Bovine Astrovirus Surveillance in Uruguay Reveals High Detection Rate of a Novel Mamastrovirus Species
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples, RNA Extraction and Reverse Transcription
2.2. Polymerase Chain Reaction for BoAstV Detection and Sequencing
2.3. Capsid PCR and Sequencing
2.4. Phylogenetic Analyses
2.5. Estimates of the Evolutionary Divergence between Sequences
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Woode, G.N.; Bridger, J.C. Isolation of small viruses resembling astroviruses and caliciviruses from acute enteritis of calves. J. Med. Microbiol. 1978, 11, 441–452. [Google Scholar] [CrossRef]
- Woode, G.N.; Pohlenz, J.F.; Gourley, N.E.; Fagerland, J.A. Astrovirus and Breda virus infections of dome cell epithelium of bovine ileum. J. Clin. Microbiol. 1984, 19, 623–630. [Google Scholar]
- Li, L.; Diab, S.; McGraw, S.; Barr, B.; Traslavina, R.; Higgins, R.; Talbot, T.; Blanchard, P.; Rimoldi, G.; Fahsbender, E.; et al. Divergent astrovirus associated with neurologic disease in cattle. Emerg. Infect. Dis. 2013, 19, 1385–1392. [Google Scholar] [CrossRef]
- Giannitti, F.; Caffarena, R.D.; Pesavento, P.; Uzal, F.A.; Maya, L.; Fraga, M.; Colina, R.; Castells, M. The first case of bovine astrovirus-associated encephalitis in the southern hemisphere (Uruguay) uncovers evidence of viral introduction to the Americas from Europe. Front. Microbiol. 2019, 10, 1240. [Google Scholar] [CrossRef]
- Ng, T.F.; Kondov, N.O.; Deng, X.; van Eenennaam, A.; Neibergs, H.L.; Delwart, E. A metagenomics and case-control study to identify viruses associated with bovine respiratory disease. J. Virol. 2015, 89, 5340–5349. [Google Scholar] [CrossRef]
- Cordey, S.; Brito, F.; Vu, D.L.; Turin, L.; Kilowoko, M.; Kyungu, E.; Genton, B.; Zdobnov, E.M.; D’Acremont, V.; Kaiser, L. Astrovirus VA1 identified by next-generation sequencing in a nasopharyngeal specimen of a febrile Tanzanian child with acute respiratory disease of unknown etiology. Emerg. Microbes Infect. 2016, 6, e67. [Google Scholar]
- Padmanabhan, A.; Hause, B.M. Detection and characterization of a novel genotype of porcine astrovirus 4 from nasal swabs from pigs with acute respiratory disease. Arch. Virol. 2016, 161, 2575–2579. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Khalafalla, A.I.; Paden, C.R.; Yusof, M.F.; Eltahir, Y.M.; Al Hammadi, Z.M.; Tao, Y.; Queen, K.; Hosani, F.A.; Gerber, S.I.; et al. Identification of diverse viruses in upper respiratory samples in dromedary camels from United Arab Emirates. PLoS ONE 2017, 13, e0184718. [Google Scholar] [CrossRef] [PubMed]
- Bosch, A.; Pintó, R.M.; Guix, S. Human astroviruses. Clin. Microbiol. Rev. 2014, 27, 1048–1074. [Google Scholar] [CrossRef] [PubMed]
- Donato, C.; Vijaykrishna, D. The broad host range and genetic diversity of mammalian and avian astroviruses. Viruses 2017, 9, 102. [Google Scholar] [CrossRef] [PubMed]
