PRRSV Vaccine Strain-Induced Secretion of Extracellular ISG15 Stimulates Porcine Alveolar Macrophage Antiviral Response against PRRSV
Abstract
1. Introduction
2. Material and Methods
2.1. Cells, Viruses, Chemicals, and Plasmids
2.2. RNA Isolation, Reverse Transcription, Plasmids Construction, and qPCR
2.3. Expression of Recombinant Swine ISG15
2.4. Ethics Statement, Mouse Immunizations, and Cell Fusions
2.5. Enzyme-Linked Immunosorbent Assay (ELISA)
2.6. Western Blot (WB) Analysis
2.7. Immunofluorescence Assay (IFA)
2.8. Interferon Bioactivity Assay
2.9. Cell Viability Assay
2.10. PRRSV Attachment Assay
2.11. Statistical Analysis
3. Result
3.1. Development and Characterization of the Monoclonal Antibody against Swine ISG15
3.2. Establishment of Sandwich ELISA for Detection of Swine ISG15
3.3. PRRSV Vaccine Strain Induces Secretion of sISG15 in PAMs
3.4. Expression of sISG15 in PAMs Infected by the PRRSV Vaccine Strain Is IFNs-Independent
3.5. Extracellular ISG15 Stimulated PAMs Conferred Partial Resistance to PRRSV Infection
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kuhn, J.H.; Lauck, M.; Bailey, A.L.; Shchetinin, A.M.; Vishnevskaya, T.V.; Bao, Y.; Ng, T.F.; LeBreton, M.; Schneider, B.S.; Gillis, A.; et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch. Virol. 2016, 161, 755–768. [Google Scholar] [CrossRef]
- Adams, M.J.; Lefkowitz, E.J.; King, A.M.; Harrach, B.; Harrison, R.L.; Knowles, N.J.; Kropinski, A.M.; Krupovic, M.; Kuhn, J.H.; Mushegian, A.R.; et al. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses. Arch. Virol. 2016, 161, 2921–2949. [Google Scholar] [CrossRef]
- Forsberg, R. Divergence time of porcine reproductive and respiratory syndrome virus subtypes. Mol. Biol. Evol. 2005, 22, 2131–2134. [Google Scholar] [CrossRef]
- van Woensel, P.A.; Liefkens, K.; Demaret, S. Effect on viraemia of an American and a European serotype PRRSV vaccine after challenge with European wild-type strains of the virus. Vet. Rec. 1998, 142, 510–512. [Google Scholar] [CrossRef]
- Morgan, S.B.; Frossard, J.P.; Pallares, F.J.; Gough, J.; Stadejek, T.; Graham, S.P.; Steinbach, F.; Drew, T.W.; Salguero, F.J. Pathology and virus distribution in the lung and lymphoid tissues of pigs experimentally inoculated with three distinct type 1 PRRS virus isolates of varying pathogenicity. Transbound. Emerg. Dis. 2014, 63, 285–295. [Google Scholar] [CrossRef]
- Albina, E.; Carrat, C.; Charley, B. Interferon-alpha response to swine arterivirus (PoAV), the porcine reproductive and respiratory syndrome virus. J. Interferon Cytokine Res. 1998, 18, 485–490. [Google Scholar] [CrossRef]
- Duan, X.; Nauwynck, H.J.; Pensaert, M.B. Virus quantification and identification of cellular targets in the lungs and lymphoid tissues of pigs at different time intervals after inoculation with porcine reproductive and respiratory syndrome virus (PRRSV). Vet. Microbiol. 1997, 56, 9–19. [Google Scholar] [CrossRef]
- Duan, X.; Nauwynck, H.J.; Pensaert, M.B. Effects of origin and state of differentiation and activation of monocytes/macrophages on their susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV). Arch. Virol. 1997, 142, 2483–2497. [Google Scholar] [CrossRef]
