Gene Expression Profiling of Different Huh7 Variants Reveals Novel Hepatitis C Virus Host Factors
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Cell Lines
2.2. Gene Expression Profiling and Statistical Analysis
2.3. Chemicals and Antibodies
2.4. Virus Stock Preparation and Titration of JcR2a and Jc1
2.5. Dengue and Rift Valley Fever Virus Infection
2.6. Reverse Transfection and Infection of Huh7 Cells
2.7. Reverse Transfection of Huh7-LucUbiNeo Cells
2.8. CellTiter-Glo® Cell Viability Assay
2.9. In Vitro-Transcription and Electroporation of RNA into Huh7 Cells
2.10. Luciferase Assay
2.11. RNA Isolation, Reverse Transcription and qRT-PCR
2.12. Immunoblotting
2.13. Immunofluorescence (IF), Filipin Staining and Bright Field Microscopy
2.14. Live Cell Imaging Using the IncuCyte System
2.15. Generation of Stable Overexpressing Cell Lines
2.16. Cloning of cDNAs of Putative HCV Host Factors
2.16.1. THAP7, CRYM, and NR0B2
2.16.2. LBHD1 (C11orf48)
2.16.3. CRAMP1
3. Results
3.1. Gene Expression Profiling Suggests Putative Novel HCV Host Factors
3.2. Overexpression of Host Factors in Lowly Permissive Cells Increases HCV Replication
3.3. CRYM, LBHD1, and THAP7 Increase HCV Replication in Lowly Permissive Huh7 Cells
3.4. NR0B2 Expression Levels Sensitively Modulate HCV Replication Efficiency
3.5. The FXR-NR0B2 Axis Regulates HCV Replication through Bile Acid and Cholesterol Homeostasis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- De Martel, C.; Maucort-Boulch, D.; Plummer, M.; Franceschi, S. World-wide relative contribution of hepatitis B and C viruses in hepatocellular carcinoma. Hepatology 2015, 62, 1190–1200. [Google Scholar] [CrossRef] [PubMed]
- El-Serag, H.B. Epidemiology of viral hepatitis and hepatocellular carcinoma. Gastroenterology 2012, 142, 1264–1273. [Google Scholar] [CrossRef] [PubMed]
- Smith, S.; Harmanci, H.; Hutin, Y.; Hess, S.; Bulterys, M.; Peck, R.; Rewari, B.; Mozalevskis, A.; Shibeshi, M.; Mumba, M.; et al. Global progress on the elimination of viral hepatitis as a major public health threat: An analysis of WHO Member State responses 2017. JHEP Rep. 2019, 1, 81–89. [Google Scholar] [CrossRef]
- Pawlotsky, J.-M.; Feld, J.J.; Zeuzem, S.; Hoofnagle, J.H. From non-A, non-B hepatitis to hepatitis C virus cure. J. Hepatol. 2015, 62 (Suppl. S1), S87–S99. [Google Scholar] [CrossRef] [PubMed]
- Perez, S.; Kaspi, A.; Domovitz, T.; Davidovich, A.; Lavi-Itzkovitz, A.; Meirson, T.; Alison Holmes, J.; Dai, C.-Y.; Huang, C.-F.; Chung, R.T.; et al. Hepatitis C virus leaves an epigenetic signature post cure of infection by direct-acting antivirals. PLoS Genet. 2019, 15, e10081. [Google Scholar] [CrossRef] [PubMed]
- D’Ambrosio, R.; Della Corte, C.; Colombo, M. Hepatocellular Carcinoma in Patients with a Sustained Response to Anti-Hepatitis C Therapy. Int. J. Mol. Sci. 2015, 16, 19698–19712. [Google Scholar] [CrossRef] [PubMed]
- Ono, A.; Goossens, N.; Finn, R.S.; Schmidt, W.N.; Thung, S.N.; Im, G.Y.; Hoshida, Y. Persisting risk of hepatocellular carcinoma after hepatitis C virus cure monitored by a liver transcriptome signature. Hepatology 2017, 66, 1344–1346. [Google Scholar] [CrossRef]
- Romano, A.; Angeli, P.; Piovesan, S.; Noventa, F.; Anastassopoulos, G.; Chemello, L.; Cavalletto, L.; Gambato, M.; Russo, F.P.; Burra, P.; et al. Newly diagnosed hepatocellular carcinoma in patients with advanced hepatitis C treated with DAAs: A prospective population study. J. Hepatol. 2018, 69, 345–352. [Google Scholar] [CrossRef]
- Bartenschlager, R.; Urban, S.; Protzer, U. Towards curative therapy of chronic viral hepatitis. Z. Gastroenterol. 2019, 57, 61–73. [Google Scholar] [CrossRef]