- Alfred, N.; Liu, H.; Li, M.L.; Hong, S.F.; Tang, H.B.; Wei, Z.Z.; Chen, Y.; Li, F.K.; Zhong, Y.Z.; Huang, W.J. Molecular epidemiology and phylogenetic analysis of diverse bovine astroviruses associated with diarrhea in cattle and water buffalo calves in China. J. Vet. Med. Sci. 2015, 77, 643–651. [Google Scholar] [CrossRef] [PubMed]
- Woode, G.N.; Gourley, N.E.; Pohlenz, J.F.; Liebler, E.M.; Mathews, S.L.; Hutchinson, M.P. Serotypes of bovine astrovirus. J. Clin. Microbiol. 1985, 22, 668–670. [Google Scholar] [PubMed]
- Tse, H.; Chan, W.M.; Tsoi, H.W.; Fan, R.Y.; Lau, C.C.; Lau, S.K.; Woo, P.C.; Yuen, K.Y. Rediscovery and genomic characterization of bovine astroviruses. J. Gen. Virol. 2011, 92, 1888–1898. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016, 8, W232–W235. [Google Scholar] [CrossRef]
- Méndez, E.; Arias, C.F. Astroviruses. In Fields Virology, 6th ed.; Knipe, D.M., Howley, P.M., Cohen, J.I., Griffin, D.E., Lamb, R.A., Martin, M.A., Racaniello, V.R., Roizman, B., Eds.; Wolters Kluwer/Lippincott Williams and Wilkins: Philadelphia, PA, USA, 2013; Volume 1, pp. 609–628. [Google Scholar]
- Johnson, C.; Hargest, V.; Cortez, V.; Meliopoulos, V.A.; Schultz-Cherry, S. Astrovirus Pathogenesis. Viruses 2017, 9, 22. [Google Scholar] [CrossRef]
- Candido, M.; Alencar, A.L.; Almeida-Queiroz, S.R.; da Glória Buzinaro, M.; Munin, F.S.; de Godoy, S.H.; Livonesi, M.C.; Fernandes, A.M.; de Sousa, R.L. Molecular detection and phylogenetic analysis of bovine astrovirus in Brazil. Arch. Virol. 2015, 160, 1519–1525. [Google Scholar] [CrossRef]
- Mohamed, F.F.; Mansour, S.M.G.; El-Araby, I.E.; Mor, S.K.; Goyal, S.M. Molecular detection of enteric viruses from diarrheic calves in Egypt. Arch. Virol. 2017, 162, 129–137. [Google Scholar] [CrossRef]
- Hirashima, Y.; Okada, D.; Shibata, S.; Yoshida, S.; Fujisono, S.; Omatsu, T.; Mizutani, T.; Nagai, M. Whole genome analysis of a novel neurotropic bovine astrovirus detected in a Japanese black steer with non-suppurative encephalomyelitis in Japan. Arch. Virol. 2018, 163, 2805–2810. [Google Scholar] [CrossRef]
- Pérot, P.; Lecuit, M.; Eloit, M. Astrovirus Diagnostics. Viruses 2017, 9, 10. [Google Scholar] [CrossRef]
- Oem, J.K.; An, D.J. Phylogenetic analysis of bovine astrovirus in Korean cattle. Virus Genes 2014, 48, 372–375. [Google Scholar] [CrossRef] [PubMed]
- Nagai, M.; Omatsu, T.; Aoki, H.; Otomaru, K.; Uto, T.; Koizumi, M.; Minami-Fukuda, F.; Takai, H.; Murakami, T.; Masuda, T.; et al. Full genome analysis of bovine astrovirus from fecal samples of cattle in Japan: Identification of possible interspecies transmission of bovine astrovirus. Arch. Virol. 2015, 160, 2491–2501. [Google Scholar] [CrossRef] [PubMed]
- Sharp, C.P.; Gregory, W.F.; Mason, C.; Bronsvoort, B.M.; Beard, P.M. High prevalence and diversity of bovine astroviruses in the faeces of healthy and diarrhoeic calves in South West Scotland. Vet. Microbiol. 2015, 178, 70–76. [Google Scholar] [CrossRef]
