Novel Lentivirus-Based Method for Rapid Selection of Inhibitory Nanobody against PRRSV
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Viruses
2.2. Isolation of Nanobody Sequence
2.3. Lentivectors Production and Concentration
2.4. Construction and Selection of Stable Cell Line
2.5. Selection of PRRSV-Resistant Marc-145–Nbs
2.6. Western Blot of Marc-145–Nbs
2.7. Nb sequence Analysis
2.8. Production of Soluble Nbs
2.9. Internalization Assays
2.10. Nb9 Antiviral Assays
2.11. Detection of Interaction Targets of Nb9
2.12. Statistical Analysis
3. Results
3.1. Construction of a Lentivirus-Delivered Nanobody Library from Two Non-Immunized Camels
3.2. Generation of a Stable Cell Pool (Marc-145–Nbs) for Nb Expression
3.3. Selection of PRRSV-Resistant Nbs by Marc-145–Nbs Based Antiviral Assays
3.4. Characteristic Analysis of Soluble Nbs in Marc-145 Cells
3.5. Antiviral Activity of Nbs Against PRRSV Infection
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Normile, D. Virology. China, Vietnam grapple with ‘rapidly evolving’ pig virus. Science 2007, 317, 1017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavanagh, D. Nidovirales: A new order comprising Coronaviridae and Arteriviridae. Arch. Virol. 1997, 142, 629–633. [Google Scholar] [PubMed]
- Murtaugh, M.P.; Genzow, M. Immunological solutions for treatment and prevention of porcine reproductive and respiratory syndrome (PRRS). Vaccine 2011, 29, 8192–8204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Renukaradhya, G.J.; Meng, X.J.; Calvert, J.G.; Roof, M.; Lager, K.M. Live porcine reproductive and respiratory syndrome virus vaccines: Current status and future direction. Vaccine 2015, 33, 4069–4080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bao, D.; Wang, R.; Qiao, S.; Wan, B.; Wang, Y.; Liu, M.; Shi, X.; Guo, J.; Zhang, G. Antibody-dependent enhancement of PRRSV infection down-modulates TNF-alpha and IFN-beta transcription in macrophages. Vet. Immunol. Immunopathol. 2013, 156, 128–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cancel-Tirado, S.M.; Evans, R.B.; Yoon, K.J. Monoclonal antibody analysis of porcine reproductive and respiratory syndrome virus epitopes associated with antibody-dependent enhancement and neutralization of virus infection. Vet. Immunol. Immunopathol. 2004, 102, 249–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ke, H.; Yoo, D. The viral innate immune antagonism and an alternative vaccine design for PRRS virus. Vet. Microbiol. 2017, 209, 75–89. [Google Scholar] [CrossRef] [Scilit]
- Sang, Y.; Rowland, R.R.; Blecha, F. Interaction between innate immunity and porcine reproductive and respiratory syndrome virus. Anim. Health Res. Rev. 2011, 12, 149–167. [Google Scholar] [CrossRef] [Scilit]
- Allende, R.; Laegreid, W.W.; Kutish, G.F.; Galeota, J.A.; Wills, R.W.; Osorio, F.A. Porcine reproductive and respiratory syndrome virus: Description of persistence in individual pigs upon experimental infection. J. Virol. 2000, 74, 10834–10837. [Google Scholar] [CrossRef] [Scilit]
- Wills, R.W.; Zimmerman, J.J.; Yoon, K.J.; Swenson, S.L.; McGinley, M.J.; Hill, H.T.; Platt, K.B.; Christopher-Hennings, J.; Nelson, E.A. Porcine reproductive and respiratory syndrome virus: A persistent infection. Vet. Microbiol. 1997, 55, 231–240. [Google Scholar] [CrossRef] [Scilit]
