Human Cytomegalovirus-Encoded G Protein-Coupled Receptor UL33 Facilitates Virus Dissemination via the Extracellular and Cell-to-Cell Route
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cell Culture
2.2. ELISA and Reporter Gene Assays
2.3. Bacterial Artificial Chromosomes (BAC) Mutagenesis and Recombinant Viruses
2.4. Analysis of Virus Growth and Spread
2.5. Immunofluorescence Microscopy
2.6. Multiple Sequence Alignment and Secondary Structure Prediction of UL33
3. Results
3.1. Generation of HCMV Merlin Recombinants
3.2. UL33 is Important for Virus Spread in Fibroblasts
3.3. US28 and UL33 Facilitate Cell-to-Cell Virus Spread
3.4. Expression of Several Essential HCMV Proteins Is Not Regulated by UL33
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Pierce, K.L.; Premont, R.T.; Lefkowitz, R.J. Seven-transmembrane receptors. Nat. Rev. Mol. Cell. Biol. 2002, 3, 639–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molleskov-Jensen, A.S.; Oliveira, M.T.; Farrell, H.E.; Davis-Poynter, N. Virus-encoded 7 transmembrane receptors. Prog. Mol. Biol. Transl. Sci. 2015, 129, 353–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vischer, H.F.; Siderius, M.; Leurs, R.; Smit, M.J. Herpesvirus-encoded GPCRs: Neglected players in inflammatory and proliferative diseases? Nat. Rev. Drug. Discov. 2014, 13, 123–139. [Google Scholar] [CrossRef] [Scilit]
- Bate, S.L.; Dollard, S.C.; Cannon, M.J. Cytomegalovirus seroprevalence in the USA: The national health and nutrition examination surveys, 1988–2004. Clin. Infect. Dis. 2010, 50, 1439–1447. [Google Scholar] [CrossRef] [Scilit]
- Britt, W. Manifestations of human cytomegalovirus infection: Proposed mechanisms of acute and chronic disease. Curr. Top. Microbiol. Immunol. 2008, 325, 417–470. [Google Scholar] [CrossRef] [Scilit]
- Chee, M.S.; Satchwell, S.C.; Preddie, E.; Weston, K.M.; Barrell, B.G. Human cytomegalovirus encodes three G protein-coupled receptor homologues. Nature 1990, 344, 774–777. [Google Scholar] [CrossRef] [Scilit]
- Margulies, B.J.; Browne, H.; Gibson, W. Identification of the human cytomegalovirus G protein-coupled receptor homologue encoded by UL33 in infected cells and enveloped virus particles. Virology 1996, 225, 111–125. [Google Scholar] [CrossRef] [Scilit]
- Penfold, M.E.; Schmidt, T.L.; Dairaghi, D.J.; Barry, P.A.; Schall, T.J. Characterization of the rhesus cytomegalovirus US28 locus. J. Virol. 2003, 77, 10404–10413. [Google Scholar] [CrossRef] [Scilit]
- Margulies, B.J.; Gibson, W. The chemokine receptor homologue encoded by US27 of human cytomegalovirus is heavily glycosylated and is present in infected human foreskin fibroblasts and enveloped virus particles. Virus Res. 2007, 123, 57–71. [Google Scholar] [CrossRef] [Scilit]
- O’Connor, C.M.; Shenk, T. Human cytomegalovirus pUL78 G protein-coupled receptor homologue is required for timely cell entry in epithelial cells but not fibroblasts. J. Virol. 2012, 86, 11425–11433. [Google Scholar] [CrossRef] [Scilit]
- Noriega, V.M.; Gardner, T.J.; Redmann, V.; Bongers, G.; Lira, S.A.; Tortorella, D. Human cytomegalovirus US28 facilitates cell-to-cell viral dissemination. Viruses 2014, 6, 1202–1218. [Google Scholar] [CrossRef] [Scilit]
- O’Connor, C.M.; Shenk, T. Human cytomegalovirus pUS27 G protein-coupled receptor homologue is required for efficient spread by the extracellular route but not for direct cell-to-cell spread. J. Virol. 2011, 85, 3700–3707. [Google Scholar] [CrossRef] [Scilit]
