Role of CARD Region of MDA5 Gene in Canine Influenza Virus Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Virus and Cell
2.3. Cloning and Bioinformatics Analysis of the Canine MDA5 Gene
2.4. Construction of Plasmids
2.5. Transfection
2.6. Indirect Immunofluorescence Analysis
2.7. Luciferase Assay
2.8. Real-Time qPCR
2.9. Virus Growth Curve
2.10. Western Blotting
2.11. RNA Interference
2.12. Animal Experiment
2.13. Statistical Analysis
3. Results
3.1. Characteristics of Canine MDA5
3.2. Antiviral Effect of MDA5
3.3. Functional Characteristics of Canine MDA5
3.4. Overexpression of Canine MDA5 and CARD Induces Antiviral Activity and Cytokine Expression
3.5. Canine MDA5 Knockdown Reduces Poly I:C-Stimulated IFN-β, Reduces Inflammatory Factors, and Decreases Antiviral Activity
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Li, S.; Shi, Z.; Jiao, P.; Zhang, G.; Zhong, Z.; Tian, W.; Long, L.P.; Cai, Z. Avian-origin H3N2 canine influenza A viruses in Southern China. Infect. Genet. Evol. 2010, 10, 1286–1288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.; Zhao, Y.; Zeng, X.; Lu, C.; Liu, Y. Genetic and pathobiologic characterization of H3N2 canine influenza viruses isolated in the Jiangsu Province of China in 2009-2010. Vet. Microbiol. 2012, 158, 247–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teng, Q.; Zhang, X.; Xu, D.; Zhou, J.; Dai, X.; Chen, Z.; Li, Z. Characterization of an H3N2 canine influenza virus isolated from Tibetan mastiffs in China. Vet. Microbiol. 2013, 162, 345–352. [Google Scholar] [CrossRef] [Scilit]
- Damiani, A.M.; Kalthoff, D.; Beer, M.; Muller, E.; Osterrieder, N. Serological survey in dogs and cats for influenza A(H1N1)pdm09 in Germany. Zoonoses Public Health 2012, 59, 549–552. [Google Scholar] [CrossRef] [Scilit]
- Su, S.; Chen, J.D.; Jia, K.; Khan, S.U.; He, S.Y.; Fu, X.L.; Hong, M.L.; Sun, L.S.; Qi, W.B.; Gray, G.C.; et al. Evidence for Subclinical Influenza A(H1N1)pdm09 Virus Infection among Dogs in Guangdong Province, China. J. Clin. Microbiol. 2014, 52, 1762–1765. [Google Scholar] [CrossRef] [Scilit]
- Su, S.; Qi, W.B.; Zhou, P.; Xiao, C.C.; Yan, Z.S.; Cui, J.; Jia, K.; Zhang, G.H.; Gray, G.C.; Liao, M.; et al. First Evidence of H10N8 Avian Influenza Virus Infections among Feral Dogs in Live Poultry Markets in Guangdong Province, China. Clin. Infect. Dis. 2014, 59, 748–750. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.P.; Sun, S.S.; Ma, J.J.; Tan, Y.Y.; Du, L.J.; Shen, Y.; Mu, Q.H.; Pu, J.; Lin, D.G.; Liu, J.H. Identification and characterization of avian-origin H3N2 canine influenza viruses in northern China during 2009–2010. Virology 2013, 435, 301–307. [Google Scholar] [CrossRef] [Scilit]
- Fu, C.; Luo, J.; Ye, S.; Yuan, Z.; Li, S. Integrated Lung and Tracheal mRNA-Seq and miRNA-Seq Analysis of Dogs with an Avian-Like H5N1 Canine Influenza Virus Infection. Front. Microbiol. 2018, 9, 303. [Google Scholar] [CrossRef] [Scilit]
- Songserm, T.; Amonsin, A.; Jam-on, R.; Sae-Heng, N.; Pariyothorn, N.; Payungporn, S.; Theamboonlers, A.; Chutinimitkul, S.; Thanawongnuwech, R.; Poovorawan, Y. Fatal avian influenza A H5N1 in a dog. Emerg. Infect. Dis. 2006, 12, 1744–1747. [Google Scholar] [CrossRef] [Scilit]
- Lee, I.H.; Le, T.B.; Kim, H.S.; Seo, S.H. Isolation of a novel H3N2 influenza virus containing a gene of H9N2 avian influenza in a dog in South Korea in 2015. Virus Genes 2016, 52, 142–145. [Google Scholar] [CrossRef] [Scilit]
