cells to accumulate in S/G2 [98]. The avian coronavirus infectious bronchitis virus also promotes favorable conditions for viral protein synthesis and, hence, progeny virus production, by inducing a cell cycle G2/M phase arrest of virus-infected cells [99].
We found that CAstV infection promoted a cell cycle arrest in spleen cells. This cell cycle arrest was accompanied by the inhibition of genes encoding TMEM158 and YWHAB (belonging to the 14-3-3 protein family) and a significant increase in cyclin-dependent kinase inhibitor 2C (CDKN2C) mRNA [100]. CDKN2C encodes an inhibitor that prevents the activation of the cyclin-dependent kinases (CDKs) and controls the G1 phase of the cell cycle. CDKs are key regulators of transitions from one phase of the cell cycle to the next [101]. However, further investigations are required to clarify the relevance of this regulation to CAstV replication.
The enrichment analyses demonstrated that CAstV infection caused the increased expression of mainly ISGs involved in various signaling pathways, primarily the RIG-I-like signaling pathway. The mRNA levels of cell cycle and stress response genes were mostly decreased. Our results demonstrated that CAstV infection triggered innate responses in the chicken spleen and revealed a series of ISGs that interact during viral infection. We hypothesized that CAstV has a mechanism of immune evasion that prevents the significant activation of immune genes in the early stages of infection, but this may also depend on the virulence of the virus and the age of the chickens. Studies on turkey astrovirus show that innate immune responses are crucial in fighting against astrovirus infections in young birds [63,102]. Turkey astrovirus type 2 (TAstV-2), isolated from turkeys diagnosed with poult enteritis and mortality syndrome and similar to human astrovirus, exhibits immunomodulatory properties. Qureshi et al. demonstrated that TAstV-2-infected chicken lymphocytes have a significantly decreased mitogen response and suggested that this could lead to severe immune disorders [103]. In subsequent studies, they proved that TAstV-2 infection causes changes in innate immune cells. These cells were characterized by decreased phagocytic activity, decreased bacterial killing activity, and decreased expression of the proinflammatory cytokines IL-1 and IL-6 [104], suggesting that TAstV-2 infection suppresses the innate immune system.
Interestingly, our KEGG analysis revealed that JUN gene downregulation was common to both of the enriched pathways associated with the antiviral response (the NOD-like receptor signaling pathway and influenza A pathway). c-jun is a downstream component of the c-jun N-terminal Kinases (JNKs) signaling pathway and a crucial cofactor of activator protein AP-1. It may take part in the development of viral infections [105] and can be activated by many extracellular factors, including viral infections [106]. For example, in influenza A virus (IAV) infection, the JUN gene is phosphorylated and, thus, activated at a very early stage [107]. This enables the further initiation of antiviral agents, including IFNβ, which in turn can cause significant inflammation [108]. Xie et al. demonstrated that suppressing JUN in human and mouse cells efficiently reduces IAV replication and resets the balance of pro- and anti-inflammation induced by IAV infection, both in vitro and in vivo [105]. Thus, the suppression of JUN gene expression in CastV infection may also be evidence of the immunosuppressive effect of CAstV.
Another example of the immunosuppressive nature of CAstV infection appears to be its effect on the complement system, which helps the avian immune system fight viral infections. As part of the innate immune response, it is immediately ready to target and eliminate virus particles and interact with virus-infected cell surfaces [109]. Growing evidence suggests that RNA viruses, such as their DNA counterparts, have evolved strategies to restrict complement function by modulating the expression of host genes involved in the antiviral response [110]. Infection with avian astroviruses, such as human ones, is accompanied by limited inflammation. This suggests that astroviruses may somehow disrupt the innate immune system during infection [102,111]. Indeed, both HAstV and its purified recombinant CP protein have been shown to inhibit serum complement activation [112,113]. HAstV CP inhibits the activation of the classical and lectin complement pathways. In the classical pathway, the CP protein inhibits C1 activation by directly binding to C1q and displacing the C1s–C1r–C1r–C1s serine protease tetramer [113]. In the lectin pathway, CP inhibits the activation of mannose-binding lectin by binding directly to it at the same binding site as the serine protease MASP-2 [114,115]). Our analysis revealed that the C1R and C1S genes of the complement pathway were upregulated at the 4 dpi time point (log2 fold change = 0.8).
The lack of the activation of other components of the complement system suggests a possible inhibition of the pathway at this stage by CAstV. The crucial role of complement is to initiate an inflammatory response. The absence of inflammation in astrovirus infection suggests that the suppression of complement activation by astroviruses is an essential component of immune and inflammatory response suppression. Indeed, research does seem to confirm this. Tam et al. found only low levels of the complement-mediated activation of NF-κB after HAstV infection in comparison with adenovirus and human papillomavirus infection, suggesting that HAstV has complement avoidance strategies [116,117]. Moreover, the lack of C3 activation, which is needed to trigger an interferon response, may explain the lack of activation of IFNs and, consequently, cytokines in our experiment. A similar situation has been described by Guix et al. and by Marvin et al. in studies using the human astrovirus [117,118].

5. Conclusions

In conclusion, this study provided broad insight into the CAstV-induced host response and a basis for further studies that may clarify the interactions between virus and host. Although this study had some limitations, such as using small study groups and a single time point, it, nonetheless, provided a global analysis of host transcriptional changes that occur during CAstV infection in vivo, new information about novel genes in chickens, and a strong basis for further studies.
We demonstrated that CAstV infection in chickens affects both the cell cycle and immune signaling in the spleen. We believe that the results regarding molecular mechanisms and the host immune response warrant a further transcriptomic analysis at multiple time points after infection.

Supplementary Materials

The following are available online at www.mdpi.com/article/10.3390/v13122374/s1, Supplementary File S1: differentially expressed genes in CastV-infected group compared with control group, Supplementary File S2: CAstV-infected vs. control GO-enriched biological processes.