- Lollinga, W.T.; de Wit, R.H.; Rahbar, A.; Vasse, G.F.; Davoudi, B.; Diepstra, A.; Riezebos-Brilman, A.; Harmsen, M.C.; Hillebrands, J.L.; Soderberg-Naucler, C.; et al. Human Cytomegalovirus-Encoded Receptor US28 Is Expressed in Renal Allografts and Facilitates Viral Spreading In Vitro. Transplantation 2017, 101, 531–540. [Google Scholar] [CrossRef] [Scilit]
- Humby, M.S.; O’Connor, C.M. Human Cytomegalovirus US28 Is Important for Latent Infection of Hematopoietic Progenitor Cells. J. Virol. 2015, 90, 2959–2970. [Google Scholar] [CrossRef] [Scilit]
- Krishna, B.A.; Poole, E.L.; Jackson, S.E.; Smit, M.J.; Wills, M.R.; Sinclair, J.H. Latency-Associated Expression of Human Cytomegalovirus US28 Attenuates Cell Signaling Pathways To Maintain Latent Infection. MBio 2017, 8. [Google Scholar] [CrossRef] [Scilit]
- Arnolds, K.L.; Lares, A.P.; Spencer, J.V. The US27 gene product of human cytomegalovirus enhances signaling of host chemokine receptor CXCR4. Virology 2013, 439, 122–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Randolph-Habecker, J.R.; Rahill, B.; Torok-Storb, B.; Vieira, J.; Kolattukudy, P.E.; Rovin, B.H.; Sedmak, D.D. The expression of the cytomegalovirus chemokine receptor homolog US28 sequesters biologically active CC chemokines and alters IL-8 production. Cytokine 2002, 19, 37–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Streblow, D.N.; Vomaske, J.; Smith, P.; Melnychuk, R.; Hall, L.; Pancheva, D.; Smit, M.; Casarosa, P.; Schlaepfer, D.D.; Nelson, J.A. Human cytomegalovirus chemokine receptor US28-induced smooth muscle cell migration is mediated by focal adhesion kinase and Src. J. Biol. Chem. 2003, 278, 50456–50465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Streblow, D.N.; Soderberg-Naucler, C.; Vieira, J.; Smith, P.; Wakabayashi, E.; Ruchti, F.; Mattison, K.; Altschuler, Y.; Nelson, J.A. The human cytomegalovirus chemokine receptor US28 mediates vascular smooth muscle cell migration. Cell 1999, 99, 511–520. [Google Scholar] [CrossRef] [Scilit]
- Vomaske, J.; Melnychuk, R.M.; Smith, P.P.; Powell, J.; Hall, L.; DeFilippis, V.; Fruh, K.; Smit, M.; Schlaepfer, D.D.; Nelson, J.A.; et al. Differential ligand binding to a human cytomegalovirus chemokine receptor determines cell type-specific motility. PLoS Pathog. 2009, 5, e1000304. [Google Scholar] [CrossRef] [Scilit]
- Casarosa, P.; Gruijthuijsen, Y.K.; Michel, D.; Beisser, P.S.; Holl, J.; Fitzsimons, C.P.; Verzijl, D.; Bruggeman, C.A.; Mertens, T.; Leurs, R.; et al. Constitutive signaling of the human cytomegalovirus-encoded receptor UL33 differs from that of its rat cytomegalovirus homolog R33 by promiscuous activation of G proteins of the Gq, Gi, and Gs classes. J. Biol. Chem. 2003, 278, 50010–50023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Senten, J.R.; Bebelman, M.P.; Fan, T.S.; Heukers, R.; Bergkamp, N.D.; van Gasselt, P.; Langemeijer, E.V.; Slinger, E.; Lagerweij, T.; Rahbar, A.; et al. The human cytomegalovirus-encoded G protein-coupled receptor UL33 exhibits oncomodulatory properties. J. Biol. Chem. 2019. [Google Scholar] [CrossRef] [Scilit]
- Dunn, W.; Chou, C.; Li, H.; Hai, R.; Patterson, D.; Stolc, V.; Zhu, H.; Liu, F. Functional profiling of a human cytomegalovirus genome. Proc. Natl. Acad. Sci. USA 2003, 100, 14223–14228. [Google Scholar] [CrossRef] [Scilit]
