Foodborne Transmission and Clinical Symptoms of Honey Bee Viruses in Ants Lasius spp.
Abstract
1. Introduction
2. Materials and Methods
2.1. Foodborne Transmission of DWV and ABPV
2.2. Preparation of Virus-Infected Honey Bee Pupae
2.3. Field Survey
2.4. Clinical Symptoms of ABPV
2.5. RNA Extraction
2.6. Reverse Transcription
2.7. Real-Time Quantitative PCR
2.8. Negative-Sense Strand-Specific PCR
2.9. Statistical Analyses
3. Results
3.1. Foodborne Transmission of DWV and ABPV
3.2. Field Survey
3.3. Clinical Symptoms of ABPV
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Biesmeijer, J.C.; Roberts, S.P.; Reemer, M.; Ohlemüller, R.; Edwards, M.; Peeters, T.; Schaffers, A.; Potts, S.G.; Kleukers, R.; Thomas, C. Parallel declines in pollinators and insect-pollinated plants in Britain and the Netherlands. Science 2006, 313, 351–354. [Google Scholar] [CrossRef]
- Hallmann, C.A.; Sorg, M.; Jongejans, E.; Siepel, H.; Hofland, N.; Schwan, H.; Stenmans, W.; Müller, A.; Sumser, H.; Hörren, T. More than 75 percent decline over 27 years in total flying insect biomass in protected areas. PLoS ONE 2017, 12, e0185809. [Google Scholar] [CrossRef]
- Seibold, S.; Gossner, M.M.; Simons, N.K.; Blüthgen, N.; Müller, J.; Ambarlı, D.; Ammer, C.; Bauhus, J.; Fischer, M.; Habel, J.C. Arthropod decline in grasslands and forests is associated with landscape-level drivers. Nature 2019, 574, 671–674. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, P.; Barton, P.S.; Birkhofer, K.; Chichorro, F.; Deacon, C.; Fartmann, T.; Fukushima, C.S.; Gaigher, R.; Habel, J.C.; Hallmann, C.A. Scientists’ warning to humanity on insect extinctions. Biol. Conserv. 2020. [Google Scholar] [CrossRef]
- Losey, J.E.; Vaughan, M. The economic value of ecological services provided by insects. Bioscience 2006, 56, 311–323. [Google Scholar] [CrossRef]
- Costanza, R.; d’Arge, R.; De Groot, R.; Farber, S.; Grasso, M.; Hannon, B.; Limburg, K.; Naeem, S.; O’neill, R.V.; Paruelo, J. The value of the world’s ecosystem services and natural capital. Nature 1997, 387, 253. [Google Scholar] [CrossRef]
- Potts, S.G.; Biesmeijer, J.C.; Kremen, C.; Neumann, P.; Schweiger, O.; Kunin, W.E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol. Evol. 2010, 25, 345–353. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Bayo, F.; Wyckhuys, K.A. Worldwide decline of the entomofauna: A review of its drivers. Biol. Conserv. 2019, 232, 8–27. [Google Scholar] [CrossRef]
- Daszak, P.; Cunningham, A.A.; Hyatt, A.D. Emerging infectious diseases of wildlife--threats to biodiversity and human health. Science 2000, 287, 443–449. [Google Scholar] [CrossRef]
- Morens, D.M.; Folkers, G.K.; Fauci, A.S. The challenge of emerging and re-emerging infectious diseases. Nature 2004, 430, 242. [Google Scholar] [CrossRef]
- Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global trends in emerging infectious diseases. Nature 2008, 451, 990. [Google Scholar] [CrossRef] [PubMed]
- Woolhouse, M. Quantifying transmission. In Microbial Transmission; Baquero, F., Bouza, E., Gutiérrez-Fuentes, J., Coque, T., Eds.; ASM Press: Washington, DC, USA, 2019; pp. 279–289. [Google Scholar]
- Wolfe, N.D.; Dunavan, C.P.; Diamond, J. Origins of major human infectious diseases. Nature 2007, 447, 279. [Google Scholar] [CrossRef] [PubMed]