- Wills, R.W.; Doster, A.R.; Galeota, J.A.; Sur, J.H.; Osorio, F.A. Duration of infection and proportion of pigs persistently infected with porcine reproductive and respiratory syndrome virus. J. Clin. Microbiol. 2003, 41, 58–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, T.; Nan, Y.; Xiao, S.; Zhao, Q.; Zhou, E.M. Antiviral Strategies against PRRSV Infection. Trends Microbiol. 2017, 25, 968–979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stijlemans, B.; Conrath, K.; Cortez-Retamozo, V.; Van Xong, H.; Wyns, L.; Senter, P.; Revets, H.; De Baetselier, P.; Muyldermans, S.; Magez, S. Efficient targeting of conserved cryptic epitopes of infectious agents by single domain antibodies. African trypanosomes as paradigm. J. Biol. Chem. 2004, 279, 1256–1261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanlandschoot, P.; Stortelers, C.; Beirnaert, E.; Ibanez, L.I.; Schepens, B.; Depla, E.; Saelens, X. Nanobodies(R): New ammunition to battle viruses. Antivir. Res. 2011, 92, 389–407. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Liang, C.; Duan, H.; Zhang, X.; Wang, X.; Xiao, S.; Zhou, E.M. Intracellularly expressed nanobodies against non-structural protein 4 of porcine reproductive and respiratory syndrome virus inhibit virus replication. Biotechnol. Lett. 2016, 38, 1081–1088. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Wang, Y.; Duan, H.; Zhang, A.; Liang, C.; Gao, J.; Zhang, C.; Huang, B.; Li, Q.; Li, N.; et al. An intracellularly expressed Nsp9-specific nanobody in MARC-145 cells inhibits porcine reproductive and respiratory syndrome virus replication. Vet. Microbiol. 2015, 181, 252–260. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Zhang, L.; Huang, B.; Li, K.; Hou, G.; Zhao, Q.; Wu, C.; Nan, Y.; Du, T.; Mu, Y.; et al. A Nanobody Targeting Viral Nonstructural Protein 9 Inhibits Porcine Reproductive and Respiratory Syndrome Virus Replication. J. Virol. 2019, 93, e01888-1918. [Google Scholar] [CrossRef] [Scilit]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [Scilit]
- Zhang, N.; Guo, H.; Zheng, W.; Wang, T.; Ma, X. Design and screening of a chimeric survivin-specific nanobody and its anticancer activities in vitro. Anticancer Drugs 2016, 27, 839–847. [Google Scholar] [CrossRef] [Scilit]
- Zhao, A.; Tohidkia, M.R.; Siegel, D.L.; Coukos, G.; Omidi, Y. Phage antibody display libraries: A powerful antibody discovery platform for immunotherapy. Crit. Rev. Biotechnol. 2016, 36, 276–289. [Google Scholar] [CrossRef] [Scilit]
- Kay, M.A. State-of-the-art gene-based therapies: The road ahead. Nat. Rev. Genet. 2011, 12, 316–328. [Google Scholar] [CrossRef] [Scilit]
- Vannucci, L.; Lai, M.; Chiuppesi, F.; Ceccherini-Nelli, L.; Pistello, M. Viral vectors: A look back and ahead on gene transfer technology. New Microbiol. 2013, 36, 1–22. [Google Scholar] [PubMed]
- Fu, X.; Gao, X.; He, S.; Huang, D.; Zhang, P.; Wang, X.; Zhang, S.; Dang, R.; Yin, S.; Du, E.; et al. Design and selection of a camelid single-chain antibody yeast two-hybrid library produced de novo for the cap protein of porcine circovirus type 2 (PCV2). PLoS ONE 2013, 8, e56222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, W.; Hua, R.; Wei, M.; Li, C.; Qiu, Z.; Yang, X.; Zhang, C. An optimized method for high-titer lentivirus preparations without ultracentrifugation. Sci. Rep. 2015, 5, 13875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Ren, J.; Shi, P.; Lu, D.; Zhao, C.; Su, Y.; Zhang, L.; Huang, J. The Immunological Regulation Roles of Porcine beta-1, 4 Galactosyltransferase V (B4GALT5) in PRRSV Infection. Front. Cell Infect. Microbiol. 2018, 8, 48. [Google Scholar] [CrossRef] [Scilit]
- Steeland, S.; Vandenbroucke, R.E.; Libert, C. Nanobodies as therapeutics: Big opportunities for small antibodies. Drug Discov. Today 2016, 21, 1076–1113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ingram, J.R.; Schmidt, F.I.; Ploegh, H.L. Exploiting Nanobodies’ Singular Traits. Annu. Rev. Immunol. 2018, 36, 695–715. [Google Scholar] [CrossRef] [Scilit]