- Sur, J.H.; Cooper, V.L.; Galeota, J.A.; Hesse, R.A.; Doster, A.R.; Osorio, F.A. In vivo detection of porcine reproductive and respiratory syndrome virus RNA by in situ hybridization at different times postinfection. J. Clin. Microbiol. 1996, 34, 2280–2286. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Li, L.; Yu, Y.; Tu, Y.; Tong, J.; Zhang, C.; Liu, Y.; Li, Y.; Han, Z.; Jiang, C.; et al. Highly pathogenic porcine reproductive and respiratory syndrome virus infection and induction of apoptosis in bone marrow cells of infected piglets. J. Gen. Virol. 2016, 97, 1356–1361. [Google Scholar] [CrossRef] [PubMed]
- Labarque, G.G.; Nauwynck, H.J.; Van Reeth, K.; Pensaert, M.B. Effect of cellular changes and onset of humoral immunity on the replication of porcine reproductive and respiratory syndrome virus in the lungs of pigs. J. Gen. Virol. 2000, 81, 1327–1334. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Batista, L.; Dee, S.; Halbur, P.; Murtaugh, M.P. The level of virus-specific T-cell and macrophage recruitment in porcine reproductive and respiratory syndrome virus infection in pigs is independent of virus load. J. Virol. 2004, 78, 5923–5933. [Google Scholar] [CrossRef]
- Pestka, S.; Krause, C.D.; Walter, M.R. Interferons, interferon-like cytokines, and their receptors. Immunol. Rev. 2004, 202, 8–32. [Google Scholar] [CrossRef] [PubMed]
- Uze, G.; Schreiber, G.; Piehler, J.; Pellegrini, S. The receptor of the type I interferon family. Curr. Top. Microbiol. Immunol. 2007, 316, 71–95. [Google Scholar] [PubMed]
- Schroder, K.; Hertzog, P.J.; Ravasi, T.; Hume, D.A. Interferon-gamma: An overview of signals, mechanisms and functions. J. Leukoc. Biol. 2004, 75, 163–189. [Google Scholar] [CrossRef] [PubMed]
- Katze, M.G.; He, Y.; Gale, M., Jr. Viruses and interferon: A fight for supremacy. Nat. Rev. Immunol. 2002, 2, 675–687. [Google Scholar] [CrossRef] [PubMed]
- de Veer, M.J.; Holko, M.; Frevel, M.; Walker, E.; Der, S.; Paranjape, J.M.; Silverman, R.H.; Williams, B.R. Functional classification of interferon-stimulated genes identified using microarrays. J. Leukoc. Biol. 2001, 69, 912–920. [Google Scholar]
- Loeb, K.R.; Haas, A.L. The interferon-inducible 15-kDa ubiquitin homolog conjugates to intracellular proteins. J. Biol. Chem. 1992, 267, 7806–7813. [Google Scholar]
- Knight, E., Jr.; Fahey, D.; Cordova, B.; Hillman, M.; Kutny, R.; Reich, N.; Blomstrom, D. A 15-kDa interferon-induced protein is derived by COOH-terminal processing of a 17-kDa precursor. J. Biol. Chem. 1988, 263, 4520–4522. [Google Scholar]
- Malakhova, O.A.; Yan, M.; Malakhov, M.P.; Yuan, Y.; Ritchie, K.J.; Kim, K.I.; Peterson, L.F.; Shuai, K.; Zhang, D.E. Protein ISGylation modulates the JAK-STAT signaling pathway. Genes Dev. 2003, 17, 455–460. [Google Scholar] [CrossRef]
- D’Cunha, J.; Knight, E., Jr.; Haas, A.L.; Truitt, R.L.; Borden, E.C. Immunoregulatory properties of ISG15, an interferon-induced cytokine. Proc. Natl. Acad. Sci. USA 1996, 93, 211–215. [Google Scholar] [CrossRef]
- Bogunovic, D.; Boisson-Dupuis, S.; Casanova, J.L. ISG15: Leading a double life as a secreted molecule. Exp. Mol. Med. 2013, 45, e18. [Google Scholar] [CrossRef]