Author Contributions

Conceptualization, J.S.-K.; methodology, J.S.-K.; validation, J.S.-K. and B.M.-K.; formal analysis, J.S.-K.; investigation, J.S.-K. and K.T.; data curation, J.S.-K., J.P.J. and B.M.-K.; writing—original draft preparation, J.S.-K.; writing—review and editing, J.S.-K., B.M.-K., M.G., J.P.J. and K.D.-B., visualization, J.S.-K.; supervision, J.S.-K.; funding acquisition, J.S.-K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the KNOW (Leading National Research Centre) Scientific Consortium “Healthy Animal—Safe Food”, decision of Ministry of Science and Higher Education no. 05-1/KNOW2/2015.

Institutional Review Board Statement

Animal experiments were performed in agreement with the rules in place in the EU (Directive 2010/63/UE) and approved by the Local Ethics Commission.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data generated in RNA-seq study were submitted to the SRA database (https://www.ncbi.nlm.nih.gov/sra) (accessed on 30 October 2021) under accession number PRJNA768620 (release date: 30 October 2021).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ulloa, J.C.; Gutiérrez, M.F. Genomic analysis of two ORF2 segments of new porcine astrovirus isolates and their close relationship with human astroviruses. Can. J. Microbiol. 2010, 56, 569–577. [Google Scholar] [CrossRef] [Scilit]
  2. Domańska-Blicharz, K.; Lisowska, A.; Jacukowicz, A.; Pikuła, A.; Minta, Z. Cross-sectional survey of selected enteric viruses in Polish turkey flocks between 2008 and 2011. BMC Veter-Res. 2017, 13, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Smyth, V.J. A Review of the Strain Diversity and Pathogenesis of Chicken Astrovirus. Viruses 2017, 9, 29. [Google Scholar] [CrossRef] [Scilit]
  4. Meliopoulos, V.A.; Kayali, G.; Burnham, A.; Oshansky, C.M.; Thomas, P.G.; Gray, G.; Beck, M.A.; Schultz-Cherry, S. Detection of Antibodies against Turkey Astrovirus in Humans. PLoS ONE 2014, 9, e96934. [Google Scholar] [CrossRef] [Scilit]
  5. International Committee on Taxonomy of Viruses. ICTV Virus Taxononomy: 2019 Release. Available online: http://ictvonline.org/proposals/2010.017acV.A.v3.Avastrovirus.pdf (accessed on 3 March 2021).
  6. Shirai, J.; Nakamura, K.; Nozaki, H.; Kawamura, H. Differences in the Induction of Urate Deposition of Specific-Pathogen-Free Chicks Inoculated with Avian Nephritis Virus Passaged by Five Different Methods. Avian Dis. 1991, 35, 269. [Google Scholar] [CrossRef] [Scilit]
  7. Bulbule, N.R.; Mandakhalikar, K.D.; Kapgate, S.S.; Deshmukh, V.V.; Schat, K.A.; Chawak, M.M. Role of chicken astrovirus as a causative agent of gout in commercial broilers in India. Avian Pathol. 2013, 42, 464–473. [Google Scholar] [CrossRef] [Scilit]
  8. McNulty, M.; Allan, G.; Connor, T.; McFerran, J.; McCracken, R. An entero?like virus associated with the runting syndrome in broiler chickens. Avian Pathol. 1984, 13, 429–439. [Google Scholar] [CrossRef] [Scilit]
  9. Spackman, D.; Gough, R.E.; Collins, M.S.; Lanning, D. Isolation of an enterovirus-like agent from the meconium of dead-in-shell chicken embryos. Veter-Rec. 1984, 114, 216–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Decaesstecker, M.; Charlier, G.; Meulemans, G. Significance of parvoviruses, enterolike viruses and reoviruses in the aetiology of the chicken malabsorption syndrome. Avian Pathol. 1986, 15, 769–782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Smyth, J.A.; Connor, T.J.; McNeilly, F.; Moffet, D.A.; Calvert, V.M.; McNulty, M.S. Studies on the pathogenicity of enterovirus-like viruses in chickens. Avian Pathol. 2007, 36, 119–126. [Google Scholar] [CrossRef] [Scilit]
  12. Oluwayelu, D.O.; Todd, D.; Ball, N.W.; Scott, A.N.J.; Oladele, O.A.; Emikpe, B.; Fagbohun, O.A.; Owoade, A.A.; Olaleye, O.D. Isolation and Preliminary Characterization of Chicken Anemia Virus from Chickens in Nigeria. Avian Dis. 2005, 49, 446–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. French, D.; Stayer, P.; Riley, E.; Vanhooser, S.; Ferro, P. Impact of astrovirus challenge on a commercial broiler breeder flock and subsequent progeny. In Proceedings of the 153rd Annual Meeting of the American Veterinary Medical Association, San Antonio, TX, USA, 6–9 September 2016; p. 7. [Google Scholar]
  14. Long, K.E.; Hastie, G.M.; Ojkić, D.; Brash, M.L. Economic Impacts of White Chick Syndrome in Ontario, Canada. Avian Dis. 2017, 61, 402–408. [Google Scholar] [CrossRef] [Scilit]
  15. Nuñez, L.F.N.; Parra, S.H.S.; Mettifogo, E.; Catroxo, M.H.B.; Astolfi-Ferreira, C.; Ferreira, A.J.P. Isolation of chicken astrovirus from specific pathogen-free chicken embryonated eggs. Poult. Sci. 2015, 94, 947–954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Sajewicz-Krukowska, J.; Pać, K.; Lisowska, A.; Pikuła, A.; Minta, Z.; Króliczewska, B.; Domańska-Blicharz, K. Astrovirus-induced ‘‘white chicks’’ condition—Field observation, virus detection, and preliminary characterization. Avian Pathol. 2016, 45, 2–12. [Google Scholar] [CrossRef] [Scilit]
