N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells
2.2. Mutagenesis of the N-glycan Motif, Plasmid Constructions, and Rescue of Infectious Clones
2.3. Immunofluorescence Microscopy
2.4. Plaque Forming Assay and Virus Titration
2.5. Real-Time RT-PCR for the Detection of ZIKV RNA
2.6. pcDNA3.1-prME Plasmid Construction
2.7. Glycosidase Treatment
2.8. Measurement of Secreted E Protein
2.9. Comparison of the N-glycan Motif in the Flavivirus Genus
2.10. Data Analysis
3. Results
3.1. Removal of the N-glycan Site in ZIKV prM Resulted in Impaired Viral Gene Expression and No Infectious Virus
3.2. ZIKV prM and E N-Glycans Were Requried for Effective Secretion of the ZIKV E Protein
3.3. Absence of the prM N-Glycan Caused Protein Aggregation
3.4. Lack of the prM N-Glycan Induced Nuclear Translocation of CHOP
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gould, E.A.; Solomon, T. Pathogenic flaviviruses. Lancet 2008, 371, 500–509. [Google Scholar] [CrossRef] [Scilit]
- Hamel, R.; Dejarnac, O.; Wichit, S.; Ekchariyawat, P.; Neyret, A.; Luplertlop, N.; Perera-Lecoin, M.; Surasombatpattana, P.; Talignani, L.; Thomas, F.; et al. Biology of Zika Virus Infection in Human Skin Cells. J. Virol. 2015, 89, 8880–8896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holbrook, M.R. Historical Perspectives on Flavivirus Research. Viruses 2017, 9, 97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taguwa, S.; Yeh, M.T.; Rainbolt, T.K.; Nayak, A.; Shao, H.; Gestwicki, J.E.; Andino, R.; Frydman, J. Zika Virus Dependence on Host Hsp70 Provides a Protective Strategy against Infection and Disease. Cell Rep. 2019, 26, 906–920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Musso, D.; Ko, A.I.; Baud, D. Zika Virus Infection—After the Pandemic. N. Engl. J. Med. 2019, 381, 1444–1457. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Annamalai, A.S.; Pattnaik, A.; Sahoo, B.R.; Muthukrishnan, E.; Natarajan, S.K.; Steffen, D.; Vu, H.L.X.; Delhon, G.; Osorio, F.A.; Petro, T.M.; et al. Zika Virus Encoding Nonglycosylated Envelope Protein Is Attenuated and Defective in Neuroinvasion. J. Virol. 2017, 91, e01348-17. [Google Scholar] [CrossRef] [Scilit]
- Sirohi, D.; Kuhn, R.J. Zika Virus Structure, Maturation, and Receptors. J. Infect. Dis. 2017, 216, S935–S944. [Google Scholar] [CrossRef] [Scilit]
- Laureti, M.; Narayanan, D.; Rodriguez-Andres, J.; Fazakerley, J.K.; Kedzierski, L. Flavivirus Receptors: Diversity, Identity, and Cell Entry. Front. Immunol. 2018, 9, 2180. [Google Scholar] [CrossRef] [Scilit]
- Yu, I.-M.; Zhang, W.; Holdaway, H.A.; Li, L.; Kostyuchenko, V.A.; Chipman, P.R.; Kuhn, R.J.; Rossmann, M.G.; Chen, J. Structure of the Immature Dengue Virus at Low pH Primes Proteolytic Maturation. Science 2008, 319, 1834–1837. [Google Scholar] [CrossRef] [Scilit]
- Mécharles, S.; Herrmann, C.; Poullain, P.; Tran, T.-H.; Deschamps, N.; Mathon, G.; Landais, A.; Breurec, S.; Lannuzel, A. Acute myelitis due to Zika virus infection. Lancet 2016, 387, 1481. [Google Scholar] [CrossRef] [Scilit]
- Elshuber, S.; Allison, S.L.; Heinz, F.X.; Mandl, C.W. Cleavage of protein prM is necessary for infection of BHK-21 cells by tick-borne encephalitis virus FN1. J. Gen. Virol. 2003, 84, 183–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lobigs, M.; Lee, E.; Ng, M.L.; Pavy, M.; Lobigs, P. A flavivirus signal peptide balances the catalytic activity of two proteases and thereby facilitates virus morphogenesis. Virology 2010, 401, 80–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, G.; Poulsen, M.; Fenyvuesvolgyi, C.; Yashiroda, Y.; Yoshida, M.; Simard, J.M.; Gallo, R.C.; Zhao, R.Y. Characterization of cytopathic factors through genome-wide analysis of the Zika viral proteins in fission yeast. Proc. Natl. Acad. Sci. USA 2017, 114, E376–E385. [Google Scholar] [CrossRef] [Scilit]
- Aebi, M. N-linked protein glycosylation in the ER. Biochim. Biophys. Acta 2013, 1833, 2430–2437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Helenius, A.; Aebi, M. Roles of N-Linked Glycans in the Endoplasmic Reticulum. Annu. Rev. Biochem. 2004, 73, 1019–1049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Helle, F.; Vieyres, G.; Elkrief, L.; Popescu, C.-I.; Wychowski, C.; Descamps, V.; Castelain, S.; Roingeard, P.; Duverlie, G.; Dubuisson, J. Role of N-Linked Glycans in the Functions of Hepatitis C Virus Envelope Proteins Incorporated into Infectious Virions. J. Virol. 2010, 84, 11905–11915. [Google Scholar] [CrossRef] [Scilit]