- Yu, W.; Zhan, Y.; Xue, B.; Dong, Y.; Wang, Y.; Jiang, P.; Wang, A.; Sun, Y.; Yang, Y. Highly efficient cellular uptake of a cell-penetrating peptide (CPP) derived from the capsid protein of porcine circovirus type 2. J. Biol. Chem. 2018, 293, 15221–15232. [Google Scholar] [CrossRef] [Scilit]
- Nan, Y.; Wu, C.; Gu, G.; Sun, W.; Zhang, Y.; Zhou, E. Improved Vaccine against PRRSV: Current Progress and Future Perspective. Front. Microbiol. 2017, 8, 1635. [Google Scholar] [CrossRef] [Scilit]
- Vu, H.; Pattnaik, A.K.; Osorio, F.A. Strategies to broaden the cross-protective efficacy of vaccines against porcine reproductive and respiratory syndrome virus. Vet. Microbiol. 2017, 206, 29–34. [Google Scholar] [CrossRef] [Scilit]
- Strokappe, N.; Szynol, A.; Aasa-Chapman, M.; Gorlani, A.; Forsman, Q.A.; Hulsik, D.L.; Chen, L.; Weiss, R.; de Haard, H.; Verrips, T. Llama antibody fragments recognizing various epitopes of the CD4bs neutralize a broad range of HIV-1 subtypes A., B and C. PLoS ONE 2012, 7, e33298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garaicoechea, L.; Olichon, A.; Marcoppido, G.; Wigdorovitz, A.; Mozgovoj, M.; Saif, L.; Surrey, T.; Parreno, V. Llama-derived single-chain antibody fragments directed to rotavirus VP6 protein possess broad neutralizing activity in vitro and confer protection against diarrhea in mice. J. Virol. 2008, 82, 9753–9764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chartier, A.; Raz, V.; Sterrenburg, E.; Verrips, C.T.; van der Maarel, S.M.; Simonelig, M. Prevention of oculopharyngeal muscular dystrophy by muscular expression of Llama single-chain intrabodies in vivo. Hum. Mol. Genet. 2009, 18, 1849–1859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maass, D.R.; Sepulveda, J.; Pernthaner, A.; Shoemaker, C.B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). J. Immunol. Methods 2007, 324, 13–25. [Google Scholar] [CrossRef] [Scilit]
- Pardon, E.; Laeremans, T.; Triest, S.; Rasmussen, S.G.; Wohlkonig, A.; Ruf, A.; Muyldermans, S.; Hol, W.G.; Kobilka, B.K.; Steyaert, J. A general protocol for the generation of Nanobodies for structural biology. Nat. Protoc. 2014, 9, 674–693. [Google Scholar] [CrossRef] [Scilit]
- Ingram, J.R.; Knockenhauer, K.E.; Markus, B.M.; Mandelbaum, J.; Ramek, A.; Shan, Y.; Shaw, D.E.; Schwartz, T.U.; Ploegh, H.L.; Lourido, S. Allosteric activation of apicomplexan calcium-dependent protein kinases. Proc. Natl. Acad. Sci. USA 2015, 112, E4975–E4984. [Google Scholar] [CrossRef] [Scilit]
- Truttmann, M.C.; Wu, Q.; Stiegeler, S.; Duarte, J.N.; Ingram, J.; Ploegh, H.L. HypE-specific nanobodies as tools to modulate HypE-mediated target AMPylation. J. Biol. Chem. 2015, 290, 9087–9100. [Google Scholar] [CrossRef] [Scilit]
- Boons, E.; Li, G.; Vanstreels, E.; Vercruysse, T.; Pannecouque, C.; Vandamme, A.M.; Daelemans, D. A stably expressed llama single-domain intrabody targeting Rev displays broad-spectrum anti-HIV activity. Antivir. Res. 2014, 112, 91–102. [Google Scholar] [CrossRef] [Scilit]
- Ashour, J.; Schmidt, F.I.; Hanke, L.; Cragnolini, J.; Cavallari, M.; Altenburg, A.; Brewer, R.; Ingram, J.; Shoemaker, C.; Ploegh, H.L. Intracellular expression of camelid single-domain antibodies specific for influenza virus nucleoprotein uncovers distinct features of its nuclear localization. J. Virol. 2015, 89, 2792–2800. [Google Scholar] [CrossRef] [Scilit]
- Ostrowski, M.; Galeota, J.A.; Jar, A.M.; Platt, K.B.; Osorio, F.A.; Lopez, O.J. Identification of neutralizing and nonneutralizing epitopes in the porcine reproductive and respiratory syndrome virus GP5 ectodomain. J. Virol. 2002, 76, 4241–4250. [Google Scholar] [CrossRef] [Scilit]