  17. Smyth, V.J.; Jewhurst, H.L.; Adair, B.M.; Todd, D. Detection of chicken astrovirus by reverse transcriptase-polymerase chain reaction. Avian Pathol. 2009, 38, 293–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Long, K.E.; Ouckama, R.M.; Weisz, A.; Brash, M.L.; Ojkic, D. White Chick Syndrome Associated with Chicken Astrovirus in Ontario, Canada. Avian Dis. 2018, 62, 247–258. [Google Scholar] [CrossRef] [Scilit]
  19. Sajewicz-Krukowska, J.; Domanska-Blicharz, K. Nearly full-length genome sequence of a novel astrovirus isolated from chickens with ‘white chicks’ condition. Arch. Virol. 2016, 161, 2581–2587. [Google Scholar] [CrossRef] [Scilit]
  20. Kato, H.; Takeuchi, O.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Matsui, K.; Uematsu, S.; Jung, A.; Kawai, T.; Ishii, K.; et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006, 441, 101–105. [Google Scholar] [CrossRef] [Scilit]
  21. Wang, J.; Kurt-Jones, E.A.; Finberg, R.W. Innate immunity to respiratory viruses. Cell. Microbiol. 2007, 9, 1641–1646. [Google Scholar] [CrossRef] [Scilit]
  22. Loo, Y.-M.; Fornek, J.; Crochet, N.; Bajwa, G.; Perwitasari, O.; Martinez-Sobrido, L.; Akira, S.; Gill, M.A.; Garcia-Sastre, A.; Katze, M.G.; et al. Distinct RIG-I and MDA5 Signaling by RNA Viruses in Innate Immunity. J. Virol. 2008, 82, 335–345. [Google Scholar] [CrossRef] [Scilit]
  23. Ehrhardt, C.; Seyer, R.; Hrincius, E.R.; Eierhoff, T.; Wolff, T.; Ludwig, S. Interplay between influenza A virus and the innate immune signaling. Microbes Infect. 2010, 12, 81–87. [Google Scholar] [CrossRef] [Scilit]
  24. Yilmaz, A.; Shen, S.; Adelson, D.; Xavier, S.; Zhu, J.J. Identification and sequence analysis of chicken Toll-like receptors. Immunogenetics 2004, 56, 743–753. [Google Scholar] [CrossRef] [Scilit]
  25. Yu, S.; Mao, H.; Jin, M.; Lin, X. Transcriptomic Analysis of the Chicken MDA5 Response Genes. Genes 2020, 11, 308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Yoneyama, M.; Kikuchi, M.; Matsumoto, K.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Foy, E.; Loo, Y.M.; Gale, M., Jr.; Akira, S.; et al. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J. Immunol. 2005, 175, 2851–2858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Komuro, A.; Horvath, C.M. RNA- and Virus-Independent Inhibition of Antiviral Signaling by RNA Helicase LGP2. J. Virol. 2006, 80, 12332–12342. [Google Scholar] [CrossRef] [Scilit]
  28. Takeuchi, O.; Akira, S. Recognition of viruses by innate immunity. Immunol. Rev. 2007, 220, 214–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Takeuchi, O.; Akira, S. Pattern Recognition Receptors and Inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [Scilit]
  30. Kato, H.; Takeuchi, O.; Mikamo-Satoh, E.; Hirai, R.; Kawai, T.; Matsushita, K.; Hiiragi, A.; Dermody, T.S.; Fujita, T.; Akira, S. Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid–inducible gene-I and melanoma differentiation–associated gene 5. J. Exp. Med. 2008, 205, 1601–1610. [Google Scholar] [CrossRef] [Scilit]
  31. Gitlin, L.; Benoit, L.; Song, C.; Cella, M.; Gilfillan, S.; Holtzman, M.J.; Colonna, M. Melanoma Differentiation-Associated Gene 5 (MDA5) Is Involved in the Innate Immune Response to Paramyxoviridae Infection In Vivo. PLOS Pathog. 2010, 6, e1000734. [Google Scholar] [CrossRef] [Scilit]
  32. Yu, L.; Zhang, X.; Wu, T.; Su, J.; Wang, Y.; Wang, Y.; Baoyang, R.; Xiaosai, N.; Yantao, W. Avian infectious bronchitis virus disrupts the melanoma differentiation associated gene 5 (MDA5) signaling pathway by cleavage of the adaptor protein MAVS. BMC Vet. Res. 2017, 13, 332. [Google Scholar] [CrossRef] [Scilit]
  33. Smyth, V.J.; Jewhurst, H.L.; Wilkinson, D.S.; Adair, B.M.; Gordon, A.W.; Todd, D. Development and evaluation of real-time TaqMan(R) RT-PCR assays for the detection of avian nephritis virus and chicken astrovirus in chickens. Avian Pathol. 2010, 39, 467–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Andrews, S. FastQC: A Quality Control TOOL for High Throughput Sequence Data. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 2 February 2021).
  35. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [Scilit]
  37. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [Scilit]
  38. Fu, J.; Frazee, A.C.; Collado-Torres, L.; Jaffe, A.E.; Leek, J.T. Ballgown: Flexible, Isoform-Level Differential EXPRESSION Analysis. R Package Version 2.16.0; Biorxiv 003665; 2014. Available online: https://rdrr.io/bioc/ballgown/ (accessed on 2 February 2021).
  39. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Bioconductor. Open Source Software for Bioinformatics. Available online: https://bioconductor.org (accessed on 3 February 2021).