- Longdon, B.; Brockhurst, M.A.; Russell, C.A.; Welch, J.J.; Jiggins, F.M. The evolution and genetics of virus host shifts. PLoS Pathog. 2014, 10, e1004395. [Google Scholar] [CrossRef] [PubMed]
- Woolhouse, M.E.; Webster, J.P.; Domingo, E.; Charlesworth, B.; Levin, B.R. Biological and biomedical implications of the co-evolution of pathogens and their hosts. Nat. Gen. 2002, 32, 569. [Google Scholar] [CrossRef] [PubMed]
- Moya, A.; Holmes, E.C.; González-Candelas, F. The population genetics and evolutionary epidemiology of RNA viruses. Nat. Rev. Microbiol. 2004, 2, 279. [Google Scholar] [CrossRef] [PubMed]
- Woolhouse, M.E.; Haydon, D.T.; Antia, R. Emerging pathogens: The epidemiology and evolution of species jumps. Trends Ecol. Evol. 2005, 20, 238–244. [Google Scholar] [CrossRef] [PubMed]
- Woolhouse, M.E.; Taylor, L.H.; Haydon, D.T. Population biology of multihost pathogens. Science 2001, 292, 1109–1112. [Google Scholar] [CrossRef]
- Tehel, A.; Brown, M.J.; Paxton, R.J. Impact of managed honey bee viruses on wild bees. Curr. Opin. Virol. 2016, 19, 16–22. [Google Scholar] [CrossRef]
- Fürst, M.; McMahon, D.P.; Osborne, J.; Paxton, R.; Brown, M. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature 2014, 506, 364. [Google Scholar] [CrossRef]
- Chen, Y.; Evans, J.; Feldlaufer, M. Horizontal and vertical transmission of viruses in the honey bee, Apis mellifera. J. Invertebr. Pathol. 2006, 92, 152–159. [Google Scholar] [CrossRef]
- Martin, S.J.; Brettell, L.E. Deformed wing virus in Honeybees and Other Insects. Ann. Rev. Virol. 2019, 6. [Google Scholar] [CrossRef] [PubMed]
- Porter, S.D.; Valles, S.M.; Pereira, R.M. Scavenging crickets (Orthoptera: Gryllidae) transmit Solenopsis invicta virus 3 to red imported fire ant (Hymenoptera: Formicidae) colonies. Fla. Entomol. 2016, 99, 811–813. [Google Scholar] [CrossRef][Green Version]
- Schläppi, D.; Lattrell, P.; Yañez, O.; Chejanovsky, N.; Neumann, P. Foodborne Transmission of Deformed Wing Virus to Ants (Myrmica rubra). Insects 2019, 10, 394. [Google Scholar] [CrossRef] [PubMed]
- Yue, C.; Schröder, M.; Gisder, S.; Genersch, E. Vertical-transmission routes for deformed wing virus of honeybees (Apis mellifera). J. Gen. Virol. 2007, 88, 2329–2336. [Google Scholar] [CrossRef]
- Forzan, M.; Sagona, S.; Mazzei, M.; Felicioli, A. Detection of deformed wing virus in Vespa crabro. Bull. Insectol. 2017, 70, 261–265. [Google Scholar]
- Martin, S.J.; Highfield, A.C.; Brettell, L.; Villalobos, E.M.; Budge, G.E.; Powell, M.; Nikaido, S.; Schroeder, D.C. Global honey bee viral landscape altered by a parasitic mite. Science 2012, 336, 1304–1306. [Google Scholar] [CrossRef]
- Neumann, P.; Yañez, O.; Fries, I.; de Miranda, J.R. Varroa invasion and virus adaptation. Trends Parasitol. 2012, 28, 353–354. [Google Scholar] [CrossRef]
- Wilfert, L.; Long, G.; Leggett, H.; Schmid-Hempel, P.; Butlin, R.; Martin, S.; Boots, M. Deformed wing virus is a recent global epidemic in honeybees driven by Varroa mites. Science 2016, 351, 594–597. [Google Scholar] [CrossRef]
- De Miranda, J.R.; Genersch, E. Deformed wing virus. J. Invertebr. Pathol. 2010, 103, 48–61. [Google Scholar] [CrossRef]
- de Miranda, J.R.; Cordoni, G.; Budge, G. The acute bee paralysis virus–Kashmir bee virus–Israeli acute paralysis virus complex. J. Invertebr. Pathol. 2010, 103, S30–S47. [Google Scholar] [CrossRef]