- Meyer, A.G.; Spielman, S.J.; Bedford, T.; Wilke, C.O. Time dependence of evolutionary metrics during the 2009 pandemic influenza virus outbreak. Virus Evol. 2015, 1, vev006. [Google Scholar] [CrossRef] [PubMed]
- Gire, S.K.; Goba, A.; Andersen, K.G.; Sealfon, R.S.; Park, D.J.; Kanneh, L.; Jalloh, S.; Momoh, M.; Fullah, M.; Dudas, G.; et al. Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak. Science 2014, 345, 1369–1372. [Google Scholar] [CrossRef]
- Park, D.J.; Dudas, G.; Wohl, S.; Goba, A.; Whitmer, S.L.; Andersen, K.G.; Sealfon, R.S.; Ladner, J.T.; Kugelman, J.R.; Matranga, C.B.; et al. Ebola virus epidemiology, transmission, and evolution during seven months in Sierra Leone. Cell 2015, 161, 1516–1526. [Google Scholar] [CrossRef]
- Vu, D.L.; Bosch, A.; Pintó, R.M.; Guix, S. Epidemiology of classic and novel human astrovirus: Gastroenteritis and beyond. Viruses 2017, 9, 33. [Google Scholar] [CrossRef]
- Arias, C.F.; DuBois, R.M. The Astrovirus Capsid: A Review. Viruses 2017, 9, 15. [Google Scholar] [CrossRef]



| Primer Name | 5′–3′ Sequence | Genomic Region | Reference |
|---|---|---|---|
| BoAstV-F | GAYTGGACBCGHTWTGATGG | RdRp | [13] |
| BoAstV-R | KYTTRACCCACATNCCAA | ||
| BoAstV-CAP-U-33F1 | GCCCTCTATGGGAAACTCCT | Capsid | This study |
| BoAstV-CAP-U-33R1 | GTMACCAKCCAKATWATYTC | ||
| BoAstV-CAP-UF2 | CAACARCCWGGGTTYATGAA | Capsid | This study |
| BoAstV-CAP-UR2 | ATCCTCATCAGAGAGATCA | ||
| BoAstV-CAP-UF3 | TTGGAGATGGCRGAYGATGA | Capsid | This study |
| BoAstV-CAP-UR3 | GCCAAATTAAATTAACTGG | ||
| BoAstV-CAP-28F1 | AGCCTCTGTGGGAAACTAGA | Capsid | This study |
| BoAstV-CAP-28R1 | CCACCAVCCRCCCHTRAAAAGCCA |
| Uruguayan Strain LVMS2704 (MN200263) | Uruguayan Strain LVMS681 (MN200262) | ||
|---|---|---|---|
| MAstV-Species | Distance | MAstV-Species | Distance |
| MN200262 BoAstV LVMS681 MAstV-X | 0.01 | MN200263 BoAstV LVMS2704 MAstV-X | 0.01 |
| LC047792 BoAstV Hokkaido12-18 MAstV-X | 0.09 | LC047792 BoAstV Hokkaido12-18 MAstV-X | 0.09 |
| LC047794 BoAstV Hokkaido12-27 MAstV-X | 0.29 | LC047794 BoAstV Hokkaido12-27 MAstV-X | 0.29 |
| LC047795 BoAstV Kagoshima1-2 MAstV-X | 0.29 | LC047795 BoAstV Kagoshima1-2 MAstV-X | 0.29 |
| LC047801 BoAstV Kagoshima2-52 MAstV-X | 0.29 | LC047801 BoAstV Kagoshima2-52 MAstV-X | 0.29 |
| LC047789 BoAstV Hokkaido11-7 MAstV-X | 0.29 | LC047789 BoAstV Hokkaido11-7 MAstV-X | 0.29 |
| LC047799 BoAstV Kagoshima2-24 MAstV-X | 0.30 | LC047799 BoAstV Kagoshima2-24 MAstV-X | 0.30 |
| LC047788 BoAstV Ishikawa9728 MAstV-X | 0.31 | LC047788 BoAstV Ishikawa9728 MAstV-X | 0.31 |
| HQ916314 BoAstV B170 MAstV-30 | 0.48 | HQ916314 BoAstV B170 MAstV-30 | 0.48 |
| HQ916316 BoAstV B76 MAstV-29 | 0.49 | HQ916316 BoAstV B76 MAstV-29 | 0.49 |
| HM756260 PoAstV 14-4 MAstV-31 | 0.52 | HM756260 PoAstV 14-4 MAstV-31 | 0.52 |
| KJ476833 BoAstV BAstGX-G1 MAstV-33 | 0.54 | KJ476833 BoAstV BAstGX-G1 MAstV-33 | 0.54 |
| KX645667 BaAstV LAP11-A0091 MAstV-X | 0.54 | KX645667 BaAstV LAP11-A0091 MAstV-X | 0.54 |
| LC047796 BoAstV Kagoshima1-7 MAstV-33 | 0.55 | LC047796 BoAstV Kagoshima1-7 MAstV-33 | 0.54 |