  41. g:Profiler. Available online: https://biit.cs.ut.ee/gprofiler/index.cgi (accessed on 5 February 2021).
  42. The Gene Ontology Home Page. Available online: http://geneontology.org/ (accessed on 1 August 2012).
  43. KEGG. Available online: http://www.genome.jp/kegg/ (accessed on 10 January 2009).
  44. Cong, F.; Liu, X.; Han, Z.; Shao, Y.; Kong, X.; Liu, S. Transcriptome analysis of chicken kidney tissues following coronavirus avian infectious bronchitis virus infection. BMC Genom. 2013, 14, 743. [Google Scholar] [CrossRef] [Scilit]
  45. Vora, P.; Youdim, A.; Thomas, L.S.; Fukata, M.; Tesfay, S.Y.; Lukasek, K.; Michelsen, K.S.; Wada, A.; Hirayama, T.; Arditi, M.; et al. Beta-defensin-2 expression is regulated by TLR signaling in intestinal epithelial cells. J. Immunol. 2004, 173, 5398–5405. [Google Scholar] [CrossRef] [Scilit]
  46. Nuñez, L.F.N.; Santander-Parra, S.H.; Kyriakidis, N.C.; Astolfi-Ferreira, C.S.; Buim, M.R.; De La Torre, D.; Ferreira, A.J.P. Molecular Characterization and Determination of Relative Cytokine Expression in Naturally Infected Day-Old Chicks with Chicken Astrovirus Associated to White Chick Syndrome. Animals 2020, 10, 1195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Smyth, V.J.; Trudgett, J.; Wylie, M. Chicken astrovirus detected in hatchability problems associated with “white chicks”. Vet. Rec. 2013, 173, 403–404. [Google Scholar] [CrossRef] [Scilit]
  48. Wang, X.; Zhang, J.; Meng, R.; Jiang, Y.; Liang, S.; Zhang, Y.; Xie, M.; Zhou, Z.; Hou, S. Host Differences Affecting Resistance and Susceptibility of the Second Generation of a Pekin Duck Flock to Duck Hepatitis A Virus Genotype 3. Front. Microbiol. 2017, 8, 1128. [Google Scholar] [CrossRef] [Scilit]
  49. Wang, Q.; Liu, M.; Xu, L.; Wu, Y.; Huang, Y. Transcriptome analysis reveals the molecular mechanism of hepatic fat metabolism disorder caused by Muscovy duck reovirus infection. Avian Pathol. 2017, 47, 127–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Yan, L.; Qu, S.; Liu, G.; Liu, L.; Yu, Y.; Ding, G.; Zhao, Y.; Li, Y.; Xie, Y.; Zhang, J.; et al. Comparative Transcriptomic Analysis of Primary Duck Hepatocytes Provides Insight into Differential Susceptibility to DHBV Infection. PLoS ONE 2016, 11, e0149702. [Google Scholar] [CrossRef] [Scilit]
  51. Wang, Y.; Lupiani, B.; Reddy, S.M.; Lamont, S.J.; Zhou, H. RNA-seq analysis revealed novel genes and signaling pathway associated with disease resistance to avian influenza virus infection in chickens. Poult. Sci. 2014, 93, 485–493. [Google Scholar] [CrossRef] [Scilit]
  52. Liu, H.; Yang, X.; Zhang, Z.; Li, J.; Zou, W.; Zeng, F.; Wang, H. Comparative transcriptome analysis reveals induction of apoptosis in chicken kidney cells associated with the virulence of nephropathogenic infectious bronchitis virus. Microb. Pathog. 2017, 113, 451–459. [Google Scholar] [CrossRef] [Scilit]
  53. Ou, C.; Wang, Q.; Zhang, Y.; Kong, W.; Zhang, S.; Yu, Y.; Ma, J.; Liu, X.; Kong, X. Transcription profiles of the responses of chicken bursae of Fabricius to IBDV in different timing phases. Virol. J. 2017, 14, 1–10. [Google Scholar] [CrossRef] [Scilit]
  54. Koci, M.D.; Kelley, L.A.; Larsen, D.; Schultz-Cherry, S. Astrovirus-Induced Synthesis of Nitric Oxide Contributes to Virus Control during Infection. J. Virol. 2004, 78, 1564–1574. [Google Scholar] [CrossRef] [Scilit]
  55. Meyerhoff, R.; Nighot, P.K.; Ali, R.A.; Blikslager, A.; Koci, M.D. Characterization of turkey inducible nitric oxide synthase and identification of its expression in the intestinal epithelium following astrovirus infection. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 63–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Olah, I.; Vervelde, L. Structure of the avian lymphoid system. In Avian Immunol; Schat, K.A., Kaspers, B., Kaiser, P., Eds.; Elsevier Academic Press Inc: Amsterdam, The Netherlands, 2014; pp. 11–44. [Google Scholar]
  57. Monson, M.S. Hepatotoxic and Immunomodulatory Transcriptome Responses to Aflatoxin B1 in the Turkey (Meleagris gallopavo). Ph.D. Thesis, University of Minnesota, Minneapolis, MN, USA, 2015. [Google Scholar]
  58. El-Diwany, R.; Soliman, M.; Sugawara, S.; Breitwieser, F.; Skaist, A.; Coggiano, C.; Sangal, N.; Chattergoon, M.; Bailey, J.R.; Siliciano, R.F.; et al. CMPK2 and BCL-G are associated with type 1 interferon–induced HIV restriction in humans. Sci. Adv. 2018, 4, eaat0843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Oshiumi, H.; Miyashita, M.; Okamoto, M.; Morioka, Y.; Okabe, M.; Matsumoto, M.; Seya, T. DDX60 Is Involved in RIG-I-Dependent and Independent Antiviral Responses, and Its Function Is Attenuated by Virus-Induced EGFR Activation. Cell Rep. 2015, 11, 1193–1207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Wu, X.; Liu, K.; Jia, R.; Pan, Y.; Wang, M.; Chen, S.; Liu, M.; Zhu, D.; Zhao, X.; Wu, Y.; et al. Duck IFIT5 differentially regulates Tembusu virus replication and inhibits virus-triggered innate immune response. Cytokine 2020, 133, 155161. [Google Scholar] [CrossRef] [Scilit]