- Crawford, P.C.; Dubovi, E.J.; Castleman, W.L.; Stephenson, I.; Gibbs, E.P.J.; Chen, L.; Smith, C.; Hill, R.C.; Ferro, P.; Pompey, J.; et al. Transmission of Equine Influenza Virus to Dogs. Science 2005, 310, 482–485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castleman, W.L.; Powe, J.R.; Crawford, P.C.; Gibbs, E.P.; Dubovi, E.J.; Donis, R.O.; Hanshaw, D. Canine H3N8 influenza virus infection in dogs and mice. Vet. Pathol. 2010, 47, 507–517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, X.; Na, W.; Kang, A.; Yeom, M.; Yuk, H.; Moon, H.; Kim, S.-j.; Kim, H.-W.; Kim, J.-K.; Pang, M.; et al. Comparison of the virulence of three H3N2 canine influenza virus isolates from Korea and China in mouse and Guinea pig models. BMC Vet. Res. 2018, 14, 149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, T.; Guo, W.; Huang, W.; Dai, L.; Zhao, L.; Li, H.; Li, X.; Zhang, X.; Wang, Y.; Yan, Y.; et al. Isolation and genetic characterization of H3N8 equine influenza virus from donkeys in China. Vet. Microbiol. 2010, 144, 455–460. [Google Scholar] [CrossRef] [Scilit]
- Tu, J.G.; Zhou, H.B.; Jiang, T.Z.; Li, C.; Zhang, A.D.; Guo, X.B.; Zou, W.; Chen, H.C.; Jin, M.L. Isolation and molecular characterization of equine H3N8 influenza viruses from pigs in China. Arch. Virol. 2009, 154, 887–890. [Google Scholar] [CrossRef] [Scilit]
- Meylan, E.; Tschopp, J.; Karin, M. Intracellular pattern recognition receptors in the host response. Nature 2006, 442, 39–44. [Google Scholar] [CrossRef] [Scilit]
- Yoneyama, M.; Fujita, T. Function of RIG-I-like receptors in antiviral innate immunity. J. Biol. Chem. 2007, 282, 15315–15318. [Google Scholar] [CrossRef] [Scilit]
- Rothenfusser, S.; Goutagny, N.; DiPerna, G.; Gong, M.; Monks, B.G.; Schoenemeyer, A.; Yamamoto, M.; Akira, S.; Fitzgerald, K.A. The RNA helicase Lgp2 inhibits TLR-independent sensing of viral replication by retinoic acid-inducible gene-I. J. Immunol. 2005, 175, 5260–5268. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Lu, C.; Stewart, M.; Xu, H.; Strong, R.K.; Igumenova, T.; Li, P. Structural basis of double-stranded RNA recognition by the RIG-I like receptor MDA5. Arch. Biochem. Biophys. 2009, 488, 23–33. [Google Scholar] [CrossRef] [Scilit]
- Jiang, F.G.; Ramanathan, A.; Miller, M.T.; Tang, G.Q.; Gale, M.; Patel, S.S.; Marcotrigiano, J. Structural basis of RNA recognition and activation by innate immune receptor RIG-I. Nature 2011, 479, 423-U184. [Google Scholar] [CrossRef] [Scilit]
- Brisse, M.; Ly, H. Comparative Structure and Function Analysis of the RIG-I-Like Receptors: RIG-I and MDA5. Front. Immunol. 2019, 10, 1586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kato, H.; Takeuchi, O.; Mikamo-Satoh, E.; Hirai, R.; Kawai, T.; Matsushita, K.; Hiiragi, A.; Dermody, T.S.; Fujita, T.; Akira, S. Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J. Exp. Med. 2008, 205, 1601–1610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, S.; Eisenacher, K.; Kirchhofer, A.; Brzozka, K.; Lammens, A.; Lammens, K.; Fujita, T.; Conzelmann, K.K.; Krug, A.; Hopfner, K.P. The C-terminal regulatory domain is the RNA 5 ‘-triphosphate sensor of RIG-I. Mol. Cell 2008, 29, 169–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loo, Y.M.; Fornek, J.; Crochet, N.; Bajwa, G.; Perwitasari, O.; Martinez-Sobrido, L.; Akira, S.; Gill, M.A.; Garcia-Sastre, A.; Katze, M.G.; et al. Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity. J. Virol. 2008, 82, 335–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pichlmair, A.; Schulz, O.; Tan, C.P.; Naslund, T.I.; Liljestrom, P.; Weber, F.; Reis e Sousa, C. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5’-phosphates. Science 2006, 314, 997–1001. [Google Scholar] [CrossRef] [Scilit]