- Payne, A.N.; Shepherd, T.F.; Rangel, J. The detection of honey bee (Apis mellifera)-associated viruses in ants. Sci. Rep. 2020, 10, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.D.; Spivak, M. Socialized medicine: Individual and communal disease barriers in honey bees. J. Invertebr. Pathol. 2010, 103, 62–72. [Google Scholar] [CrossRef] [PubMed]
- Dainat, B.; Kuhn, R.; Cherix, D.; Neumann, P. A scientific note on the ant pitfall for quantitative diagnosis of Varroa destructor. Apidologie 2011, 42, 740–742. [Google Scholar] [CrossRef]
- Celle, O.; Blanchard, P.; Olivier, V.; Schurr, F.; Cougoule, N.; Faucon, J.-P.; Ribière, M. Detection of Chronic bee paralysis virus (CBPV) genome and its replicative RNA form in various hosts and possible ways of spread. Virus Res. 2008, 133, 280–284. [Google Scholar] [CrossRef]
- Levitt, A.L.; Singh, R.; Cox-Foster, D.L.; Rajotte, E.; Hoover, K.; Ostiguy, N.; Holmes, E.C. Cross-species transmission of honey bee viruses in associated arthropods. Virus Res. 2013, 176, 232–240. [Google Scholar] [CrossRef]
- Sébastien, A.; Lester, P.J.; Hall, R.J.; Wang, J.; Moore, N.E.; Gruber, M.A. Invasive ants carry novel viruses in their new range and form reservoirs for a honeybee pathogen. Biol. Lett. 2015, 11, 20150610. [Google Scholar] [CrossRef]
- Cooling, M.; Gruber, M.; Hoffmann, B.; Sébastien, A.; Lester, P. A metatranscriptomic survey of the invasive yellow crazy ant, Anoplolepis gracilipes, identifies several potential viral and bacterial pathogens and mutualists. Insect Soc. 2017, 64, 197–207. [Google Scholar] [CrossRef]
- Gruber, M.A.; Cooling, M.; Baty, J.W.; Buckley, K.; Friedlander, A.; Quinn, O.; Russell, J.F.; Sébastien, A.; Lester, P.J. Single-stranded RNA viruses infecting the invasive Argentine ant, Linepithema humile. Sci. Rep. 2017, 7. [Google Scholar] [CrossRef]
- Lester, P.J.; Buick, K.H.; Baty, J.W.; Felden, A.; Haywood, J. Different bacterial and viral pathogens trigger distinct immune responses in a globally invasive ant. Sci. Rep. 2019, 9, 1–10. [Google Scholar] [CrossRef]
- Folgarait, P.J. Ant biodiversity and its relationship to ecosystem functioning: A review. Biodiv. Conserv. 1998, 7, 1221–1244. [Google Scholar] [CrossRef]
- Del Toro, I.; Ribbons, R.R.; Pelini, S.L. The little things that run the world revisited: A review of ant-mediated ecosystem services and disservices (Hymenoptera: Formicidae). Myrmecol. News 2012, 17, 133–146. [Google Scholar]
- Seifert, B. Die Ameisen Mittel- und Nordeuropas; Lutra Verlags und Vertriebsgesellschaft: Tauer, Germany, 2007; p. 368. [Google Scholar]
- Kipyatkov, V.; Lopatina, E.; Imamgaliev, A.; Shirokova, L. Effect of temperature on rearing of the first brood by the founder females of the ant Lasius niger (Hymenoptera, Formicidae): Latitude-dependent variability of the response norm. J. Evol. Biochem. Physiol. 2004, 40, 165–175. [Google Scholar] [CrossRef]
- Ribière, M.; Olivier, V.; Blanchard, P. Chronic bee paralysis: A disease and a virus like no other? J. Invertebr. Pathol. 2010, 103, S120–S131. [Google Scholar] [CrossRef] [PubMed]
- Hölldobler, B.; Wilson, E.O. The multiple recruitment systems of the African weaver ant Oecophylla longinoda (Latreille)(Hymenoptera: Formicidae). Behav. Ecol. Sociobiol. 1978, 3, 19–60. [Google Scholar] [CrossRef]
- Czaczkes, T.J.; Heinze, J.; Ruther, J. Nest Etiquette—Where Ants Go When Nature Calls. PLoS ONE 2015, 10, e0118376. [Google Scholar] [CrossRef] [PubMed]