  61. Rong, E.; Hu, J.; Yang, C.; Chen, H.; Wang, Z.; Liu, X.; Liu, W.; Lu, C.; He, P.; Wang, X.; et al. Broad-spectrum antiviral functions of duck interferon-induced protein with tetratricopeptide repeats (AvIFIT). Dev. Comp. Immunol. 2018, 84, 71–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Zhu, J.; Ghosh, A.; Sarkar, S.N. OASL—A new player in controlling antiviral innate immunity. Curr. Opin. Virol. 2015, 12, 15–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Ren, D.; Li, T.; Zhang, X.; Yao, X.; Gao, W.; Xie, Q.; Zhang, J.; Shao, H.; Wan, Z.; Qin, A.; et al. OASL triggered by novel goose astrovirusvia ORF2 restricts its replication. J. Virol. 2020, 94, e01767-20. [Google Scholar] [CrossRef] [Scilit]
  64. Korpela, J. Avidin, a high affinity biotin-binding protein, as a tool and subject of biological research. Med. Boil. 1984, 62, 5–26. [Google Scholar]
  65. Green, N.M. Avidin. Adv. Prot. Chem. 1975, 29, 85. [Google Scholar]
  66. Ly-Chatain, M.H.; Moussaoui, S.; Vera, A.; Rigobello, V.; Demarigny, Y. Antiviral effect of cationic compounds on bacteriophages. Front. Microbiol. 2013, 4, 46. [Google Scholar] [CrossRef] [Scilit]
  67. Villa, T.; Siota, L.F.; Rama, J.L.R.; Ageitos, J. Antivirals against animal viruses. Biochem. Pharmacol. 2016, 133, 97–116. [Google Scholar] [CrossRef] [Scilit]
  68. Schanoski, A.S.; Le, T.T.; Kaiserman, D.; Rowe, C.; Prow, N.A.; Barboza, D.D.; Santos, C.A.; Zanotto, P.M.A.; Magalhães, K.G.; Aurelio, L.; et al. Granzyme A in Chikungunya and Other Arboviral Infections. Front. Immunol. 2020, 10, 3083. [Google Scholar] [CrossRef] [Scilit]
  69. Zhong, C.; Li, C.; Wang, X.; Toyoda, T.; Gao, G.; Fan, Z. Granzyme K inhibits replication of influenza virus through cleaving the nuclear transport complex importin α1/β dimer of infected host cells. Cell Death Differ. 2012, 19, 882–890. [Google Scholar] [CrossRef] [Scilit]
  70. Cheriyath, V.; Glaser, K.B.; Waring, J.F.; Baz, R.; Hussein, M.A.; Borden, E.C. G1P3, an IFN-induced survival factor, antagonizes TRAIL-induced apoptosis in human myeloma cells. J. Clin. Investig. 2007, 117, 3107–3117. [Google Scholar] [CrossRef] [Scilit]
  71. Schoggins, J.W.; Wilson, S.J.; Panis, M.; Murphy, M.Y.; Jones, C.T.; Bieniasz, P.; Rice, C.M. A diverse range of gene products are effectors of the type I interferon antiviral response. Nature 2011, 472, 481–485. [Google Scholar] [CrossRef] [Scilit]
  72. Li, J.; Ding, S.C.; Cho, H.; Chung, B.C.; Gale, M., Jr.; Chanda, S.K.; Diamond, M.S. A short hairpin RNA screen of interfer-on-stimulated genes identifies a novel negative regulator of the cellular antiviral response. MBio 2013, 4, e00385-13. [Google Scholar] [CrossRef] [Scilit]
  73. Bitoun, E.; Micheloni, A.; Lamant, L.; Bonnart, C.; Tartaglia-Polcini, A.; Cobbold, C.; Al Saati, T.; Mariotti, F.; Mazereeuw-Hautier, J.; Boralevi, F.; et al. LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome. Hum. Mol. Genet. 2003, 12, 2417–2430. [Google Scholar] [CrossRef] [Scilit]
  74. Lee, J.Y. Host-Virus Interactions of Infectious Laryngotracheitis Virus Infection in Cultured Cells. Ph.D. Thesis, University of Arkansas, Fayetteville, AR, USA, 2011. [Google Scholar]
  75. Bourin, M.; Gautron, J.; Berges, M.; Attucci, S.; Le Blay, G.; Labas, V.; Nys, Y.; Rehault-Godbert, S. Antimicrobial Potential of Egg Yolk Ovoinhibitor, a Multidomain Kazal-like Inhibitor of Chicken Egg. J. Agric. Food Chem. 2011, 59, 12368–12374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  76. Beck, M.A.; Handy, J.; Levander, O.A. Host nutritional status: The neglected virulence factor. Trends Microbiol. 2004, 12, 417–423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Steinbrenner, H.; Al-Quraishy, S.; Dkhil, M.; Wunderlich, F.; Sies, H. Dietary Selenium in Adjuvant Therapy of Viral and Bacterial Infections. Adv. Nutr. 2015, 6, 73–82. [Google Scholar] [CrossRef] [Scilit]
  78. Wang, Y.; Huang, J.; Sun, Y.; He, J.; Li, W.; Liu, Z.; Taylor, E.W.; Rayman, M.P.; Wan, X.; Zhang, J. SARS-CoV-2 suppresses mRNA expression of selenoproteins associated with ferroptosis, endoplasmic reticulum stress and DNA synthesis. Food Chem Toxicol. 2021, 153, 112286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Murai, K.; Honda, M.; Shirasaki, T.; Shimakami, T.; Omura, H.; Misu, H.; Kita, Y.; Takeshita, Y.; Ishii, K.-A.; Takamura, T.; et al. Induction of Selenoprotein P mRNA during Hepatitis C Virus Infection Inhibits RIG-I-Mediated Antiviral Immunity. Cell Host Microbe 2019, 25, 588–601.e7. [Google Scholar] [CrossRef] [Scilit]
  80. Creagh, E.; Sheehan, D.; Cotter, T. Heat shock proteins—Modulators of apoptosis in tumour cells. Leukemia 2000, 14, 1161–1173. [Google Scholar] [CrossRef] [Scilit]