- Yu, D.; Silva, M.C.; Shenk, T. Functional map of human cytomegalovirus AD169 defined by global mutational analysis. Proc. Natl. Acad. Sci. USA 2003, 100, 12396–12401. [Google Scholar] [CrossRef] [Scilit]
- Beisser, P.S.; Vink, C.; Van Dam, J.G.; Grauls, G.; Vanherle, S.J.; Bruggeman, C.A. The R33 G protein-coupled receptor gene of rat cytomegalovirus plays an essential role in the pathogenesis of viral infection. J. Virol. 1998, 72, 2352–2363. [Google Scholar] [CrossRef] [Scilit]
- Farrell, H.E.; Abraham, A.M.; Cardin, R.D.; Molleskov-Jensen, A.S.; Rosenkilde, M.M.; Davis-Poynter, N. Identification of common mechanisms by which human and mouse cytomegalovirus seven-transmembrane receptor homologues contribute to in vivo phenotypes in a mouse model. J. Virol. 2013, 87, 4112–4117. [Google Scholar] [CrossRef] [Scilit]
- Davis-Poynter, N.J.; Lynch, D.M.; Vally, H.; Shellam, G.R.; Rawlinson, W.D.; Barrell, B.G.; Farrell, H.E. Identification and characterization of a G protein-coupled receptor homolog encoded by murine cytomegalovirus. J. Virol. 1997, 71, 1521–1529. [Google Scholar] [CrossRef] [Scilit]
- Cardin, R.D.; Schaefer, G.C.; Allen, J.R.; Davis-Poynter, N.J.; Farrell, H.E. The M33 chemokine receptor homolog of murine cytomegalovirus exhibits a differential tissue-specific role during in vivo replication and latency. J. Virol. 2009, 83, 7590–7601. [Google Scholar] [CrossRef] [Scilit]
- Farrell, H.E.; Abraham, A.M.; Cardin, R.D.; Sparre-Ulrich, A.H.; Rosenkilde, M.M.; Spiess, K.; Jensen, T.H.; Kledal, T.N.; Davis-Poynter, N. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues. J. Virol. 2011, 85, 6091–6095. [Google Scholar] [CrossRef] [Scilit]
- Farrell, H.E.; Bruce, K.; Lawler, C.; Oliveira, M.; Cardin, R.; Davis-Poynter, N.; Stevenson, P.G. Murine Cytomegalovirus Spreads by Dendritic Cell Recirculation. MBio 2017, 8. [Google Scholar] [CrossRef] [Scilit]
- Case, R.; Sharp, E.; Benned-Jensen, T.; Rosenkilde, M.M.; Davis-Poynter, N.; Farrell, H.E. Functional analysis of the murine cytomegalovirus chemokine receptor homologue M33: Ablation of constitutive signaling is associated with an attenuated phenotype in vivo. J. Virol. 2008, 82, 1884–1898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Warming, S.; Costantino, N.; Court, D.L.; Jenkins, N.A.; Copeland, N.G. Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 2005, 33, e36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Scilit]
- Bongers, G.; Maussang, D.; Muniz, L.R.; Noriega, V.M.; Fraile-Ramos, A.; Barker, N.; Marchesi, F.; Thirunarayanan, N.; Vischer, H.F.; Qin, L.; et al. The cytomegalovirus-encoded chemokine receptor US28 promotes intestinal neoplasia in transgenic mice. J. Clin. Investig. 2010, 120, 3969–3978. [Google Scholar] [CrossRef] [Scilit]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [Scilit]
- Matrosovich, M.; Matrosovich, T.; Garten, W.; Klenk, H.D. New low-viscosity overlay medium for viral plaque assays. Virol. J. 2006, 3, 63. [Google Scholar] [CrossRef] [Scilit]
- Stanton, R.J.; Baluchova, K.; Dargan, D.J.; Cunningham, C.; Sheehy, O.; Seirafian, S.; McSharry, B.P.; Neale, M.L.; Davies, J.A.; Tomasec, P.; et al. Reconstruction of the complete human cytomegalovirus genome in a BAC reveals RL13 to be a potent inhibitor of replication. J. Clin. Investig. 2010, 120, 3191–3208. [Google Scholar] [CrossRef] [Scilit]