- Borgia, S.M.; Hedskog, C.; Parhy, B.; Hyland, R.H.; Stamm, L.M.; Brainard, D.M.; Subramanian, M.G.; McHutchison, J.G.; Mo, H.; Svarovskaia, E.; et al. Identification of a Novel Hepatitis C Virus Genotype From Punjab, India: Expanding Classification of Hepatitis C Virus Into 8 Genotypes. J. Infect. Dis. 2018, 218, 1722–1729. [Google Scholar] [CrossRef]
- Hedskog, C.; Parhy, B.; Chang, S.; Zeuzem, S.; Moreno, C.; Shafran, S.D.; Borgia, S.M.; Asselah, T.; Alric, L.; Abergel, A.; et al. Identification of 19 Novel Hepatitis C Virus Subtypes-Further Expanding HCV Classification. Open Forum Infect. Dis. 2019, 6, ofz076. [Google Scholar] [CrossRef] [PubMed]
- Bartenschlager, R.; Lohmann, V.; Penin, F. The molecular and structural basis of advanced antiviral therapy for hepatitis C virus infection. Nat. Rev. Microbiol. 2013, 11, 482. [Google Scholar] [CrossRef] [PubMed]
- Moradpour, D.; Penin, F.; Rice, C.M. Replication of hepatitis C virus. Nat. Rev. Microbiol. 2007, 5, 453. [Google Scholar] [CrossRef] [PubMed]
- Neufeldt, C.J.; Cortese, M.; Acosta, E.G.; Bartenschlager, R. Rewiring cellular networks by members of the Flaviviridae family. Nat. Rev. Microbiol. 2018, 16, 125–142. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Cortese, M.; Haselmann, U.; Tabata, K.; Romero-Brey, I.; Funaya, C.; Schieber, N.L.; Qiang, Y.; Bartenschlager, M.; Kallis, S.; et al. Spatiotemporal Coupling of the Hepatitis C Virus Replication Cycle by Creating a Lipid Droplet- Proximal Membranous Replication Compartment. Cell Rep. 2019, 27, 3602–3617. [Google Scholar] [CrossRef] [PubMed]
- Chan, S.T.; Ou, J.J. Hepatitis C Virus-Induced Autophagy and Host Innate Immune Response. Viruses 2017, 9, 224. [Google Scholar] [CrossRef]
- Chen, J.; Zhou, Y.; Zhuang, Y.; Qin, T.; Guo, M.; Jiang, J.; Niu, J.; Li, J.Z.; Chen, X.; Wang, Q. The metabolic regulator small heterodimer partner contributes to the glucose and lipid homeostasis abnormalities induced by hepatitis C virus infection. Metabolism 2019, 100, 153954. [Google Scholar] [CrossRef]
- Levy, G.; Habib, N.; Guzzardi, M.A.; Kitsberg, D.; Bomze, D.; Ezra, E. Nuclear receptors control pro-viral and antiviral metabolic responses to hepatitis C virus infection. Nat. Chem. Biol. 2016, 12, 1037–1045. [Google Scholar] [CrossRef]
- Shoji, I.; Deng, L.; Hotta, H. Molecular mechanism of hepatitis C virus-induced glucose metabolic disorders. Front. Microbiol. 2012, 2, 278. [Google Scholar] [CrossRef]
- Gerresheim, G.K.; Bathke, J.; Michel, A.M. Cellular Gene Expression during Hepatitis C Virus Replication as Revealed by Ribosome Profiling. Int. J. Mol. Sci. 2019, 20, 1321. [Google Scholar] [CrossRef]
- Stoeck, I.K.; Lee, J.-Y.; Tabata, K.; Romero-Brey, I.; Paul, D.; Schult, P.; Lohmann, V.; Kaderali, L.; Bartenschlager, R. Hepatitis C Virus Replication Depends on Endosomal Cholesterol Homeostasis. J. Virol. 2018, 92, e01196-17. [Google Scholar] [CrossRef] [PubMed]
- Adinolfi, L.E.; Zampino, R.; Restivo, L.; Lonardo, A.; Guerrera, B.; Marrone, A.; Nascimbeni, F.; Florio, A.; Loria, P. Chronic hepatitis C virus infection and atherosclerosis: Clinical impact and mechanisms. World J. Gastroenterol. 2014, 20, 3410–3417. [Google Scholar] [CrossRef] [PubMed]
- Woodhouse, S.D.; Narayan, R.; Latham, S.; Lee, S.; Antrobus, R.; Gangadharan, B.; Luo, S.; Schroth, G.P.; Klenerman, P.; Zitzmann, N. Transcriptome sequencing, microarray and proteomic analyses reveal cellular and metabolic impact of hepatitis C virus infection in vitro. Hepatology 2010, 52, 443–453. [Google Scholar] [CrossRef] [PubMed]
- Raglow, Z.; Thoma-Perry, C.; Gilroy, R.; Wan, Y.J. The interaction between HCV and nuclear receptor-mediated pathways. Pharmacol. Ther. 2011, 132, 30–38. [Google Scholar] [CrossRef]