- Honda, K.; Yanai, H.; Negishi, H.; Asagiri, M.; Sato, M.; Mizutani, T.; Shimada, N.; Ohba, Y.; Takaoka, A.; Yoshida, N.; et al. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 2005, 434, 772–777. [Google Scholar] [CrossRef] [Scilit]
- Kawai, T.; Takahashi, K.; Sato, S.; Coban, C.; Kumar, H.; Kato, H.; Ishii, K.J.; Takeuchi, O.; Akira, S. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat. Immunol. 2005, 6, 981–988. [Google Scholar] [CrossRef] [Scilit]
- Potter, J.A.; Randall, R.E.; Taylor, G.L. Crystal structure of human IPS-1/MAVS/VISA/Cardif caspase activation recruitment domain. BMC Struct. Biol. 2008, 8, 11. [Google Scholar] [CrossRef] [Scilit]
- Sun, Q.; Sun, L.; Liu, H.H.; Chen, X.; Seth, R.B.; Forman, J.; Chen, Z.J. The specific and essential role of MAVS in antiviral innate immune responses. Immunity 2006, 24, 633–642. [Google Scholar] [CrossRef] [Scilit]
- Asgari, S.; Schlapbach, L.J.; Anchisi, S.; Hammer, C.; Bartha, I.; Junier, T.; Mottet-Osman, G.; Posfay-Barbe, K.M.; Longchamp, D.; Stocker, M.; et al. Severe viral respiratory infections in children with IFIH1 loss-of-function mutations. Proc. Natl. Acad. Sci. USA 2017, 114, 8342–8347. [Google Scholar] [CrossRef] [Scilit]
- Lamborn, I.T.; Jing, H.; Zhang, Y.; Drutman, S.B.; Abbott, J.K.; Munir, S.; Bade, S.; Murdock, H.M.; Santos, C.P.; Brock, L.G.; et al. Recurrent rhinovirus infections in a child with inherited MDA5 deficiency. J. Exp. Med. 2017, 214, 1949–1972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zaki, M.; Thoenes, M.; Kawalia, A.; Nurnberg, P.; Kaiser, R.; Heller, R.; Bolz, H.J. Recurrent and Prolonged Infections in a Child with a Homozygous IFIH1 Nonsense Mutation. Front. Genet. 2017, 8, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kato, H.; Takeuchi, O.; Sato, S.; Yoneyama, M.; Yamamoto, M.; Matsui, K.; Uematsu, S.; Jung, A.; Kawai, T.; Ishii, K.J.; et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006, 441, 101–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gitlin, L.; Barchet, W.; Gilfillan, S.; Cella, M.; Beutler, B.; Flavell, R.A.; Diamond, M.S.; Colonna, M. Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proc. Natl. Acad. Sci. USA 2006, 103, 8459–8464. [Google Scholar] [CrossRef] [Scilit]
- Ohtani, M.; Hikima, J.; Kondo, H.; Hirono, I.; Jung, T.S.; Aoki, T. Characterization and antiviral function of a cytosolic sensor gene, MDA5, in Japanese flounder, Paralichthys olivaceus. Dev. Comp. Immunol. 2011, 35, 554–562. [Google Scholar] [CrossRef] [Scilit]
- Lee, C.C.; Wu, C.C.; Lin, T.L. Characterization of chicken melanoma differentiation-associated gene 5 (MDA5) from alternative translation initiation. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 335–343. [Google Scholar] [CrossRef] [Scilit]
- Wei, L.; Cui, J.; Song, Y.; Zhang, S.; Han, F.; Yuan, R.; Gong, L.; Jiao, P.; Liao, M. Duck MDA5 functions in innate immunity against H5N1 highly pathogenic avian influenza virus infections. Vet. Res. 2014, 45, 66. [Google Scholar] [CrossRef] [Scilit]