- Carbaugh, D.L.; Baric, R.S.; LaZear, H.M. Envelope Protein Glycosylation Mediates Zika Virus Pathogenesis. J. Virol. 2019, 93, e00113-19. [Google Scholar] [CrossRef] [Scilit]
- Sheridan, M.A.; Balaraman, V.; Schust, D.J.; Ezashi, T.; Roberts, R.M.; Franz, A.W. African and Asian strains of Zika virus differ in their ability to infect and lyse primitive human placental trophoblast. PLoS ONE 2018, 13, e0200086. [Google Scholar] [CrossRef] [Scilit]
- Haddow, A.D.; Schuh, A.J.; Yasuda, C.Y.; Kasper, M.R.; Heang, V.; Huy, R.; Guzman, H.; Tesh, R.B.; Weaver, S. Genetic Characterization of Zika Virus Strains: Geographic Expansion of the Asian Lineage. PLoS Negl. Trop. Dis. 2012, 6, e1477. [Google Scholar] [CrossRef] [Scilit]
- Lanciotti, R.S.; Lambert, A.J.; Holodniy, M.; Saavedra, S.; Signor, L.D.C.C. Phylogeny of Zika Virus in Western Hemisphere, 2015. Emerg. Infect. Dis. 2016, 22, 933–935. [Google Scholar] [CrossRef] [Scilit]
- Sirohi, D.; Chen, Z.; Sun, L.; Klose, T.; Pierson, T.C.; Rossmann, M.G.; Kuhn, R.J. The 3.8 A resolution cryo-EM structure of Zika virus. Science 2016, 352, 467–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- May, M.; Relich, R.F. A Comprehensive Systems Biology Approach to Studying Zika Virus. PLoS ONE 2016, 11, e0161355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fontes-Garfias, C.R.; Shan, C.; Luo, H.; Muruato, A.E.; Medeiros, D.B.; Mays, E.; Xie, X.; Zou, J.; Roundy, C.M.; Wakamiya, M.; et al. Functional Analysis of Glycosylation of Zika Virus Envelope Protein. Cell Rep. 2017, 21, 1180–1190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mossenta, M.; Marchese, S.; Poggianella, M.; Campos, J.L.S.; Burrone, O. Role of N-glycosylation on Zika virus E protein secretion, viral assembly and infectivity. Biochem. Biophys. Res. Commun. 2017, 492, 579–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, D.; Li, S.; Dong, F.; Zhang, Y.; Lin, Y.; Wang, J.; Zou, Z.; Zheng, A. N-glycosylation of Viral E Protein Is the Determinant for Vector Midgut Invasion by Flaviviruses. mBio 2018, 9, e00046-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.M.; Yun, S.I.; Song, B.H.; Hahn, Y.S.; Lee, C.H.; Oh, H.W.; Lee, Y.M. A Single N-Linked Glycosylation Site in the Japanese Encephalitis Virus prM Protein Is Critical for Cell Type-Specific prM Protein Biogenesis, Virus Particle Release, and Pathogenicity in Mice. J. Virol. 2008, 82, 7846–7862. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanna, S.L.; Pierson, T.C.; Sanchez, M.D.; Ahmed, A.A.; Murtadha, M.M.; Doms, R.W. N-Linked Glycosylation of West Nile Virus Envelope Proteins Influences Particle Assembly and Infectivity. J. Virol. 2005, 79, 13262–13274. [Google Scholar] [CrossRef] [Scilit]
- Hacker, K.; White, L.; De Silva, A.M. N-Linked glycans on dengue viruses grown in mammalian and insect cells. J. Gen. Virol. 2009, 90, 2097–2106. [Google Scholar] [CrossRef] [Scilit]
- Goto, A.; Yoshii, K.; Obara, M.; Ueki, T.; Mizutani, T.; Kariwa, H.; Takashima, I. Role of the N-linked glycans of the prM and E envelope proteins in tick-borne encephalitis virus particle secretion. Vaccine 2005, 23, 3043–3052. [Google Scholar] [CrossRef] [Scilit]
- Meyer, B.; García-Bocanegra, I.; Wernery, U.; Wernery, R.; Sieberg, A.; Müller, M.A.; Drexler, J.F.; Drosten, C.; Eckerle, I. Serologic Assessment of Possibility for MERS-CoV Infection in Equids. Emerg. Infect. Dis. 2015, 21, 181–182. [Google Scholar] [CrossRef] [Scilit]
- Mutso, M.; Saul, S.; Rausalu, K.; Susova, O.; Žusinaite, E.; Mahalingam, S.; Merits, A. Reverse genetic system, genetically stable reporter viruses and packaged subgenomic replicon based on a Brazilian Zika virus isolate. J. Gen. Virol. 2017, 98, 2712–2724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- UniProt. Available online: https://www.uniprot.org/ (accessed on 14 April 2020).