- Lohmann, V.; Bartenschlager, R. On the History of Hepatitis C Virus Cell Culture Systems. J. Med. Chem. 2014, 57, 1627–1642. [Google Scholar] [CrossRef]
- Nakabayashi, H.; Taketa, K.; Miyano, K.; Yamane, T.; Sato, J. Growth of human hepatoma cells lines with differentiated functions in chemically defined medium. Cancer Res. 1982, 42, 3858–3863. [Google Scholar]
- Lohmann, V.; Hoffmann, S.; Herian, U.; Penin, F.; Bartenschlager, R. Viral and cellular determinants of hepatitis C virus RNA replication in cell culture. J. Virol. 2003, 77, 3007–3019. [Google Scholar] [CrossRef]
- Friebe, P.; Boudet, J.; Simorre, J.-P.; Bartenschlager, R. Kissing-Loop Interaction in the 3’ End of the Hepatitis C Virus Genome Essential for RNA Replication. J. Virol. 2005, 79, 380–392. [Google Scholar] [CrossRef]
- Binder, M.; Kochs, G.; Bartenschlager, R.; Lohmann, V. Hepatitis C virus escape from the interferon regulatory factor 3 pathway by a passive and active evasion strategy. Hepatology 2007, 46, 1365–1374. [Google Scholar] [CrossRef]
- Lohmann, V. Hepatitis C Virus RNA Replication. In Hepatitis C Virus: From Molecular Virology to Antiviral Therapy; Bartenschlager, R., Ed.; Springer: Berlin/Heidelberg, Germany, 2013; pp. 167–198. [Google Scholar]
- Li, Q.; Brass, A.L.; Ng, A.; Hu, Z.; Xavier, R.J.; Liang, T.J.; Elledge, S.J. A genome-wide genetic screen for host factors required for hepatitis C virus propagation. Proc. Natl. Acad. Sci. USA 2009, 106, 16410–16415. [Google Scholar] [CrossRef]
- Ng, T.I.; Mo, H.; Pilot-Matias, T.; He, Y.; Koev, G.; Krishnan, P.; Mondal, R.; Pithawalla, R.; He, W.; Dekhtyar, T.; et al. Identification of host genes involved in hepatitis C virus replication by small interfering RNA technology. Hepatology 2007, 45, 1413–1421. [Google Scholar] [CrossRef] [PubMed]
- Supekova, L.; Supek, F.; Lee, J.; Chen, S.; Gray, N.; Pezacki, J.P.; Schlapbach, A.; Schultz, P.G. Identification of human kinases involved in hepatitis C virus replication by small interference RNA library screening. J. Biol. Chem. 2008, 283, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Randall, G.; Panis, M.; Cooper, J.D.; Tellinghuisen, T.L.; Sukhodolets, K.E.; Pfeffer, S.; Landthaler, M.; Landgraf, P.; Kan, S.; Lindenbach, B.D.; et al. Cellular cofactors affecting hepatitis C virus infection and replication. Proc. Natl. Acad. Sci. USA 2007, 104, 12884–12889. [Google Scholar] [CrossRef] [PubMed]
- Berger, K.L.; Cooper, J.D.; Heaton, N.S.; Yoon, R.; Oakland, T.E.; Jordan, T.X.; Mateu, G.; Grakoui, A.; Randall, G. Roles for endocytic trafficking and phosphatidylinositol 4-kinase III alpha in hepatitis C virus replication. Proc. Natl. Acad. Sci. USA 2009, 106, 7577–7582. [Google Scholar] [CrossRef]
- Tai, A.W.; Benita, Y.; Peng, L.F.; Kim, S.S.; Sakamoto, N.; Xavier, R.J.; Chung, R.T. A functional genomic screen identifies cellular cofactors of hepatitis C virus replication. Cell Host Microbe 2009, 5, 298–307. [Google Scholar] [CrossRef]
- Borawski, J.; Troke, P.; Puyang, X.; Gibaja, V.; Zhao, S.; Mickanin, C.; Leighton-Davies, J.; Wilson, C.J.; Myer, V.; CornellaTaracido, I.; et al. Class III Phosphatidylinositol 4-Kinase Alpha and Beta Are Novel Host Factor Regulators of Hepatitis C Virus Replication. J. Virol. 2009, 83, 10058–10074. [Google Scholar] [CrossRef]
- Reiss, S.; Rebhan, I.; Backes, P.; Romero-Brey, I.; Erfle, H.; Matula, P.; Kaderali, L.; Poenisch, M.; Blankenburg, H.; Hiet, M.-S.; et al. Recruitment and Activation of a Lipid Kinase by Hepatitis C Virus NS5A Is Essential for Integrity of the Membranous Replication Compartment. Cell Host Microbe 2011, 9, 32–45. [Google Scholar] [CrossRef]