- Menendez-Arias, L.; Gago, F. Antiviral agents: Structural basis of action and rational design. Subcell. Biochem. 2013, 68, 599–630. [Google Scholar] [PubMed]
- Goldman, E.R.; Anderson, G.P.; Liu, J.L.; Delehanty, J.B.; Sherwood, L.J.; Osborn, L.E.; Cummins, L.B.; Hayhurst, A. Facile generation of heat-stable antiviral and antitoxin single domain antibodies from a semisynthetic llama library. Anal. Chem. 2006, 78, 8245–8255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silacci, M.; Brack, S.; Schirru, G.; Marlind, J.; Ettorre, A.; Merlo, A.; Viti, F.; Neri, D. Design, construction, and characterization of a large synthetic human antibody phage display library. Proteomics 2005, 5, 2340–2350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, A.T.; Sayers, E.J. Cell entry of cell penetrating peptides: Tales of tails wagging dogs. J. Control. Release 2012, 161, 582–591. [Google Scholar] [CrossRef] [Scilit]
- Jittavisutthikul, S.; Thanongsaksrikul, J.; Thueng-In, K.; Chulanetra, M.; Srimanote, P.; Seesuay, W.; Malik, A.A.; Chaicumpa, W. Humanized-VHH transbodies that inhibit HCV protease and replication. Viruses 2015, 7, 2030–2056. [Google Scholar] [CrossRef] [Scilit]
- Popescu, L.N.; Trible, B.R.; Chen, N.; Rowland, R. GP5 of porcine reproductive and respiratory syndrome virus (PRRSV) as a target for homologous and broadly neutralizing antibodies. Vet. Microbiol. 2017, 209, 90–96. [Google Scholar] [CrossRef] [Scilit]
- Stoian, A.; Rowland, R. Challenges for Porcine Reproductive and Respiratory Syndrome (PRRS) Vaccine Design: Reviewing Virus Glycoprotein Interactions with CD163 and Targets of Virus Neutralization. Vet. Sci. 2019, 6, 9. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Huang, B.; Kong, N.; Li, Q.; Ma, Y.; Li, Z.; Gao, J.; Zhang, C.; Wang, X.; Liang, C.; et al. A novel porcine reproductive and respiratory syndrome virus vector system that stably expresses enhanced green fluorescent protein as a separate transcription unit. Vet. Res. 2013, 44, 104. [Google Scholar] [CrossRef] [Scilit]
- Huang, B.; Xiao, X.; Xue, B.; Zhou, E.M. Clover-tagged porcine reproductive and respiratory syndrome virus infectious clones for rapid detection of virus neutralizing antibodies. J. Virol. Methods 2018, 259, 100–105. [Google Scholar] [CrossRef] [Scilit]







| Primer | Oligonucleotides (from 5′ to 3′) |
|---|---|
| CALL01 | GTCCTGGCTGCTCTTCTACAAGG |
| CALL02 | GGTACGTGCTGTTGAACTGTTCC |
| XbaI-Nb-F | GCTCTAGAATGCACCACCACCACCACCACCAGGTGCAGCTGGTGGAGTCTGGRGGAGG (R = A/G) |
| NotI-Nb-R | AAGGAAAAAAGCGGCCGCTTAATGGAGACGGTG ACCWGGGT (W = A/T) |
| CD513B-F | ATAGCGGTTTGACTCACGGGGATTT |
| CD513B-R | GACATCACTTTCCCAGTTTACCCCG |
| N-F | AGATCATCATCGCCCAACAAAAC |
| N-R | GACACAATTGCCGCTCACTA |
| β-actin-F | TCCCTGGAGAAGAGCTACGA |
| β-actin-R | AGCACTGTGTTGGCGTACAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Z.-H.; Lei, K.-X.; Han, G.-W.; Xu, H.-L.; He, F. Novel Lentivirus-Based Method for Rapid Selection of Inhibitory Nanobody against PRRSV. Viruses 2020, 12, 229. https://doi.org/10.3390/v12020229
Liu Z-H, Lei K-X, Han G-W, Xu H-L, He F. Novel Lentivirus-Based Method for Rapid Selection of Inhibitory Nanobody against PRRSV. Viruses. 2020; 12(2):229. https://doi.org/10.3390/v12020229
Chicago/Turabian StyleLiu, Ze-Hui, Kai-Xia Lei, Guang-Wei Han, Hui-Ling Xu, and Fang He. 2020. "Novel Lentivirus-Based Method for Rapid Selection of Inhibitory Nanobody against PRRSV" Viruses 12, no. 2: 229. https://doi.org/10.3390/v12020229
APA StyleLiu, Z.-H., Lei, K.-X., Han, G.-W., Xu, H.-L., & He, F. (2020). Novel Lentivirus-Based Method for Rapid Selection of Inhibitory Nanobody against PRRSV. Viruses, 12(2), 229. https://doi.org/10.3390/v12020229