- Zhen, Y.; Caprioli, R.M.; Staros, J.V. Characterization of Glycosylation Sites of the Epidermal Growth Factor Receptor†. Biochemistry 2003, 42, 5478–5492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, H.; Tian, M.; Ding, C.; Yu, S. The C/EBP Homologous Protein (CHOP) Transcription Factor Functions in Endoplasmic Reticulum Stress-Induced Apoptosis and Microbial Infection. Front. Immunol. 2019, 9, 3083. [Google Scholar] [CrossRef] [Scilit]
- Imperiali, B.; O’Connor, S.E. Effect of N-linked glycosylation on glycopeptide and glycoprotein structure. Curr. Opin. Chem. Boil. 1999, 3, 643–649. [Google Scholar] [CrossRef] [Scilit]
- Molinari, M. N-glycan structure dictates extension of protein folding or onset of disposal. Nat. Methods 2007, 3, 313–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mukhopadhyay, S.; Kuhn, R.J.; Rossmann, M.G. A structural perspective of the flavivirus life cycle. Nat. Rev. Genet. 2005, 3, 13–22. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Z.; Chan, J.F.W.; Tee, K.M.; Choi, G.K.Y.; Lau, S.K.P.; Woo, P.C.; Tse, H.; Yuen, K.Y. Comparative genomic analysis of pre-epidemic and epidemic Zika virus strains for virological factors potentially associated with the rapidly expanding epidemic. Emerg. Microbes Infect. 2016, 5, e22-12. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Puerta-Guardo, H.; Biering, S.B.; Glasner, D.R.; Tran, E.B.; Patana, M.; Gomberg, T.A.; Malvar, C.; Lo, N.T.N.; Espinosa, D.A.; et al. Endocytosis of flavivirus NS1 is required for NS1-mediated endothelial hyperpermeability and is abolished by a single N-glycosylation site mutation. PLoS Pathog. 2019, 15, e1007938. [Google Scholar] [CrossRef] [Scilit]
- Yuan, L.; Huang, X.Y.; Liu, Z.Y.; Zhang, F.; Zhu, X.L.; Yu, J.Y.; Ji, X.; Xu, Y.P.; Li, G.; Li, C.; et al. A single mutation in the prM protein of Zika virus contributes to fetal microcephaly. Science 2017, 358, 933–936. [Google Scholar] [CrossRef] [Scilit]
- Nambala, P.; Su, W.-C. Role of Zika Virus prM Protein in Viral Pathogenicity and Use in Vaccine Development. Front. Microbiol. 2018, 9, 1797. [Google Scholar] [CrossRef] [Scilit]
- Arar, C.; Mignon, C.; Mattei, M.G.; Monsigny, M.; Roche, A.C.; Legrand, A. Mapping of the MR60/ERGIC-53 gene to human Chromosome 18q21.3–18q22 by in situ hybridization. Mamm. Genome 1996, 7, 791–792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hauri, H.-P.; Kappeler, F.; Andersson, H.; Appenzeller, C. ERGIC-53 and traffic in the secretory pathway. J. Cell Sci. 2000, 113, 587–596. [Google Scholar] [PubMed]
- Varki, A. Essentials of Glycobiology, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2017. [Google Scholar]
- Lorenz, I.C.; Allison, S.L.; Heinz, F.X.; Helenius, A. Folding and Dimerization of Tick-Borne Encephalitis Virus Envelope Proteins prM and E in the Endoplasmic Reticulum. J. Virol. 2002, 76, 5480–5491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Liu, L.; Naik, I.; Braunstein, Z.; Zhong, J.; Ren, B. Transcription Factor C/EBP Homologous Protein in Health and Diseases. Front. Immunol. 2017, 8, 1612. [Google Scholar] [CrossRef] [Scilit]