- Vaillancourt, F.H.; Pilote, L.; Cartier, M.; Lippens, J.; Liuzzi, M.; Bethell, R.C.; Cordingley, M.G.; Kukolj, G. Identification of a lipid kinase as a host factor involved in hepatitis C virus RNA replication. Virology 2009, 387, 5–10. [Google Scholar] [CrossRef]
- Jopling, C.L.; Yi, M.; Lancaster, A.M.; Lemon, S.M.; Sarnow, P. Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science 2005, 309, 1577–1581. [Google Scholar] [CrossRef]
- Kaul, A.; Stauffer, S.; Berger, C.; Pertel, T.; Schmitt, J.; Kallis, S.; Zayas, M.; Lohmann, V.; Luban, J.; Bartenschlager, R. Essential role of cyclophilin A for hepatitis C virus replication and virus production and possible link to polyprotein cleavage kinetics. PLoS Pathog. 2009, 5, e1000546. [Google Scholar] [CrossRef]
- Yang, F.; Robotham, J.M.; Nelson, H.B.; Irsigler, A.; Kenworthy, R.; Tang, H. Cyclophilin A Is an Essential Cofactor for Hepatitis C Virus Infection and the Principal Mediator of Cyclosporine Resistance In Vitro. J. Virol. 2008, 82, 5269–5278. [Google Scholar] [CrossRef] [PubMed]
- Hanoulle, X.; Badillo, A.; Wieruszeski, J.M.; Verdegem, D.; Landrieu, I.; Bartenschlager, R.; Penin, F.; Lippens, G. Hepatitis C virus NS5A protein is a substrate for the peptidyl-prolyl cis/trans isomerase activity of cyclophilins A and B. J. Biol. Chem. 2009, 284, 13589–13601. [Google Scholar] [CrossRef] [PubMed]
- Chatterji, U.; Bobardt, M.; Selvarajah, S.; Yang, F.; Tang, H.; Sakamoto, N.; Vuagniaux, G.; Parkinson, T.; Gallay, P. The isomerase active site of cyclophilin A is critical for hepatitis C virus replication. J. Biol. Chem. 2009, 284, 16998–17005. [Google Scholar] [CrossRef] [PubMed]
- Wilson, G.K.; Stamataki, Z. In Vitro Systems for the Study of Hepatitis C Virus Infection. Int. J. Hepatol. 2012, 2012, 292591. [Google Scholar] [CrossRef]
- Saeed, M.; Andreo, U.; Chung, H.Y.; Espiritu, C.; Branch, A.D.; Silva, J.M.; Rice, C.M. SEC14L2 enables pan-genotype HCV replication in cell culture. Nature 2015, 524, 471–475. [Google Scholar] [CrossRef]
- Binder, M.; Sulaimanov, N.; Clausznitzer, D.; Schulze, M.; Huber, C.M.; Lenz, S.M.; Schloder, J.P.; Trippler, M.; Bartenschlager, R.; Lohmann, V.; et al. Replication vesicles are load- and choke-points in the hepatitis C virus lifecycle. PLoS Pathog. 2013, 9, e1003561. [Google Scholar] [CrossRef]
- Jo, J.; Aichele, U.; Kersting, N.; Klein, R.; Aichele, P.; Bisse, E.; Sewell, A.K.; Blum, H.E.; Bartenschlager, R.; Lohmann, V.; et al. Analysis of CD8+ T-cell-mediated inhibition of hepatitis C virus replication using a novel immunological model. Gastroenterology 2009, 136, 1391–1401. [Google Scholar] [CrossRef]
- Koutsoudakis, G.; Herrmann, E.; Kallis, S.; Bartenschlager, R.; Pietschmann, T. The level of CD81 cell surface expression is a key determinant for productive entry of hepatitis C virus into host cells. J. Virol. 2007, 81, 588–598. [Google Scholar] [CrossRef]
- Pietschmann, T.; Kaul, A.; Koutsoudakis, G.; Shavinskaya, A.; Kallis, S.; Steinmann, E.; Abid, K.; Negro, F.; Dreux, M.; Cosset, F.L.; et al. Construction and characterization of infectious intragenotypic and intergenotypic hepatitis C virus chimeras. Proc. Natl. Acad. Sci. USA 2006, 103, 7408–7413. [Google Scholar] [CrossRef]
- Blight, K.J.; McKeating, J.A.; Rice, C.M. Highly Permissive Cell Lines for Subgenomic and Genomic Hepatitis C Virus RNA Replication. J. Virol. 2002, 76, 13001–13014. [Google Scholar] [CrossRef]
- Vieyres, G.; Pietschmann, T. Entry and replication of recombinant hepatitis C viruses in cell culture. Methods 2013, 59, 233–248. [Google Scholar] [CrossRef]
- An Excel Spreadsheet for Calculating the Infectious Titer. Available online: https://www.klinikum.uni-heidelberg.de/Downloads.126386.0.html (accessed on 28 December 2019).