  81. Reyes-del Valle, J.; Chávez-Salinas, S.; Medina, F.; del Angel, R.M. Heat Shock Protein 90 and Heat Shock Protein 70 Are Components of Dengue Virus Receptor Complex in Human Cells. J. Virol. 2005, 79, 4557–4567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  82. Liu, J.-S.; Kuo, S.-R.; Makhov, A.M.; Cyr, D.M.; Griffith, J.D.; Broker, T.R.; Chow, L.T. Human Hsp70 and Hsp40 Chaperone Proteins Facilitate Human Papillomavirus-11 E1 Protein Binding to the Origin and Stimulate Cell-free DNA Replication. J. Biol. Chem. 1998, 273, 30704–30712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Chen, Y.-J.; Chen, Y.-H.; Chow, L.-P.; Tsai, Y.-H.; Chen, P.-H.; Huang, C.-Y.F.; Chen, W.-T.; Hwang, L.-H. Heat Shock Protein 72 Is Associated with the Hepatitis C Virus Replicase Complex and Enhances Viral RNA Replication. J. Biol. Chem. 2010, 285, 28183–28190. [Google Scholar] [CrossRef] [Scilit]
  84. Weeks, S.A.; Miller, D.J. The Heat Shock Protein 70 Cochaperone YDJ1 Is Required for Efficient Membrane-Specific Flock House Virus RNA Replication Complex Assembly and Function in Saccharomyces cerevisiae. J. Virol. 2008, 82, 2004–2012. [Google Scholar] [CrossRef] [Scilit]
  85. Livingston, C.M.; DeLuca, N.A.; Wilkinson, D.E.; Weller, S.K. Oligomerization of ICP4 and Rearrangement of Heat Shock Proteins May Be Important for Herpes Simplex Virus Type 1 Prereplicative Site Formation. J. Virol. 2008, 82, 6324–6336. [Google Scholar] [CrossRef] [Scilit]
  86. Gao, S.; Jin, L.; Liu, G.; Wang, P.; Sun, Z.; Cao, Y.; Shi, H.; Liu, X.; Shi, Q.; Zhou, X.; et al. Overexpression of RASD1 inhibits glioma cell migration/invasion and inactivates the AKT/mTOR signaling pathway. Sci. Rep. 2017, 7, 1–12. [Google Scholar] [CrossRef] [Scilit]
  87. Cheng, Z.; Guo, J.; Chen, L.; Luo, N.; Yang, W.; Qu, X. Overexpression of TMEM158 contributes to ovarian carcinogenesis. J. Exp. Clin. Cancer Res. 2015, 34, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  88. Nieto, M.; Barradas, M.; Criado, L.M.; Flores, J.M.; Serrano, M.; Llano, E. Normal cellular senescence and cancer susceptibility in mice genetically deficient in Ras-induced senescence-1 (Ris1). Oncogene 2007, 26, 1673–1680. [Google Scholar] [CrossRef] [Scilit]
  89. Ji, G.; Li, Y.; Tan, F.; Zhuang, J.; Li, X.; Tian, K. Complete Genome Sequence of an NADC30-Like Strain of Porcine Reproductive and Respiratory Syndrome Virus in China. Genome Announc. 2016, 4, e00303-16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. van Hemert, M.; Steensma, H.Y.; Van Heusden, G.P.H. 14-3-3 proteins: Key regulators of cell division, signalling and apoptosis. BioEssays 2001, 23, 936–946. [Google Scholar] [CrossRef] [Scilit]
  91. Nathan, K.G.; Lal, S.K. The Multifarious Role of 14-3-3 Family of Proteins in Viral Replication. Viruses 2020, 12, 436. [Google Scholar] [CrossRef] [Scilit]
  92. Chan, Y.K.; Gack, M.U. A phosphomimetic-based mechanism of dengue virus to antagonize innate immunity. Nat. Immunol. 2016, 17, 523–530. [Google Scholar] [CrossRef] [Scilit]
  93. Surjit, M.; Kumar, R.; Mishra, R.N.; Reddy, M.K.; Chow, V.T.K.; Lal, S.K. The Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Protein Is Phosphorylated and Localizes in the Cytoplasm by 14-3-3-Mediated Translocation. J. Virol. 2005, 79, 11476–11486. [Google Scholar] [CrossRef] [Scilit]
  94. Liu, H.M.; Loo, Y.-M.; Horner, S.M.; Zornetzer, G.A.; Katze, M.G.; Gale, M., Jr. The Mitochondrial Targeting Chaperone 14-3-3ε Regulates a RIG-I Translocon that Mediates Membrane Association and Innate Antiviral Immunity. Cell Host Microbe 2012, 11, 528–537. [Google Scholar] [CrossRef] [Scilit]
  95. Fan, Y.; Sanyal, S.; Bruzzone, R. Breaking Bad: How Viruses Subvert the Cell Cycle. Front. Cell. Infect. Microbiol. 2018, 8, 396. [Google Scholar] [CrossRef] [Scilit]
  96. Emmett, S.R.; Dove, B.; Mahoney, L.; Wurm, T.; Hiscox, J.A. The Cell Cycle and Virus Infection. Methods Mol. Biol. 2004, 296, 197–218. [Google Scholar] [CrossRef] [Scilit]
  97. Naniche, D.; Reed, S.I.; Oldstone, M.B.A. Cell Cycle Arrest during Measles Virus Infection: A G 0 -Like Block Leads to Suppression of Retinoblastoma Protein Expression. J. Virol. 1999, 73, 1894–1901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  98. Lin, G.Y.; Lamb, R.A. The Paramyxovirus Simian Virus 5 V Protein Slows Progression of the Cell Cycle. J. Virol. 2000, 74, 9152–9166. [Google Scholar] [CrossRef] [Scilit]
  99. Chen, H.; Wurm, T.; Britton, P.; Brooks, G.; Hiscox, J.A. Interaction of the Coronavirus Nucleoprotein with Nucleolar Antigens and the Host Cell. J. Virol. 2002, 76, 5233–5250. [Google Scholar] [CrossRef] [Scilit]