| HQ916313 BoAstV B18 MAstV-33 | 0.55 | HQ916313 BoAstV B18 MAstV-33 | 0.55 |
| KJ495986 PoAstV ExpPig-36 MAstV-32 | 0.55 | HQ916317 BoAstV B76-2 MAstV-33 | 0.55 |
| HQ916317 BoAstV B76-2 MAstV-33 | 0.55 | KJ495986 PoAstV ExpPig-36 MAstV-32 | 0.55 |
| KJ620979 BoAstV BAstV-GX7 MAstV-33 | 0.55 | KJ620979 BoAstV BAstV-GX7 MAstV-33 | 0.55 |
| KJ476834 BoAstV BAstGX-J7 MAstV-33 | 0.55 | KJ476834 BoAstV BAstGX-J7 MAstV-33 | 0.55 |
| KJ476832 BoAstV BAstGX-J27 MAstV-33 | 0.55 | KJ476832 BoAstV BAstGX-J27 MAstV-33 | 0.55 |
| KJ476836 BoAstV BAstGX-J8 MAstV-33 | 0.55 | KJ476836 BoAstV BAstGX-J8 MAstV-33 | 0.55 |
| KJ620980 BoAstV BAstV-GX27 MAstV-33 | 0.55 | KJ620980 BoAstV BAstV-GX27 MAstV-33 | 0.55 |
| KJ476835 BoAstV BAstGX-J22 MAstV-33 | 0.55 | KJ476835 BoAstV BAstGX-J22 MAstV-33 | 0.55 |
| KR868724 DrAstV DcAstV-274 MAstV-X | 0.57 | KR868724 DrAstV DcAstV-274 MAstV-X | 0.56 |
| HQ916315 BoAstV B34 MAstV-28 | 0.60 | HQ916315 BoAstV B34 MAstV-28 | 0.60 |
| LC047787 BoAstV Ishikawa24-6 MAstV-28 | 0.61 | LC047787 BoAstV Ishikawa24-6 MAstV-28 | 0.61 |
| LC047797 BoAstV Kagoshima2-3-1 MAstV-28 | 0.61 | LC047797 BoAstV Kagoshima2-3-1 MAstV-28 | 0.61 |
| LC047800 BoAstV Kagoshima2-38 MAstV-28 | 0.65 | LC047800 BoAstV Kagoshima2-38 MAstV-28 | 0.65 |
| KT963071 BoAstV 715 MAstV-28 | 0.66 | KT963071 BoAstV 715 MAstV-28 | 0.66 |
| LC047798 BoAstV Kagoshima2-3-2 MAstV-28 | 0.67 | LC047798 BoAstV Kagoshima2-3-2 MAstV-28 | 0.67 |
| KP264970 BoAstV BSRI-1 MAstV-28 | 0.67 | KP264970 BoAstV BSRI-1 MAstV-28 | 0.67 |
| LC047790 BoAstV Hokkaido11-55 MAstV-28 | 0.68 | LC047790 BoAstV Hokkaido11-55 MAstV-28 | 0.68 |
| JQ408745 MuAstV TF18LM MAstV-X | 0.70 | JX684071 PoAstV US-P2011-1 MAstV-26 | 0.70 |
| JX544746 MuAstV STL 4 MAstV-X | 0.70 | JQ408745 MuAstV TF18LM MAstV-X | 0.70 |
| JX684071 PoAstV US-P2011-1 MAstV-26 | 0.70 | JX544746 MuAstV STL 4 MAstV-X | 0.70 |
| KU764486 PoAstV 15-12 MAstV-26 | 0.71 | KU764486 PoAstV 15-12 MAstV-26 | 0.71 |
| JX556692 PoAstV IL135 MAstV-27 | 0.72 | JX556692 PoAstV IL135 MAstV-27 | 0.72 |
| KM017742 CaAstV FAstV-D2 MAstV-2 | 0.74 | KM017742 CaAstV FAstV-D2 MAstV-2 | 0.74 |
| L23513 HuAstV Oxford-1 MAstV-1 | 0.74 | JN592482 OvAstV OAstV-2 MAstV-24 | 0.74 |
| JN592482 OvAstV OAstV-2 MAstV-24 | 0.74 | LC201619 PoAstV Ishi-Im1-1 MAstV-24 | 0.74 |
| LC201619 PoAstV Ishi-Im1-1 MAstV-24 | 0.74 | L23513 HuAstV Oxford-1 MAstV-1 | 0.74 |
| HM450381 RatAstV RS118 MAstV-25 | 0.75 | HM450381 RatAstV RS118 MAstV-25 | 0.75 |
| L06802 HuAstV Oxford-2 MAstV-1 | 0.75 | LC047793 BoAstV Hokkaido12-25 MAstV-24 | 0.75 |
| LC047793 BoAstV Hokkaido12-25 MAstV-24 | 0.76 | GQ914773 PoAstV Shanghai MAstV-3 | 0.75 |
| GQ914773 PoAstV Shanghai MAstV-3 | 0.76 | L06802 HuAstV Oxford-2 MAstV-1 | 0.76 |
| JN420351 CslAstV 4 1136 MAstV-11 | 0.76 | KR349491 DoAstV Grav MAstV-5 | 0.76 |
| KR349491 DoAstV Grav MAstV-5 | 0.76 | JN420351 CslAstV 4 1136 MAstV-11 | 0.76 |
| JN420354 CslAstV 1169 MAstV-4 | 0.76 | JN420354 CslAstV 1169 MAstV-4 | 0.76 |