- Chatel-Chaix, L.; Fischl, W.; Scaturro, P.; Cortese, M.; Kallis, S.; Bartenschlager, M.; Fischer, B.; Bartenschlager, R. A Combined Genetic-Proteomic Approach Identifies Residues within Dengue Virus NS4B Critical for Interaction with NS3 and Viral Replication. J. Virol. 2015, 89, 7170–7186. [Google Scholar] [CrossRef]
- Kuri, T.; Habjan, M.; Penski, N.; Weber, F. Species-independent bioassay for sensitive quantification of antiviral type I interferons. Virol. J. 2010, 7, 50. [Google Scholar] [CrossRef]
- Koutsoudakis, G.; Kaul, A.; Steinmann, E.; Kallis, S.; Lohmann, V.; Pietschmann, T.; Bartenschlager, R. Characterization of the Early Steps of Hepatitis C Virus Infection by Using Luciferase Reporter Viruses. J. Virol. 2006, 80, 5308–5320. [Google Scholar] [CrossRef]
- Schult, P.; Nattermann, M.; Lauber, C.; Seitz, S.; Lohmann, V. Evidence for internal initiation of RNA synthesis by the Hepatitis C virus RNA-dependent RNA polymerase NS5B in cellulo. J. Virol. 2019, 93, e00525-19. [Google Scholar] [CrossRef]
- Windisch, M.P.; Frese, M.; Kaul, A.; Trippler, M.; Lohmann, V.; Bartenschlager, R. Dissecting the interferon-induced inhibition of hepatitis C virus replication by using a novel host cell line. J. Virol. 2005, 79, 13778–13793. [Google Scholar] [CrossRef]
- Willemsen, J.; Wicht, O.; Wolanski, J.C.; Baur, N.; Bastian, S.; Haas, D.A.; Matula, P.; Knapp, B.; Meyniel-Schicklin, L.; Wang, C.; et al. Phosphorylation-Dependent Feedback Inhibition of RIG-I by DAPK1 Identified by Kinome-wide siRNA Screening. Mol. Cell 2017, 65, 403–415. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef]
- Koressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3_masker: Integrating masking of template sequence with primer design software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Mutz, P.; Metz, P.; Lempp, F.A.; Bender, S.; Qu, B.; Schöneweis, K.; Seitz, S.; Tu, T.; Restuccia, A.; Frankish, J.; et al. HBV Bypasses the Innate Immune Response and Does Not Protect HCV From Antiviral Activity of Interferon. Gastroenterology 2018, 154, 1791–1804. [Google Scholar] [CrossRef] [PubMed]
- Graham, F.L.; Smiley, J.; Russell, W.C.; Nairn, R. Characteristics of a Human Cell Line Transformed by DNA from Human Adenovirus Type 5. J. Gen. Virol. 1977, 36, 59–72. [Google Scholar] [CrossRef] [PubMed]
- ORFeome, T.; Wiemann, S.; Pennacchio, C.; Hu, Y.; Hunter, P.; Harbers, M.; Amiet, A.; Bethel, G.; Busse, M.; Carninci, P.; et al. The ORFeome Collaboration: A genome-scale human ORF-clone resource. Nat. Methods 2016, 13, 191. [Google Scholar]
- the ORFeome Collaboration (OC) cDNA Clones. Available online: http://www.orfeomecollaboration.org/ (accessed on 28 December 2019).