- Reed, L.J.; Muench, H. A simple method of estimating fifty percent endpoints. Am.J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef] [Scilit]
- Tian, J.; Zhang, X.Z.; Wu, H.X.; Liu, C.G.; Liu, J.S.; Hu, X.L.; Qu, L.D. Assessment of the IFN-beta response to four feline caliciviruses: Infection in CRFK cells. Infect. Genet. Evol. 2015, 34, 352–360. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, W.M. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar]
- Su, S.; Tian, J.; Hong, M.; Zhou, P.; Lu, G.; Zhu, H.; Zhang, G.; Lai, A.; Li, S. Global and quantitative proteomic analysis of dogs infected by avian-like H3N2 canine influenza virus. Front. Microbiol. 2015, 6, 228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Filzmayer, C.; Ni, Y.; Sultmann, H.; Mutz, P.; Hiet, M.S.; Vondran, F.W.R.; Bartenschlager, R.; Urban, S. Hepatitis D virus replication is sensed by MDA5 and induces IFN-beta/lambda responses in hepatocytes. J. Hepatol. 2018, 69, 25–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carpenter, S.; Ricci, E.P.; Mercier, B.C.; Moore, M.J.; Fitzgerald, K.A. Post-transcriptional regulation of gene expression in innate immunity. Nat. Rev. Immunol. 2014, 14, 361–376. [Google Scholar] [CrossRef] [Scilit]
- Gurtler, C.; Bowie, A.G. Innate immune detection of microbial nucleic acids. Trends Microbiol. 2013, 21, 413–420. [Google Scholar] [CrossRef] [Scilit]
- Hiscott, J. Convergence of the NF-kappaB and IRF pathways in the regulation of the innate antiviral response. Cytokine Growth Factor Rev. 2007, 18, 483–490. [Google Scholar] [CrossRef] [Scilit]
- Yoneyama, M.; Kikuchi, M.; Matsumoto, K.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Foy, E.; Loo, Y.M.; Gale, M.; Akira, S.; et al. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J. Immunol. 2005, 175, 2851–2858. [Google Scholar] [CrossRef] [Scilit]
- Besch, R.; Poeck, H.; Hohenauer, T.; Senft, D.; Hacker, G.; Berking, C.; Hornung, V.; Endres, S.; Ruzicka, T.; Rothenfusser, S.; et al. Proapoptotic signaling induced by RIG-I and MDA-5 results in type I interferon-independent apoptosis in human melanoma cells. J. Clin. Invest. 2009, 119, 2399–2411. [Google Scholar] [CrossRef] [Scilit]
- Meylan, E.; Curran, J.; Hofmann, K.; Moradpour, D.; Binder, M.; Bartenschlager, R.; Tschopp, J. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 2005, 437, 1167–1172. [Google Scholar] [CrossRef] [Scilit]
- Gack, M.U.; Shin, Y.C.; Joo, C.H.; Urano, T.; Liang, C.; Sun, L.; Takeuchi, O.; Akira, S.; Chen, Z.; Inoue, S.; et al. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 2007, 446, 916–920. [Google Scholar] [CrossRef] [Scilit]
- Peisley, A.; Wu, B.; Xu, H.; Chen, Z.J.; Hur, S. Structural basis for ubiquitin-mediated antiviral signal activation by RIG-I. Nature 2014, 509, 110–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, W.; Sun, L.; Jiang, X.; Chen, X.; Hou, F.; Adhikari, A.; Xu, M.; Chen, Z.J. Reconstitution of the RIG-I pathway reveals a signaling role of unanchored polyubiquitin chains in innate immunity. Cell 2010, 141, 315–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.G.; Wang, Y.Y.; Han, K.J.; Li, L.Y.; Zhai, Z.; Shu, H.B. VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 2005, 19, 727–740. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berghall, H.; Siren, J.; Sarkar, D.; Julkunen, I.; Fisher, P.B.; Vainionpaa, R.; Matikainen, S. The interferon-inducible RNA helicase, mda-5, is involved in measles virus-induced expression of antiviral cytokines. Microbes Infect. 2006, 8, 2138–2144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andrejeva, J.; Childs, K.S.; Young, D.F.; Carlos, T.S.; Stock, N.; Goodbourn, S.; Randall, R.E. The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter. Proc. Natl. Acad. Sci. USA 2004, 101, 17264–17269. [Google Scholar] [CrossRef] [Scilit]
- Kang, D.C.; Gopalkrishnan, R.V.; Lin, L.; Randolph, A.; Valerie, K.; Pestka, S.; Fisher, P.B. Expression analysis and genomic characterization of human melanoma differentiation associated gene-5, mda-5: a novel type I interferon-responsive apoptosis-inducing gene. Oncogene 2004, 23, 1789–1800. [Google Scholar] [CrossRef] [Scilit]
- Janeway, C.A., Jr.; Medzhitov, R. Innate immune recognition. Annu. Rev. Immunol. 2002, 20, 197–216. [Google Scholar] [CrossRef] [Scilit]





| Primer Name | Sequence of Oligonucleotides 5′~3′ |
|---|---|
| MDA5△NRD-F | GAATTCAATGATGTGGAGCGGCCGC |
| MDA5△NRD-R | GGATCCTCAGTTTTCCTTGTAACACTTTGCAGC |
| MDA5△CARD-F | GAATTCAATGACTTGCTTTGAAAGCAAAGAAG |
| MDA5△CARD-R | GGATCCTCATCAATCCTCATCACTAAACAAAC |
| MDA5△NRD+CARD-F | GAATTCAATGACTTGCTTTGAAAGCAAAGAAG |
| MDA5△NRD+CARD-R | GGATCCTCAGTTTTCCTTGTAACACTTTGC |
| MDA5-CARD-F | GAATTCAATGATGTGGAGCGGCCGC |
| MDA5-CARD-R | GGATCCTCATGTGCCTGTTAGCTCTTGGAC |
| MDA5-F | GAATTCAATGATGTGGAGCGGCCGC |
| MDA5-R | GGATCCTCATCAATCCTCATCACTAAACAAAC |
| Primer Name | Forward Primer (5′~3′) | Reverse Primer (5′~3′) |
|---|---|---|
| IL-1B | TCAAGAACACAGTGGAATTTGAGTCTT | TCAGTTATATCCTGGCCACCTCTG |
| IL-6 | TTCATTCCTTAGGATAGTGCTGAG | TCCTGAGGAGTGAAGATAACAATTT |
| IL-8 | AAACACACTCCACACCTTTCCAT | GGCACACCTCATTTCCATTGAA |
| IL-2 | AGTAACCTCAACTCCTGCCACAAT | TTGCTCCATCTGTTGCTCTGTTTC |
| RIG-I | CTCCAAGAAGAAGGCTGGTTC | AAGCAATCTATACTCCTCTAGACTTTC |
| LGP2 | TCACTCCCTCCTACTCTGGCTC | TTTCGGATCACTTCTTGCTGGTCT |
| MX1 | ATCACTGACTCGAATCCTGTACCC | GCCTACCTTCTCCTCATATTGGCT |
| OAS | CCAGGGTAACTCAGGAAGGAAAGT | CATCTCCATCAAACACGGGCTG |
| STA1 | TTGACAGCAAAGTGAGAAACGTGA | ATTGGCTTCATGTTCTCGGTTCTG |
| IFN-β | GAAATCACGCCAGTTCCAGAAG | TCTCATTCCATCCTGTTCTAGAGATATT |
| TRIM25 | TGAAACACTATATCAGGCAGTCCC | AAATGTATGGGTTTGTGCGTGGAT |
| TNF | CCCTGGTACGAGCCCATCTAC | AATGATTCCAAAGTACACCTGCCC |
| IPS1 | GACCACAAGATGTCCGCAAGC | GGCAAGCTGTCTCTGGTGGA |
| Name | Sequence of Oligonucleotides (5′~3′) |
|---|---|
| siMDA5-1 | GACTGAGAATTTATCACAA |
| siMDA5-2 | GTAGTTTCAGAATCAGACA |
| siMDA5-3 | GTCATCACACCAACAAAGA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fu, C.; Ye, S.; Liu, Y.; Li, S. Role of CARD Region of MDA5 Gene in Canine Influenza Virus Infection. Viruses 2020, 12, 307. https://doi.org/10.3390/v12030307
Fu C, Ye S, Liu Y, Li S. Role of CARD Region of MDA5 Gene in Canine Influenza Virus Infection. Viruses. 2020; 12(3):307. https://doi.org/10.3390/v12030307
Chicago/Turabian StyleFu, Cheng, Shaotang Ye, Yongbo Liu, and Shoujun Li. 2020. "Role of CARD Region of MDA5 Gene in Canine Influenza Virus Infection" Viruses 12, no. 3: 307. https://doi.org/10.3390/v12030307
APA StyleFu, C., Ye, S., Liu, Y., & Li, S. (2020). Role of CARD Region of MDA5 Gene in Canine Influenza Virus Infection. Viruses, 12(3), 307. https://doi.org/10.3390/v12030307