- Owhashi, M.; Taoka, Y.; Ishii, K.; Nakazawa, S.; Uemura, H.; Kambara, H. Identification of a ubiquitin family protein as a novel neutrophil chemotactic factor. Biochem. Biophys. Res. Commun. 2003, 309, 533–539. [Google Scholar] [CrossRef] [PubMed]
- Swaim, C.D.; Scott, A.F.; Canadeo, L.A.; Huibregtse, J.M. Extracellular ISG15 Signals cytokine secretion through the LFA-1 integrin receptor. Mol. Cell 2017, 68, 581–590.e5. [Google Scholar] [CrossRef] [PubMed]
- Patel, D.; Nan, Y.; Shen, M.; Ritthipichai, K.; Zhu, X.; Zhang, Y.J. Porcine reproductive and respiratory syndrome virus inhibits type I interferon signaling by blocking STAT1/STAT2 nuclear translocation. J. Virol. 2010, 84, 11045–11055. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Zhang, Y.J. Antagonizing interferon-mediated immune response by porcine reproductive and respiratory syndrome virus. BioMed Res. Int. 2014, 2014, 315470. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Wang, R.; Ma, Z.; Xiao, Y.; Nan, Y.; Wang, Y.; Lin, S.; Zhang, Y.J. Porcine reproductive and respiratory syndrome virus antagonizes JAK/STAT3 signaling via nsp5, which induces STAT3 degradation. J. Virol. 2017, 91. [Google Scholar] [CrossRef]
- Chen, Z.; Lawson, S.; Sun, Z.; Zhou, X.; Guan, X.; Christopher-Hennings, J.; Nelson, E.A.; Fang, Y. Identification of two auto-cleavage products of nonstructural protein 1 (nsp1) in porcine reproductive and respiratory syndrome virus infected cells: Nsp1 function as interferon antagonist. Virology 2010, 398, 87–97. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zheng, Z.; Zhou, P.; Zhang, B.; Shi, Z.; Hu, Q.; Wang, H. The cysteine protease domain of porcine reproductive and respiratory syndrome virus non-structural protein 2 antagonizes interferon regulatory factor 3 activation. J. Gen. Virol. 2010, 91, 2947–2958. [Google Scholar] [CrossRef]
- Sun, Z.; Chen, Z.; Lawson, S.R.; Fang, Y. The cysteine protease domain of porcine reproductive and respiratory syndrome virus nonstructural protein 2 possesses deubiquitinating and interferon antagonism functions. J. Virol. 2010, 84, 7832–7846. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Zhang, Q.; Guo, X.K.; Yu, Z.B.; Xu, A.T.; Tang, J.; Feng, W.H. Porcine reproductive and respiratory syndrome virus nonstructural protein 4 antagonizes beta interferon expression by targeting the NF-kappaB essential modulator. J. Virol. 2014, 88, 10934–10945. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Wang, L.; Li, X.; Zhang, G.; Guo, J.; Zhao, D.; Chai, S.; Deng, R. Endoribonuclease activities of porcine reproductive and respiratory syndrome virus nsp11 was essential for nsp11 to inhibit IFN-beta induction. Mol. Immunol. 2011, 48, 1568–1572. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Li, Y.; Ransburgh, R.; Snijder, E.J.; Fang, Y. Nonstructural protein 2 of porcine reproductive and respiratory syndrome virus inhibits the antiviral function of interferon-stimulated gene 15. J. Virol. 2012, 86, 3839–3850. [Google Scholar] [CrossRef] [PubMed]