- Friedrich, G.; Soriano, P. Promoter traps in embryonic stem cells: A genetic screen to identify and mutate developmental genes in mice. Genes Dev. 1991, 5, 1513–1523. [Google Scholar] [CrossRef]
- Reece-Hoyes, J.S.; Walhout, A.J.M. Gateway Recombinational Cloning. Cold Spring Harb. Protoc. 2018, 2018, pdb-top094912. [Google Scholar] [CrossRef]
- Frese, M.; Barth, K.; Kaul, A.; Lohmann, V.; Schwarzle, V.; Bartenschlager, R. Hepatitis C virus RNA replication is resistant to tumour necrosis factor-alpha. J. Gen. Virol. 2003, 84 Pt 5, 1253–1259. [Google Scholar] [CrossRef]
- Vrolijk, J.M.; Kaul, A.; Hansen, B.E.; Lohmann, V.; Haagmans, B.L.; Schalm, S.W.; Bartenschlager, R. A replicon-based bioassay for the measurement of interferons in patients with chronic hepatitis C. J. Virol. Methods 2003, 110, 201–209. [Google Scholar] [CrossRef]
- Seko, D.; Ogawa, S.; Li, T.S.; Taimura, A.; Ono, Y. Mu-Crystallin controls muscle function through thyroid hormone action. Faseb J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2016, 30, 1733–1740. [Google Scholar]
- Conti, B.; Porcu, C.; Viscomi, C.; Minutolo, A.; Costantini, S.; Corazzari, M.; Iannucci, G.; Barbaro, B.; Balsano, C. Small heterodimer partner 1 directly interacts with NS5A viral protein and has a key role in HCV related liver cell transformation. Oncotarget 2016, 7, 84575–84586. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wakita, T.; Pietschmann, T.; Kato, T.; Date, T.; Miyamoto, M.; Zhao, Z.; Murthy, K.; Habermann, A.; Krausslich, H.G.; Mizokami, M.; et al. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat. Med. 2005, 11, 791–796. [Google Scholar] [CrossRef] [PubMed]
- Chang, K.O.; George, D.W. Bile acids promote the expression of hepatitis C virus in replicon-harboring cells. J. Virol. 2007, 81, 9633–9640. [Google Scholar] [CrossRef] [PubMed]
- Scholtes, C.; Diaz, O.; Icard, V.; Kaul, A.; Bartenschlager, R.; Lotteau, V.; Andre, P. Enhancement of genotype 1 hepatitis C virus replication by bile acids through FXR. J. Hepatol. 2008, 48, 192–199. [Google Scholar] [CrossRef]
- Chhatwal, P.; Bankwitz, D.; Gentzsch, J.; Frentzen, A.; Schult, P.; Lohmann, V.; Pietschmann, T. Bile acids specifically increase hepatitis C virus RNA-replication. PLoS ONE 2012, 7, e36029. [Google Scholar] [CrossRef]
- Goodwin, B.; Jones, S.A.; Price, R.R.; Watson, M.A.; McKee, D.D.; Moore, L.B.; Galardi, C.; Wilson, J.G.; Lewis, M.C.; Roth, M.E.; et al. A Regulatory Cascade of the Nuclear Receptors FXR, SHP-1 and LRH-1 Represses Bile Acid Biosynthesis. Mol. Cell 2000, 6, 517–526. [Google Scholar] [CrossRef]
- Lu, T.T.; Makishima, M.; Repa, J.J.; Schoonjans, K.; Kerr, T.A.; Auwerx, J.; Mangelsdorf, D.J. Molecular Basis for Feedback Regulation of Bile Acid Synthesis by Nuclear Receptors. Mol. Cell 2000, 6, 507–515. [Google Scholar] [CrossRef]
- Schroeder, F.; Holland, J.F.; Bieber, L.L. Fluorometric evidence for the binding of cholesterol to the filipin complex. J. Antibiot. 1971, 24, 846–849. [Google Scholar] [CrossRef]
- Su, W.-C.; Machida, K.; Lai, M.M.C. Extrahepatic Replication of HCV. In Hepatitis C Virus II: Infection and Disease; Miyamura, T., Lemon, S.M., Walker, C.M., Wakita, T., Eds.; Springer: Tokyo, Japan, 2016; pp. 165–184. [Google Scholar]
- Hiet, M.-S.; Bauhofer, O.; Zayas, M.; Roth, H.; Tanaka, Y.; Schirmacher, P.; Willemsen, J.; Grünvogel, O.; Bender, S.; Binder, M.; et al. Control of temporal activation of hepatitis C virus-induced interferon response by domain 2 of nonstructural protein 5A. J. Hepatol. 2015, 63, 829–837. [Google Scholar] [CrossRef]
- Reyes-del Valle, J.; Salas-Benito, J.; Soto-Acosta, R.; del Angel, R.M. Dengue Virus Cellular Receptors and Tropism. Curr. Trop. Med. Rep. 2014, 1, 36–43. [Google Scholar] [CrossRef]