- de Miranda, J.R.; Bailey, L.; Ball, B.V.; Blanchard, P.; Budge, G.E.; Chejanovsky, N.; Chen, Y.-P.; Gauthier, L.; Genersch, E.; De Graaf, D.C. Standard methods for virus research in Apis. mellifera. J. Apicult Res. 2013, 52, 1–56. [Google Scholar] [CrossRef]
- Williams, G.R.; Alaux, C.; Costa, C.; Csaki, T.; Doublet, V.; Eisenhardt, D.; Fries, I.; Kuhn, R.; McMahon, D.P.; Medrzycki, P.; et al. Standard methods for maintaining adult Apis mellifera in cages under in vitro laboratory conditions. J. Apicult. Res. 2013, 52, 1–36. [Google Scholar] [CrossRef]
- Yañez, O.; Gauthier, L.; Chantawannakul, P.; Neumann, P. Endosymbiotic bacteria in honey bees: Arsenophonus spp. are not transmitted transovarially. FEMS Microbiol. Lett. 2016, 363. [Google Scholar] [CrossRef]
- Valles, S.M.; Porter, S.D. Procedures to mitigate the impact of Solenopsis invicta virus 3 in fire ant (Hymenoptera: Formicidae) rearing facilities. Fla. Entomol. 2013, 96, 252–254. [Google Scholar] [CrossRef]
- Evans, J.D.; Schwarz, R.S.; Chen, Y.P.; Budge, G.; Cornman, R.S.; De la Rua, P.; de Miranda, J.R.; Foret, S.; Foster, L.; Gauthier, L. Standard methods for molecular research in Apis. mellifera. J. Apicult. Res. 2013, 52, 1–54. [Google Scholar] [CrossRef]
- Tentcheva, D.; Gauthier, L.; Bagny, L.; Fievet, J.; Dainat, B.; Cousserans, F.; Colin, M.E.; Bergoin, M. Comparative analysis of deformed wing virus (DWV) RNA in Apis mellifera and Varroa destructor. Apidologie 2006, 37, 41–50. [Google Scholar] [CrossRef]
- Lowenthal, M.S.; Quittman, E.; Phinney, K.W. Absolute quantification of RNA or DNA using acid hydrolysis and mass spectrometry. Anal. Chem. 2019, 91, 14569–14576. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Yañez, O.; Jaffé, R.; Jarosch, A.; Fries, I.; Moritz, R.F.; Paxton, R.J.; de Miranda, J.R. Deformed wing virus and drone mating flights in the honey bee (Apis mellifera): Implications for sexual transmission of a major honey bee virus. Apidologie 2012, 43, 17–30. [Google Scholar] [CrossRef]
- Forsgren, E.; De Miranda, J.R.; Isaksson, M.; Wei, S.; Fries, I. Deformed wing virus associated with Tropilaelaps mercedesae infesting European honey bees (Apis mellifera). Exp. Appl. Acarol. 2009, 47, 87–97. [Google Scholar] [CrossRef] [PubMed]
- Yañez, O.; Tejada, G.; Neumann, P. First detection of viruses in africanized honey bees from Peru. Virol. Sin. 2014, 29, 321–323. [Google Scholar] [CrossRef]
- McMahon, D.P.; Fürst, M.A.; Caspar, J.; Theodorou, P.; Brown, M.J.; Paxton, R.J. A sting in the spit: Widespread cross-infection of multiple RNA viruses across wild and managed bees. J. Anim. Ecol. 2015, 84, 615–624. [Google Scholar] [CrossRef]
- Locke, B.; Forsgren, E.; Fries, I.; de Miranda, J.R. Acaricide treatment affects viral dynamics in Varroa destructor-infested honey bee colonies via both host physiology and mite control. Appl. Environ. Microbiol 2012, 78, 227–235. [Google Scholar] [CrossRef]
- Yue, C.; Genersch, E. RT-PCR analysis of Deformed wing virus in honeybees (Apis mellifera) and mites (Varroa destructor). J. Gen. Virol 2005, 86, 3419–3424. [Google Scholar] [CrossRef]
- Craggs, J.K.; Ball, J.K.; Thomson, B.J.; Irving, W.L.; Grabowska, A.M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J. Virol. Methods 2001, 94, 111–120. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing, R Version 3.5.1 (2018-07-02); R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