- Miller, W.E.; Zagorski, W.A.; Brenneman, J.D.; Avery, D.; Miller, J.L.; O’Connor, C.M. US28 is a potent activator of phospholipase C during HCMV infection of clinically relevant target cells. PLoS ONE 2012, 7, e50524. [Google Scholar] [CrossRef] [Scilit]
- Vieira, J.; Schall, T.J.; Corey, L.; Geballe, A.P. Functional analysis of the human cytomegalovirus US28 gene by insertion mutagenesis with the green fluorescent protein gene. J. Virol. 1998, 72, 8158–8165. [Google Scholar] [CrossRef] [Scilit]
- Bodaghi, B.; Jones, T.R.; Zipeto, D.; Vita, C.; Sun, L.; Laurent, L.; Arenzana-Seisdedos, F.; Virelizier, J.L.; Michelson, S. Chemokine sequestration by viral chemoreceptors as a novel viral escape strategy: Withdrawal of chemokines from the environment of cytomegalovirus-infected cells. J. Exp. Med. 1998, 188, 855–866. [Google Scholar] [CrossRef] [Scilit]
- Schultz, E.P.; Lanchy, J.M.; Day, L.Z.; Yu, Q.; Peterson, C.; Preece, J.; Ryckman, B.J. Specialization for cell-free or cell-to-cell spread of BAC-cloned HCMV strains is determined by factors beyond the UL128-131 and RL13 loci. J. Virol. 2020. [Google Scholar] [CrossRef] [Scilit]
- Cha, T.A.; Tom, E.; Kemble, G.W.; Duke, G.M.; Mocarski, E.S.; Spaete, R.R. Human cytomegalovirus clinical isolates carry at least 19 genes not found in laboratory strains. J. Virol. 1996, 70, 78–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Primer | Primer Description | Primer Sequence (5′-3′) |
|---|---|---|
| 1 | ΔUl33 → galK F | CGGAAGCGTCGTCGCCCCGGACTGCGCCCGCGGTCTG CTATTCGTCCACGCCTGTTGACAATTAATCATCGGCA |
| 2 | ΔUl33 → galK R | GGGAAATGGCGACGGGTTCTGGTGCTTTCTGAATAA AGTAACAGGAAAGCTCAGCACTGTCCTGCTCCTT |
| 3 | ΔUS28 → galK F | GTGCGTGGACCAGACGGCGTCCATGCACCGAGGGCAG AACTGGTGCTATCCCTGTTGACAATTAATCATCGGCA |
| 4 | ΔUS28 → galK R | ATCCATAACTTCGTATAATGTATGCTATACGAAGT TATAGCGCTTTTTTATCAGCACTGTCCTGCTCCT |
| 5 | galK → UL33-HA F | GGAAGCGTCGTCGCCCCGGACTGCG |
| 6 | galK → UL33-HA R | GGAAATGGCGACGGGTTCTGGTGC |
| 7 | galK → US28 F | GTGCGTGGACCAGACGGCGTCCATG |
| 8 | galK → US28 R | CCATAACTTCGTATAATGTATGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
van Senten, J.R.; Bebelman, M.P.; van Gasselt, P.; Bergkamp, N.D.; van den Bor, J.; Siderius, M.; Smit, M.J. Human Cytomegalovirus-Encoded G Protein-Coupled Receptor UL33 Facilitates Virus Dissemination via the Extracellular and Cell-to-Cell Route. Viruses 2020, 12, 594. https://doi.org/10.3390/v12060594
van Senten JR, Bebelman MP, van Gasselt P, Bergkamp ND, van den Bor J, Siderius M, Smit MJ. Human Cytomegalovirus-Encoded G Protein-Coupled Receptor UL33 Facilitates Virus Dissemination via the Extracellular and Cell-to-Cell Route. Viruses. 2020; 12(6):594. https://doi.org/10.3390/v12060594
Chicago/Turabian Stylevan Senten, Jeffrey R., Maarten P. Bebelman, Puck van Gasselt, Nick D. Bergkamp, Jelle van den Bor, Marco Siderius, and Martine J. Smit. 2020. "Human Cytomegalovirus-Encoded G Protein-Coupled Receptor UL33 Facilitates Virus Dissemination via the Extracellular and Cell-to-Cell Route" Viruses 12, no. 6: 594. https://doi.org/10.3390/v12060594
APA Stylevan Senten, J. R., Bebelman, M. P., van Gasselt, P., Bergkamp, N. D., van den Bor, J., Siderius, M., & Smit, M. J. (2020). Human Cytomegalovirus-Encoded G Protein-Coupled Receptor UL33 Facilitates Virus Dissemination via the Extracellular and Cell-to-Cell Route. Viruses, 12(6), 594. https://doi.org/10.3390/v12060594