- van der Meulen, K.M.; Pensaert, M.B.; Nauwynck, H.J. West Nile virus in the vertebrate world. Arch. Virol. 2005, 150, 637–657. [Google Scholar] [CrossRef]
- Vorou, R. Zika virus, vectors, reservoirs, amplifying hosts, and their potential to spread worldwide: What we know and what we should investigate urgently. Int. J. Infect. Dis. 2016, 48, 85–90. [Google Scholar] [CrossRef] [PubMed]
- Sumpter, R., Jr.; Loo, Y.-M.; Foy, E.; Li, K.; Yoneyama, M.; Fujita, T.; Lemon, S.M.; Gale, M., Jr. Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. J. Virol. 2005, 79, 2689–2699. [Google Scholar] [CrossRef] [PubMed]
- Paul, D.; Madan, V.; Bartenschlager, R. Hepatitis C virus RNA replication and assembly: Living on the fat of the land. Cell Host Microbe 2014, 16, 569–579. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Zhang, Y.Y.; Chiu, S.; Hu, Z.; Lan, K.H.; Cha, H.; Sodroski, C.; Zhang, F.; Hsu, C.S.; Thomas, E.; et al. Integrative functional genomics of hepatitis C virus infection identifies host dependencies in complete viral replication cycle. PLoS Pathog. 2014, 10, e1004163. [Google Scholar] [CrossRef]
- Poenisch, M.; Metz, P.; Blankenburg, H.; Ruggieri, A.; Lee, J.Y.; Rupp, D.; Rebhan, I.; Diederich, K.; Kaderali, L.; Domingues, F.S.; et al. Identification of HNRNPK as regulator of hepatitis C virus particle production. PLoS Pathog. 2015, 11, e1004573. [Google Scholar] [CrossRef]
- Marceau, C.D.; Puschnik, A.S.; Majzoub, K.; Ooi, Y.S.; Brewer, S.M.; Fuchs, G.; Swaminathan, K.; Mata, M.A.; Elias, J.E.; Sarnow, P.; et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature 2016, 535, 159. [Google Scholar] [CrossRef]
- Ren, Q.; Li, C.; Yuan, P.; Cai, C.; Zhang, L.; Luo, G.G.; Wei, W. A Dual-Reporter System for Real-Time Monitoring and High-throughput CRISPR/Cas9 Library Screening of the Hepatitis C Virus. Sci. Rep. 2015, 5, 8865. [Google Scholar] [CrossRef]
- Qanbari, S.; Rubin, C.J.; Maqbool, K. Genetics of adaptation in modern chicken. PLoS Genet. 2019, 15, e1007989. [Google Scholar] [CrossRef]
- Ohkubo, Y.; Sekido, T.; Nishio, S.I.; Sekido, K.; Kitahara, J.; Suzuki, S.; Komatsu, M. Loss of mu-crystallin causes PPARgamma activation and obesity in high-fat diet-fed mice. Biochem. Biophys. Res. Commun. 2019, 508, 914–920. [Google Scholar] [CrossRef]
- Macfarlan, T.; Kutney, S.; Altman, B.; Montross, R.; Yu, J.; Chakravarti, D. Human THAP7 is a chromatin-associated, histone tail-binding protein that represses transcription via recruitment of HDAC3 and nuclear hormone receptor corepressor. J. Biol. Chem. 2005, 280, 7346–7358. [Google Scholar] [CrossRef] [PubMed]
- Macfarlan, T.; Parker, J.B.; Nagata, K.; Chakravarti, D. Thanatos-associated protein 7 associates with template activating factor-Ibeta and inhibits histone acetylation to repress transcription. Mol. Endocrinol. 2006, 20, 335–347. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wang, Q.; Yang, Q.; Tang, J.; Xu, C.; Gai, D.; Chen, X.; Chen, J. Histone Deacetylase 3 Inhibitor Suppresses Hepatitis C Virus Replication by Regulating Apo-A1 and LEAP-1 Expression. Virol. Sin. 2018, 33, 418–428. [Google Scholar] [CrossRef] [PubMed]
- Kozlov, M.V.; Konduktorov, K.A.; Malikova, A.Z.; Kamarova, K.A.; Shcherbakova, A.S.; Solyev, P.N.; Kochetkov, S.N. Structural isomers of cinnamic hydroxamic acids block HCV replication via different mechanisms. Eur. J. Med. Chem. 2019, 183, 111723. [Google Scholar] [CrossRef]
- Harak, C.; Meyrath, M.; Romero-Brey, I.; Schenk, C.; Gondeau, C.; Schult, P.; Esser-Nobis, K.; Saeed, M.; Neddermann, P.; Schnitzler, P.; et al. Tuning a cellular lipid kinase activity adapts hepatitis C virus to replication in cell culture. Nat. Microbiol. 2016, 2, 16247. [Google Scholar] [CrossRef]