- Xiao, S.; Zhang, A.; Zhang, C.; Ni, H.; Gao, J.; Wang, C.; Zhao, Q.; Wang, X.; Ma, C.; Liu, H.; et al. Heme oxygenase-1 acts as an antiviral factor for porcine reproductive and respiratory syndrome virus infection and over-expression inhibits virus replication in vitro. Antivir. Res. 2014, 110, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.J.; Stein, D.A.; Fan, S.M.; Wang, K.Y.; Kroeker, A.D.; Meng, X.J.; Iversen, P.L.; Matson, D.O. Suppression of porcine reproductive and respiratory syndrome virus replication by morpholino antisense oligomers. Vet. Microbiol. 2006, 117, 117–129. [Google Scholar] [CrossRef]
- Zhang, A.; Zhao, L.; Li, N.; Duan, H.; Liu, H.; Pu, F.; Zhang, G.; Zhou, E.M.; Xiao, S. Carbon monoxide inhibits porcine reproductive and respiratory syndrome virus replication by the cyclic GMP/Protein Kinase G and NF-kappaB signaling pathway. J. Virol. 2017, 91. [Google Scholar] [CrossRef]
- Committee on Methods of Producing Monoclonal Antibodies; National Research Council. Monoclonal Antibody Production; National Academy Press: Washington, DC, USA, 1999. [Google Scholar]
- Patel, D.; Opriessnig, T.; Stein, D.A.; Halbur, P.G.; Meng, X.J.; Iversen, P.L.; Zhang, Y.J. Peptide-conjugated morpholino oligomers inhibit porcine reproductive and respiratory syndrome virus replication. Antivir. Res. 2008, 77, 95–107. [Google Scholar] [CrossRef]
- Mu, Y.; Li, L.; Zhang, B.; Huang, B.; Gao, J.; Wang, X.; Wang, C.; Xiao, S.; Zhao, Q.; Sun, Y.; et al. Glycoprotein 5 of porcine reproductive and respiratory syndrome virus strain SD16 inhibits viral replication and causes G2/M cell cycle arrest, but does not induce cellular apoptosis in Marc-145 cells. Virology 2015, 484, 136–145. [Google Scholar] [CrossRef]
- Nan, Y.; Wang, R.; Shen, M.; Faaberg, K.S.; Samal, S.K.; Zhang, Y.J. Induction of type I interferons by a novel porcine reproductive and respiratory syndrome virus isolate. Virology 2012, 432, 261–270. [Google Scholar] [CrossRef]
- Wang, R.; Nan, Y.; Yu, Y.; Yang, Z.; Zhang, Y.J. Variable interference with interferon signal transduction by different strains of porcine reproductive and respiratory syndrome virus. Vet. Microbiol. 2013, 166, 493–503. [Google Scholar] [CrossRef]
- Nan, Y.; Wu, C.; Zhang, Y.J. Interplay between janus kinase/signal transducer and activator of transcription signaling activated by type I interferons and viral antagonism. Front. Immunol. 2017, 8, 1758. [Google Scholar] [CrossRef] [PubMed]
- Janssen, H.L.A.; Brunetto, M.R.; Kim, Y.J.; Ferrari, C.; Massetto, B.; Nguyen, A.H.; Joshi, A.; Woo, J.; Lau, A.H.; Gaggar, A.; et al. Safety, efficacy and pharmacodynamics of vesatolimod (GS-9620) in virally suppressed patients with chronic hepatitis B. J. Hepatol. 2018, 68, 431–440. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Christopher-Hennings, J. Post-transcriptional control of type I interferon induction by porcine reproductive and respiratory syndrome virus in its natural host cells. Viruses 2012, 4, 725–733. [Google Scholar] [CrossRef] [PubMed]
- Miller, L.C.; Laegreid, W.W.; Bono, J.L.; Chitko-McKown, C.G.; Fox, J.M. Interferon type I response in porcine reproductive and respiratory syndrome virus-infected MARC-145 cells. Arch. Virol. 2004, 149, 2453–2463. [Google Scholar] [CrossRef]
- Sadler, A.J.; Williams, B.R. Interferon-inducible antiviral effectors. Nat. Rev. Immunol. 2008, 8, 559–568. [Google Scholar] [CrossRef]