- Oyadomari, S.; Mori, M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ. 2003, 11, 381–389. [Google Scholar] [CrossRef] [Scilit]
- Chiribau, C.-B.; Gaccioli, F.; Huang, C.C.; Yuan, C.L.; Hatzoglou, M. Molecular Symbiosis of CHOP and C/EBPβ Isoform LIP Contributes to Endoplasmic Reticulum Stress-Induced Apoptosis. Mol. Cell. Boil. 2010, 30, 3722–3731. [Google Scholar] [CrossRef] [Scilit]
- Wiertz, E.J.H.J.; Tortorella, D.; Bogyo, M.; Yu, J.; Mothes, W.; Jones, T.R.; A Rapoport, T.; Ploegh, H.L. Sec6l-mediated transfer of a membrane protein from the endoplasmic reticulum to the proteasome for destruction. Nature 1996, 384, 432–438. [Google Scholar] [CrossRef] [Scilit]
- Braunger, K.; Pfeffer, S.; Shrimal, S.; Gilmore, R.; Berninghausen, O.; Mandon, E.C.; Becker, T.; Förster, F.; Beckmann, R. Structural basis for coupling protein transport and N-glycosylation at the mammalian endoplasmic reticulum. Science 2018, 360, 215–219. [Google Scholar] [CrossRef] [Scilit]
- Puschnik, A.S.; Marceau, C.D.; Ooi, Y.S.; Majzoub, K.; Rinis, N.; Contessa, J.N.; Carette, J.E. A Small-Molecule Oligosaccharyltransferase Inhibitor with Pan-flaviviral Activity. Cell Rep. 2017, 21, 3032–3039. [Google Scholar] [CrossRef] [Scilit]







| Name | Sequence (5′→3′) |
|---|---|
| F-NheI_C | CA GCTAGC1ATGAAAAACCCAAAAAAGAAATCC |
| R-PmeI_E | TA GTTTAAAC1TTAAGCAGAGACGGCTGTGGA |
| F-N69Q | GATTGTTGGTGCCAGACGACGTCA |
| R-N69Q | TGACGTCGTCTGGCACCAACAATC |
| F-N154Q | GGGATGATCGTTCAAGACACAGGA |
| R-N154Q | TCCTGTGTCTTGAACGATCATCCC |
| Viruses (Strain) | N-glycan Motifs | ||
|---|---|---|---|
| prM | Env | NS1 | |
| WNV (NY99) | N15 | N154 | N130, N175, N207 |
| WNV (ArB3573/82) | N15 | - | N130, N175, N207 |
| JEV (SA-14) | N15 | N154 | N130, N207 |
| SLEV (MS1-7) | N15 | - | N130, N175, N207 |
| DENV1 (Nauru/West Pac/1974) | N69 | N67, N153 | N130, N207 |
| DENV2 (Thailand/16681/1984) | N69 | N67, N153 | N130, N207 |
| DENV3 (Sri Lanka/1266/2000) | N69 | N67, N153 | N130, N207 |
| DENV4 (Singapore/8976/1995) | N69 | N67, N153, N472 | N130, N207 |
| ZIKV (MR766) | N69 | - | N130, 207 |
| ZIKV (FP/10087PF/2013) | N69 | N154 | N130, 207 |
| YFV (17D vaccine) | N13, N29 | - | N130, 208 |
| YFV (Ivory coast/1999) | N13, N29 | - | N130, 208 |
| TBEV (Hypr) | N27 | N154 | N85, N207, N223 |
| POWV (LB) | N27 | N154 | N85, N207, N223 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gwon, Y.-D.; Zusinaite, E.; Merits, A.; Överby, A.K.; Evander, M. N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle. Viruses 2020, 12, 925. https://doi.org/10.3390/v12090925
Gwon Y-D, Zusinaite E, Merits A, Överby AK, Evander M. N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle. Viruses. 2020; 12(9):925. https://doi.org/10.3390/v12090925
Chicago/Turabian StyleGwon, Yong-Dae, Eva Zusinaite, Andres Merits, Anna K. Överby, and Magnus Evander. 2020. "N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle" Viruses 12, no. 9: 925. https://doi.org/10.3390/v12090925
APA StyleGwon, Y.-D., Zusinaite, E., Merits, A., Överby, A. K., & Evander, M. (2020). N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle. Viruses, 12(9), 925. https://doi.org/10.3390/v12090925