  100. Song, L.; Han, X.; Jia, C.; Zhang, X.; Jiao, Y.; Du, T.; Xiao, S.; Hiscox, J.A.; Zhou, E.M.; Mu, Y. Porcine reproductive and respiratory syndrome virus inhibits MARC-145 proliferation via inducing apoptosis and G2/M arrest by activation of Chk/Cdc25C and p53/p21 pathway. Virol. J. 2018, 15, 169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  101. Sheppard, K.E.; Pearson, R.B.; Hannan, R.D. Unexpected role of CDK4 in a G2/M checkpoint. Cell Cycle 2015, 14, 1351–1352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  102. Koci, M.D.; Moser, L.A.; Kelley, L.A.; Larsen, D.; Brown, C.C.; Schultz-Cherry, S. Astrovirus Induces Diarrhea in the Absence of Inflammation and Cell Death. J. Virol. 2003, 77, 11798–11808. [Google Scholar] [CrossRef] [Scilit]
  103. Qureshi, M.A.; Yu, M.; Saif, Y.M. A Novel “Small Round Virus” Inducing Poult Enteritis and Mortality Syndrome and Associated Immune Alterations. Avian Dis. 2000, 44, 275–283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  104. Qureshi, M.A.; Saif, Y.M.; Heggen-Peay, C.L.; Edens, F.W.; Havenstein, G.B. Induction of functional defects in macrophages by a poult enteritis and mortality syndrome-associated turkey astrovirus. Avian Dis. 2001, 45, 853. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  105. Xie, J.; Zhang, S.; Hu, Y.; Li, D.; Cui, J.; Xue, J.; Zhang, G.; Khachigian, L.; Wong, J.; Sun, L.; et al. Regulatory roles of c-jun in H5N1 influenza virus replication and host inflammation. Biochim. Biophys. Acta—Mol. Basis Dis. 2014, 1842, 2479–2488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  106. Leppa, S.; Bohmann, D. Diverse functions of JNK signaling and c-Jun in st6ress response and apoptosis. Oncogene 1999, 18, 6158–6162. [Google Scholar] [CrossRef] [Scilit]
  107. Ludwig, S.; Ehrhardt, C.; Neumeier, E.R.; Kracht, M.; Rapp, U.R.; Pleschka, S. Influenza Virus-induced AP-1-dependent Gene Expression Requires Activation of the JNK Signaling Pathway. J. Biol. Chem. 2001, 276, 10990–10998. [Google Scholar] [CrossRef] [Scilit]
  108. Ludwig, S. Influenza viruses and MAP kinase cascades—Novel targets for an antiviral intervention? Signal Transduct. 2007, 7, 81–88. [Google Scholar] [CrossRef] [Scilit]
  109. Koch, C.; Josephsen, J.; Nicolaisen, E.M.; Simonsen, M. Complement mediated lysis in chickens. Dev. Comp. Immunol. 1983, 6, 141–149. [Google Scholar] [CrossRef] [Scilit]
  110. Asok, K.N.; Umerali, K.; Sabu, T.; Bernet, J.J. In the Crosshairs: RNA Viruses OR Complement? Front. Immunol. 2020, 11, 2315. [Google Scholar]
  111. Sebire, N.J.; Malone, M.; Shah, N.; Anderson, G.; Gaspar, H.B.; Cubitt, W.D. Pathology of astrovirus associated diarrhoea in a paediatric bone marrow transplant recipient. J. Clin. Pathol. 2004, 57, 1001–1003. [Google Scholar] [CrossRef] [Scilit]
  112. Bonaparte, R.S.; Hair, P.S.; Banthia, D.; Marshall, D.M.; Cunnion, K.M.; Krishna, N.K. Human Astrovirus Coat Protein Inhibits Serum Complement Activation via C1, the First Component of the Classical Pathway. J. Virol. 2008, 82, 817–827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  113. Hair, P.S.; Gronemus, J.Q.; Crawford, K.B.; Salvi, V.P.; Cunnion, K.M.; Thielens, N.M.; Arlaud, G.J.; Rawal, N.; Krishna, N.K. Human astrovirus coat protein binds C1q and MBL and inhibits the classical and lectin pathways of complement activation. Mol. Immunol. 2010, 47, 792–798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  114. Arias, C.F.; Dubois, R.M. The Astrovirus Capsid: A Review. Viruses 2017, 9, 15. [Google Scholar] [CrossRef] [Scilit]
  115. Lachmann, P.J.; Davies, A. Complement and immunity to viruses. Immunol. Rev. 1997, 159, 69–77. [Google Scholar] [CrossRef] [Scilit]
  116. Tam, J.C.H.; Bidgood, S.R.; McEwan, W.A.; James, L.C. Intracellular sensing of complement C3 activates cell autonomous immunity. Science 2014, 345, 1256070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  117. Marvin, S.A. The Immune Response to Astrovirus Infection. Viruses 2016, 9, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  118. Marvin, S.A.; Huerta, C.T.; Sharp, B.; Freiden, P.; Cline, T.D.; Schultz-Cherry, S. Type I Interferon Response Limits Astrovirus Replication and Protects against Increased Barrier Permeability In Vitro and In Vivo. J. Virol. 2016, 90, 1988–1996. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Heat map analysis used to classify gene expression patterns under different experimental conditions. Genes with similar expression patterns were clustered in the heat map. Intensity of color indicates gene expression levels. Red represents genes with high levels of expression and green represents genes with low levels of expression.
Figure 1. Heat map analysis used to classify gene expression patterns under different experimental conditions. Genes with similar expression patterns were clustered in the heat map. Intensity of color indicates gene expression levels. Red represents genes with high levels of expression and green represents genes with low levels of expression.
Viruses 13 02374 g001