| FJ222451 HuAstV MLB1 MAstV-6 | 0.77 | FJ222451 HuAstV MLB1 MAstV-6 | 0.77 |
| FJ571068 BaAstV LS11 MAstV-17 | 0.78 | JF729316 RabAstV 2208 MAstV-23 | 0.78 |
| JF729316 RabAstV 2208 MAstV-23 | 0.78 | FJ571068 BaAstV LS11 MAstV-17 | 0.78 |
| EU847144 BaAstV AFCD57 MAstV-14 | 0.78 | EU847144 BaAstV AFCD57 MAstV-14 | 0.78 |
| FJ571066 BaAstV LD77 MAstV-15 | 0.78 | FJ571066 BaAstV LD77 MAstV-15 | 0.78 |
| FJ571071 BaAstV DX19 MAstV-19 | 0.79 | FJ571071 BaAstV DX19 MAstV-19 | 0.79 |
| FJ973620 HuAstV VA1 MAstV-9 | 0.79 | FJ973620 HuAstV VA1 MAstV-9 | 0.79 |
| EU847145 BaAstV AFCD11 MAstV-16 | 0.79 | GQ502193 HuAstV VA2 WD0680 MAstV-8 | 0.79 |
| GQ502193 HuAstV VA2 WD0680 MAstV-8 | 0.79 | EU847145 BaAstV AFCD11 MAstV-16 | 0.79 |
| KF233994 BoAstV NeuroS1 MAstV-13 | 0.79 | KM035759 BoAstV CH13 MAstV-13 | 0.79 |
| KM035759 BoAstV CH13 MAstV-13 | 0.79 | KF233994 BoAstV NeuroS1 MAstV-13 | 0.79 |
| AY179509 MiAstV MAstV-10 | 0.80 | AY179509 MiAstV MAstV-10 | 0.80 |
| FJ890355 BdAstV Bd1 MAstV-7 | 0.80 | JF755422 MoAstV M-52 MAstV-20 | 0.80 |
| JF755422 MoAstV M-52 MAstV-20 | 0.80 | FJ890355 BdAstV Bd1 MAstV-7 | 0.80 |
| FJ571067 BaAstV LD71 MAstV-12 | 0.80 | FJ571067 BaAstV LD71 MAstV-12 | 0.80 |
| Y15937 OvAstV Snodgrass MAstV-13 | 0.80 | Y15937 OvAstV Snodgrass MAstV-13 | 0.80 |
| GU985458 MiAstV SMS MAstV-21 | 0.80 | GU985458 MiAstV SMS MAstV-21 | 0.80 |
| KT956903 BoAstV CH15 MAstV-13 | 0.80 | EU847155 BaAstV AFCD337 MAstV-18 | 0.80 |
| LN879482 BoAstV BH89/14 MAstV-13 | 0.80 | KT956903 BoAstV CH15 MAstV-13 | 0.80 |
| EU847155 BaAstV AFCD337 MAstV-18 | 0.81 | LN879482 BoAstV BH89/14 MAstV-13 | 0.80 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Castells, M.; Bertoni, E.; Caffarena, R.D.; Casaux, M.L.; Schild, C.; Victoria, M.; Riet-Correa, F.; Giannitti, F.; Parreño, V.; Colina, R. Bovine Astrovirus Surveillance in Uruguay Reveals High Detection Rate of a Novel Mamastrovirus Species. Viruses 2020, 12, 32. https://doi.org/10.3390/v12010032
Castells M, Bertoni E, Caffarena RD, Casaux ML, Schild C, Victoria M, Riet-Correa F, Giannitti F, Parreño V, Colina R. Bovine Astrovirus Surveillance in Uruguay Reveals High Detection Rate of a Novel Mamastrovirus Species. Viruses. 2020; 12(1):32. https://doi.org/10.3390/v12010032
Chicago/Turabian StyleCastells, Matías, Estefany Bertoni, Rubén Darío Caffarena, María Laura Casaux, Carlos Schild, Matías Victoria, Franklin Riet-Correa, Federico Giannitti, Viviana Parreño, and Rodney Colina. 2020. "Bovine Astrovirus Surveillance in Uruguay Reveals High Detection Rate of a Novel Mamastrovirus Species" Viruses 12, no. 1: 32. https://doi.org/10.3390/v12010032
APA StyleCastells, M., Bertoni, E., Caffarena, R. D., Casaux, M. L., Schild, C., Victoria, M., Riet-Correa, F., Giannitti, F., Parreño, V., & Colina, R. (2020). Bovine Astrovirus Surveillance in Uruguay Reveals High Detection Rate of a Novel Mamastrovirus Species. Viruses, 12(1), 32. https://doi.org/10.3390/v12010032