- Bates, D.; Mächler, M.; Bolker, B.; Walker, S. Fitting linear mixed-effects models using lme4. arXiv 2014. [Google Scholar] [CrossRef]
- Yañez, O.; Zheng, H.-Q.; Hu, F.-L.; Neumann, P.; Dietemann, V. A scientific note on Israeli acute paralysis virus infection of Eastern honeybee Apis cerana and vespine predator Vespa velutina. Apidologie 2012, 43, 587–589. [Google Scholar] [CrossRef]
- Mazzei, M.; Forzan, M.; Cilia, G.; Sagona, S.; Bortolotti, L.; Felicioli, A. First detection of replicative deformed wing virus (DWV) in Vespa velutina nigrithorax. Bull. Insectol. 2018, 71, 211–216. [Google Scholar]
- Loope, K.J.; Baty, J.W.; Lester, P.J.; Wilson Rankin, E.E. Pathogen shifts in a honeybee predator following the arrival of the Varroa mite. Proc. Roy. Soc. B 2019, 286, 20182499. [Google Scholar] [CrossRef] [PubMed]
- Bailey, L.; Gibbs, J. Acute infection of bees with paralysis virus. J. Insect Pathol. 1964, 6, 395–407. [Google Scholar]
- Chanpanitkitchote, P.; Chen, Y.; Evans, J.D.; Li, W.; Li, J.; Hamilton, M.; Chantawannakul, P. Acute bee paralysis virus occurs in the Asian honey bee Apis cerana and parasitic mite Tropilaelaps mercedesae. J. Invertebr. Pathol. 2018, 151, 131–136. [Google Scholar] [CrossRef] [PubMed]
- Wilson, E.O. The Insect Societies; Harvard University Press: Cambridge, MA, USA, 1971; p. 562. [Google Scholar]
- Stroeymeyt, N.; Casillas-Pérez, B.; Cremer, S. Organisational immunity in social insects. Curr. Opin. Insect. Sci. 2014, 5, 1–15. [Google Scholar] [CrossRef]
- Sorensen, A.A.; Vinson, S.B. Quantitative food distribution studies within Laboratory colonies of the imported fire ant, Solenopsis invicta Buren. Insect Soc. 1981, 28, 129–160. [Google Scholar] [CrossRef]
- Amiri, E.; Kryger, P.; Meixner, M.D.; Strand, M.K.; Tarpy, D.R.; Rueppell, O. Quantitative patterns of vertical transmission of deformed wing virus in honey bees. PLoS ONE 2018, 13, e0195283. [Google Scholar] [CrossRef]
- Hölldobler, B.; Wilson, E.O. The Ants; Springer: Berlin/Heidelberg, Germany, 1990. [Google Scholar] [CrossRef]
- Ugelvig, L.V.; Kronauer, D.J.; Schrempf, A.; Heinze, J.; Cremer, S. Rapid anti-pathogen response in ant societies relies on high genetic diversity. Proc. Roy. Soc. B 2010, 277, 2821–2828. [Google Scholar] [CrossRef]
- Manfredini, F.; Shoemaker, D.; Grozinger, C.M. Dynamic changes in host–virus interactions associated with colony founding and social environment in fire ant queens (Solenopsis invicta). Ecol. Evol. 2016, 6, 233–244. [Google Scholar] [CrossRef] [PubMed]
- Cerdá, X.; Angulo, E.; Boulay, R.; Lenoir, A. Individual and collective foraging decisions: A field study of worker recruitment in the gypsy ant Aphaenogaster senilis. Behavl. Ecol. Sociobiol. 2009, 63, 551–562. [Google Scholar] [CrossRef]
- Cerda, X.; Arnan, X.; Retana, J. Is competition a significant hallmark of ant (Hymenoptera: Formicidae) ecology. Myrmecol. News 2013, 18, 131–147. [Google Scholar]
- Anderson, C.; McShea, D.W. Individual versus social complexity, with particular reference to ant colonies. Biol. Rev. 2001, 76, 211–237. [Google Scholar] [CrossRef]
- Palmer, T.M. Wars of attrition: Colony size determines competitive outcomes in a guild of African acacia ants. Anim. Behav. 2004, 68, 993–1004. [Google Scholar] [CrossRef]