- Zhang, D.; Zhang, D.E. Interferon-stimulated gene 15 and the protein ISGylation system. J. Interferon Cytokine Res. 2011, 31, 119–130. [Google Scholar] [CrossRef]
- Lenschow, D.J.; Giannakopoulos, N.V.; Gunn, L.J.; Johnston, C.; O’Guin, A.K.; Schmidt, R.E.; Levine, B.; Virgin, H.W., 4th. Identification of interferon-stimulated gene 15 as an antiviral molecule during Sindbis virus infection in vivo. J. Virol. 2005, 79, 13974–13983. [Google Scholar] [CrossRef]
- Osiak, A.; Utermohlen, O.; Niendorf, S.; Horak, I.; Knobeloch, K.P. ISG15, an interferon-stimulated ubiquitin-like protein, is not essential for STAT1 signaling and responses against vesicular stomatitis and lymphocytic choriomeningitis virus. Mol. Cell. Biol. 2005, 25, 6338–6345. [Google Scholar] [CrossRef]
- Seo, E.J.; Leis, J. Budding of enveloped viruses: Interferon-induced ISG15-antivirus mechanisms targeting the release process. Adv. Virol. 2012, 2012, 532723. [Google Scholar] [CrossRef]
- Bogunovic, D.; Byun, M.; Durfee, L.A.; Abhyankar, A.; Sanal, O.; Mansouri, D.; Salem, S.; Radovanovic, I.; Grant, A.V.; Adimi, P.; et al. Mycobacterial disease and impaired IFN-gamma immunity in humans with inherited ISG15 deficiency. Science 2012, 337, 1684–1688. [Google Scholar] [CrossRef]
- Nan, Y.; Wu, C.; Gu, G.; Sun, W.; Zhang, Y.J.; Zhou, E.M. Improved vaccine against PRRSV: Current progress and future perspective. Front. Microbiol. 2017, 8, 1635. [Google Scholar] [CrossRef] [PubMed]





| Primers | Sequence (5′–3′) | Function |
|---|---|---|
| pCold-SUMO-UBI-F | CCCTCGAGCAGATCTTCGTGAAGACCT | Cloning of swine ubiquitin |
| pCold-SUMO-UBI-R | GCTCTAGATTAGCAGCCACCCCTCAGA | |
| sISG15-RT-F | AGCAACGCCTATGAGGTCTG | qPCR detection of ISG15 |
| sISG15-RT-R | CCCTCGAAAGTCAGCCAGAA | |
| GAPDH-F | CCTTCCGTGTCCCTACTGCCAAC | qPCR detection of GAPDH |
| GAPDH-R | GACGCCTGCTTCACCACCTTCT | |
| sIFNB-RT-F | AGCACTGGCTGGAATGAAAC | qPCR detection of IFN-β mRNA |
| sIFNB-RT-R | TCCAGGATTGTCTCCAGGTC | |
| PRRSV-N-F | ATGCCAAATAACAACGGCAAGCAGC | qPCR detection of PRRSV-RNA |
| PRRSV-N-R | TCATGCTGAGGGTGATGCTGTG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, H.; Shi, B.; Zhang, Z.; Zhao, B.; Zhao, G.; Li, Y.; Nan, Y. PRRSV Vaccine Strain-Induced Secretion of Extracellular ISG15 Stimulates Porcine Alveolar Macrophage Antiviral Response against PRRSV. Viruses 2020, 12, 1009. https://doi.org/10.3390/v12091009
Liu H, Shi B, Zhang Z, Zhao B, Zhao G, Li Y, Nan Y. PRRSV Vaccine Strain-Induced Secretion of Extracellular ISG15 Stimulates Porcine Alveolar Macrophage Antiviral Response against PRRSV. Viruses. 2020; 12(9):1009. https://doi.org/10.3390/v12091009
Chicago/Turabian StyleLiu, Hongbin, Bingjun Shi, Zhigang Zhang, Bao Zhao, Guangming Zhao, Yijing Li, and Yuchen Nan. 2020. "PRRSV Vaccine Strain-Induced Secretion of Extracellular ISG15 Stimulates Porcine Alveolar Macrophage Antiviral Response against PRRSV" Viruses 12, no. 9: 1009. https://doi.org/10.3390/v12091009
APA StyleLiu, H., Shi, B., Zhang, Z., Zhao, B., Zhao, G., Li, Y., & Nan, Y. (2020). PRRSV Vaccine Strain-Induced Secretion of Extracellular ISG15 Stimulates Porcine Alveolar Macrophage Antiviral Response against PRRSV. Viruses, 12(9), 1009. https://doi.org/10.3390/v12091009