- Jung, G.-S.; Jeon, J.-H.; Choi, Y.-K.; Jang, S.Y.; Park, S.Y.; Kim, M.-K.; Shin, E.-C.; Jeong, W.-I.; Lee, I.-K.; Kang, Y.N.; et al. Small heterodimer partner attenuates profibrogenic features of hepatitis C virus-infected cells. Liver Int. 2015, 35, 2233–2245. [Google Scholar] [CrossRef]
- Seol, W.; Choi, H.S.; Moore, D.D. An orphan nuclear hormone receptor that lacks a DNA binding domain and heterodimerizes with other receptors. Science 1996, 272, 1336–1339. [Google Scholar] [CrossRef]
- Chanda, D.; Park, J.H.; Choi, H.S. Molecular basis of endocrine regulation by orphan nuclear receptor Small Heterodimer Partner. Endocr. J. 2008, 55, 253–268. [Google Scholar] [CrossRef]
- Nishizawa, H.; Yamagata, K.; Shimomura, I.; Takahashi, M.; Kuriyama, H.; Kishida, K.; Hotta, K.; Nagaretani, H.; Maeda, N.; Matsuda, M.; et al. Small heterodimer partner, an orphan nuclear receptor, augments peroxisome proliferator-activated receptor gamma transactivation. J. Biol. Chem. 2002, 277, 1586–1592. [Google Scholar] [CrossRef]
- Kim, H.I.; Koh, Y.K.; Kim, T.H.; Kwon, S.K.; Im, S.S.; Choi, H.S.; Kim, K.S.; Ahn, Y.H. Transcriptional activation of SHP by PPAR-gamma in liver. Biochem. Biophys. Res. Commun. 2007, 360, 301–306. [Google Scholar] [CrossRef]
- Paul, D.; Hoppe, S.; Saher, G.; Krijnse-Locker, J.; Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 2013, 87, 10612–10627. [Google Scholar] [CrossRef]
- Romero-Brey, I.; Merz, A.; Chiramel, A.; Lee, J.Y.; Chlanda, P.; Haselman, U.; Santarella-Mellwig, R.; Habermann, A.; Hoppe, S.; Kallis, S.; et al. Three-dimensional architecture and biogenesis of membrane structures associated with hepatitis C virus replication. PLoS Pathog. 2012, 8, e1003056. [Google Scholar] [CrossRef]








| Name | Sequence 5′-3′ |
|---|---|
| THAP7_fwd | ccttagcagccccttttcag |
| THAP7_rev | ccacctggtagctgtgttca |
| CRYM_fwd | aaacctcccagcagtgaagt |
| CRYM_rev | gaccgaagaacagacccgta |
| LBHD1_fwd | ctcaaaagtcccatctgccg |
| LBHD1_rev | gacttctagggtcctgtggg |
| CRAMP1_fwd | gaagaagctgtgcgatccag |
| CRAMP1_rev | agctccacgatcatcctgag |
| NR0B2_fwd | ggagcttagccccaaggaat |
| NR0B2_rev | agggttccaggacttcacaca |
| FXR_fwd | tgtgaggggtgtaaaggtttct |
| FXR_rev | gccaacattcccatctctttgc |
| GAPDH_fwd | tcggagtcaacggatttggt |
| GAPDH_rev | ttcccgttctcagccttgac |
| Name | Sequence 5′-3′ |
|---|---|
| C11orf48 cDNA 3′-UTR R | ggggcttttgtcttcttttgc |
| C11orf48 attB F | GGGGACAAGTTTGTACAAAAAAGCAGGCTTCatggcccttgtgccagggagaa |
| C11orf48 attB R open | GGGGACCACTTTGTACAAGAAAGCTGGGTCgtcctggctggctttgaaggggct |
| Name | Sequence 5′-3′ |
|---|---|
| CRAMP1 attB F | GGGGACAAGTTTGTACAAAAAAGCAGGCTTCatgacagtgaagttgggcgac |
| CRAMP1 overlap R | gccttcttccttctcgccaccagaagaccctaagttccg |
| CRAMP1 overlap F | cggaacttagggtcttctggtggcgagaaggaagaaggc |
| CRAMP1 attB R open | GGGGACCACTTTGTACAAGAAAGCTGGGTCctgggacaggtcactgacagc |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dächert, C.; Gladilin, E.; Binder, M. Gene Expression Profiling of Different Huh7 Variants Reveals Novel Hepatitis C Virus Host Factors. Viruses 2020, 12, 36. https://doi.org/10.3390/v12010036
Dächert C, Gladilin E, Binder M. Gene Expression Profiling of Different Huh7 Variants Reveals Novel Hepatitis C Virus Host Factors. Viruses. 2020; 12(1):36. https://doi.org/10.3390/v12010036
Chicago/Turabian StyleDächert, Christopher, Evgeny Gladilin, and Marco Binder. 2020. "Gene Expression Profiling of Different Huh7 Variants Reveals Novel Hepatitis C Virus Host Factors" Viruses 12, no. 1: 36. https://doi.org/10.3390/v12010036
APA StyleDächert, C., Gladilin, E., & Binder, M. (2020). Gene Expression Profiling of Different Huh7 Variants Reveals Novel Hepatitis C Virus Host Factors. Viruses, 12(1), 36. https://doi.org/10.3390/v12010036