- Dornhaus, A.; Franks, N.R. Colony size affects collective decision-making in the ant Temnothorax albipennis. Insect Soc. 2006, 53, 420–427. [Google Scholar] [CrossRef]
- Luque, G.M.; Giraud, T.; Courchamp, F. Allee effects in ants. J. Anim. Ecol. 2013, 82, 956–965. [Google Scholar] [CrossRef]
- Boomsma, J.; Van der Lee, G.; Van der Have, T. On the production ecology of Lasius niger (Hymenoptera: Formicidae) in successive coastal dune valleys. J. Anim. Ecol. 1982, 975–991. [Google Scholar] [CrossRef]
- Vargo, E.L. Effect of pleometrosis and colony size on the production of sexuals in monogyne colonies of the fire ant Solenopsis invicta. In Advances in Myrmecology; Trager, J.C., Ed.; E.J. Brill: New York, NY, USA, 1988; pp. 217–225. [Google Scholar]
- Sorvari, J.; Hakkarainen, H. Deforestation reduces nest mound size and decreases the production of sexual offspring in the wood ant Formica aquilonia. Ann. Zool. Fenn. 2005, 42, 259–267. [Google Scholar]
- Boulay, R.; Hefetz, A.; Cerdá, X.; Devers, S.; Francke, W.; Twele, R.; Lenoir, A. Production of sexuals in a fission-performing ant: Dual effects of queen pheromones and colony size. Behav. Ecol. Sociobiol. 2007, 61, 1531–1541. [Google Scholar] [CrossRef]



| Assay | Target | Primer | Sequence (5′–3′) | [bp] | Ref | Exp |
|---|---|---|---|---|---|---|
| qPCR | DWV-A | DWV F8668 | TTCATTAAAGCCACCTGGAACATC | 136 | [57] | 2 |
| DWV B8757 | TTTCCTCATTAACTGTGTCGTTGA | |||||
| DWV-B | VDV-1 F1409 | GCCCTGTTCAAGAACATG | 413 | [58] | 1 | |
| DWV B1806 | CTTTTCTAATTCAACTTCACC | |||||
| DWV-B | VDV F2 | TATCTTCATTAAAACCGCCAGGCT | 139 | [59] | 2 | |
| VDV R2a | CTTCCTCATTAACTGAGTTGTTGTC | |||||
| ABPV | ABPV F6548 | TCATACCTGCCGATCAAG | 197 | [60] | 1,2,3 | |
| ABPV B6707 | CTGAATAATACTGTGCGTATC | |||||
| Β-actin | Am-actin2-qF | CGTGCCGATAGTATTCTTG | 271 | [60] | 1 | |
| Am-actin2-qF | CTTCGTCACCAACATAGG | |||||
| RNA 250 | RNA 250-F | TGGTGCCTGGGCGGTAAAG | 227 | [54] | 3 | |
| RNA 250-R | TGCGGGGACTCACTGGCTG | |||||
| Negative sense strand specific PCR | TAG | tag | AGCCTGCGCACCGTGG | - | [61] | 1,2,3 |
| DWV-A | DWV 3Ftag | AGCCTGCGCACCGTGG –GGATGTTATCTCCTGCGTGGAA | 221 | [24] | 2 | |
| DWV 4R1 | TGTCGAAACGGTATGGTAAACT | 221 | ||||
| DWV-B | VDV 3Ftag | AGCCTGCGCACCGTGG–GGATGTTATCTTTTGAGAGGGA | 221 | This study | 1,2 | |
| VDV 4R1 | TGTCGGAATGGAATCGTAAATT | 221 | ||||
| ABPV | ABPV F4868tag | AGCCTGCGCACCGTGG–CAAAACCCGCTATCTTGAGG | 262 | This study | 1,2,3 | |
| ABPV B5114 | CCATGGAAAACCTGGTGAAC | 262 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schläppi, D.; Chejanovsky, N.; Yañez, O.; Neumann, P. Foodborne Transmission and Clinical Symptoms of Honey Bee Viruses in Ants Lasius spp. Viruses 2020, 12, 321. https://doi.org/10.3390/v12030321
Schläppi D, Chejanovsky N, Yañez O, Neumann P. Foodborne Transmission and Clinical Symptoms of Honey Bee Viruses in Ants Lasius spp. Viruses. 2020; 12(3):321. https://doi.org/10.3390/v12030321
Chicago/Turabian StyleSchläppi, Daniel, Nor Chejanovsky, Orlando Yañez, and Peter Neumann. 2020. "Foodborne Transmission and Clinical Symptoms of Honey Bee Viruses in Ants Lasius spp." Viruses 12, no. 3: 321. https://doi.org/10.3390/v12030321
APA StyleSchläppi, D., Chejanovsky, N., Yañez, O., & Neumann, P. (2020). Foodborne Transmission and Clinical Symptoms of Honey Bee Viruses in Ants Lasius spp. Viruses, 12(3), 321. https://doi.org/10.3390/v12030321