Figure 2. A volcano plot displays the number of DEGs between the control and CAstV-infected groups. Red points represent up-regulated genes, blue points represent down-regulated genes, and black points represent genes with no significant difference in expression.
Figure 2. A volcano plot displays the number of DEGs between the control and CAstV-infected groups. Red points represent up-regulated genes, blue points represent down-regulated genes, and black points represent genes with no significant difference in expression.
Viruses 13 02374 g002
Figure 3. IFIT (A), OASL (B), DDX60 (C), and RASD1 (D) gene expression in CAstV-infected chickens in relation to non-infected chickens, as verified by qRT-PCR.
Figure 3. IFIT (A), OASL (B), DDX60 (C), and RASD1 (D) gene expression in CAstV-infected chickens in relation to non-infected chickens, as verified by qRT-PCR.
Viruses 13 02374 g003
Table 1. Primers and probes used in the study.
Table 1. Primers and probes used in the study.
Target GeneSequence (5′–3′)References
OASLF: AGCACTGGTACAAGGAGATGTTGCong et al., 2013 [44]
R: CCAAGCAGCTCCAGCACAG
P: CTGAAGTCCTCCCTGCCTGTGCCCT
IFIT5F: AAAAGAAGGCAAATCATGAGTACC
R: TGATCCTCTATTGATTCTTCCAGAC
P: AATTCCTTGAAGAACTCCCTGCTGC
ACTBF: CATCCTCACCCTGAAGTACCVora et al., 2004 [45]
R: GCTCATTGTAGAAGGTGTGG
P: CACGGCATCGTCACCAACTG
DDX60N/AThermo Fisher, Gg07198553_m1
RASD1N/AThermo Fisher, Gg03359818_g1
YWHABN/AThermo Fisher, Gg03369026_m1
HSPA2N/AThermo Fisher, Gg03370143_s1
Table 2. The statistical metrics for the RNA libraries. PBS refers to control samples; CAstV refers to experimental samples.
Table 2. The statistical metrics for the RNA libraries. PBS refers to control samples; CAstV refers to experimental samples.
RNA-seq LibrariesNumber of Raw Reads (Millions)Number of
Processed Reads (Millions)
Number of Uniquely Mapped Reads (Millions)Uniquely Mapped Reads (%)
263CAstV4dpi31.627.224.891.4
264CAstV4dpi40.435.030.888.3
265CAstV4dpi41.035.030.486.7
268CAstV4dpi39.433.630.891.8
270CAstV4dpi41.235.230.887.5
276PBS4dpi36.230.828.090.7
277PBS4dpi46.638.635.691.8
278PBS4dpi35.431.829.291.7
279PBS4dpi41.435.232.090.9
280PBS4dpi40.636.032.891.4
Table 3. KEGG pathways enrichment in chickens infected with CAstV at 4 dpi.
Table 3. KEGG pathways enrichment in chickens infected with CAstV at 4 dpi.
Descriptionp-ValueNegative log10 of Adjusted
p-Value
NOD-like receptor signaling pathway0.0233644211.631444986
Influenza A0.0256631151.590690622
Cell cycle0.0294230131.531312861
Table 4. DEGs associated with the immune pathway and cell cycle in the spleen transcriptomes of chicks infected with CAstV at 4 dpi.
Table 4. DEGs associated with the immune pathway and cell cycle in the spleen transcriptomes of chicks infected with CAstV at 4 dpi.
NOD-like receptor signaling pathwayENSGALG00000010870,ENSGALG00000017186,ENSGALG00000000720,
ENSGALG00000007651,ENSGALG00000001619
Influenza AENSGALG00000010870,ENSGALG00000003584,ENSGALG00000007651,
ENSGALG00000041192,ENSGALG00000003144
Cell cycleENSGALG00000004143,ENSGALG00000005769,ENSGALG00000008233,
ENSGALG00000036892,ENSGALG00000010537
Table 5. IFIT, OASL, DDX60, and RASD1 expression in CAstV-infected and non-infected chickens, as verified by qRT-PCR.
Table 5. IFIT, OASL, DDX60, and RASD1 expression in CAstV-infected and non-infected chickens, as verified by qRT-PCR.
GenesCAstV Infected ChickensCAstV Non-Infected Chickensp-Value
RQ Mean ± SDRQ MedianRQ Mean ± SDRQ Median
IFIT58.9 ± 3.69.83.6 ± 2.04.30.015
OASL5.2 ± 1.94.92.2 ± 1.12.30.015
DDX6017.9 ± 4.217.310.3 ± 9.16.720.01
RASD11.03 ± 0.31.062.8 ± 1.32.620.09
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sajewicz-Krukowska, J.; Jastrzębski, J.P.; Grzybek, M.; Domańska-Blicharz, K.; Tarasiuk, K.; Marzec-Kotarska, B. Transcriptome Sequencing of the Spleen Reveals Antiviral Response Genes in Chickens Infected with CAstV. Viruses 2021, 13, 2374. https://doi.org/10.3390/v13122374

AMA Style

Sajewicz-Krukowska J, Jastrzębski JP, Grzybek M, Domańska-Blicharz K, Tarasiuk K, Marzec-Kotarska B. Transcriptome Sequencing of the Spleen Reveals Antiviral Response Genes in Chickens Infected with CAstV. Viruses. 2021; 13(12):2374. https://doi.org/10.3390/v13122374

Chicago/Turabian Style

Sajewicz-Krukowska, Joanna, Jan Paweł Jastrzębski, Maciej Grzybek, Katarzyna Domańska-Blicharz, Karolina Tarasiuk, and Barbara Marzec-Kotarska. 2021. "Transcriptome Sequencing of the Spleen Reveals Antiviral Response Genes in Chickens Infected with CAstV" Viruses 13, no. 12: 2374. https://doi.org/10.3390/v13122374

APA Style

Sajewicz-Krukowska, J., Jastrzębski, J. P., Grzybek, M., Domańska-Blicharz, K., Tarasiuk, K., & Marzec-Kotarska, B. (2021). Transcriptome Sequencing of the Spleen Reveals Antiviral Response Genes in Chickens Infected with CAstV. Viruses, 13(12), 2374. https://doi.org/10.3390/v13122374

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop