A Simple Method for Sample Preparation to Facilitate Efficient Whole-Genome Sequencing of African Swine Fever Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. PAM Preparation and Culture
2.2. Virus Isolation and Immunofluorescence Detection
2.3. Viral Stock Preparation
2.4. DNAse Treatment
2.5. DNA Purification
2.6. Quantitative PCR
2.7. Aspecific DNA Amplification
2.8. Amplified DNA Clean Up
2.9. IonTorrent Sequencing
2.10. Illumina Sequencing
2.11. Mapping and Assembly
2.12. Sanger Sequencing
2.13. Phylogenetic Analyses
3. Results and Discussion
3.1. Maximizing Viral DNA Content
3.2. Minimizing Contaminating Host Genome DNA
3.3. Nonspecific Amplification of the Viral DNA
3.4. NGS Sequencing of the ASFV Genome
3.5. Analysis of the Sequence
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Burrage, T.G. African swine fever virus infection in Ornithodoros ticks. Virus Res. 2013, 173, 131–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kleiboeker, S.B.; Burrage, T.G.; Scoles, G.A.; Fish, D.; Rock, D.L. African swine fever virus infection in the argasid host, Ornithodoros porcinus porcinus. J. Virol. 1998, 72, 1711–1724. [Google Scholar] [PubMed]
- Lubisi, B.A.; Bastos, A.D.; Dwarka, R.M.; Vosloo, W. Molecular epidemiology of African swine fever in East Africa. Arch. Virol. 2005, 150, 2439–2452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olasz, F.; Mészáros, I.; Tamás, V.; Bálint, Á.; Bruczyńska, M.; Wozniakowski, G.; Zádori, Z. The epidemiological features of African swine fever and the possibilities of prevention. Hung. Vet. J. 2019, 141, 101–115. [Google Scholar]
- Pejsak, Z.; Niemczuk, K.; Frant, M.; Mazur, M.; Pomorska-Mól, M.; Ziętek-Barszcz, A.; Bocian, Ł.; Łyjak, M.; Borowska, D.; Woźniakowski, G. Four years of African swine fever in Poland. New insights into epidemiology and prognosis of future disease spread. Pol. J. Vet. Sci. 2018, 21, 835–841. [Google Scholar] [PubMed]
- Galindo, I.; Alonso, C. African swine fever virus: A review. Viruses 2017, 9, 103. [Google Scholar] [CrossRef] [Scilit]
- Alkhamis, M.A.; Gallardo, C.; Jurado, C.; Soler, A.; Arias, M.; Sanchez-Vizcaino, J.M. Phylodynamics and evolutionary epidemiology of African swine fever p72-CVR genes in Eurasia and Africa. PLoS ONE 2018, 13, e0192565. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Li, N.; Luo, Y.; Liu, Y.; Miao, F.; Chen, T.; Zhang, S.; Cao, P.; Li, X.; Tian, K.; et al. Emergence of African Swine Fever in China, 2018. Transbound. Emerg. Dis. 2018, 65, 1482–1484. [Google Scholar] [CrossRef] [Scilit]
- Arias, M.; Jurado, C.; Gallardo, C.; Fernández-Pinero, J.; Sánchez-Vizcaíno, J.M. Gaps in African swine fever: Analysis and priorities. Transbound. Emerg. Dis. 2018, 65, 235–247. [Google Scholar] [CrossRef] [Scilit]
- Mészáros, I.; Olasz, F.; Tamás, V.; Bálint, Á.; Zádori, Z. The biology of afrikan swine fever Literature review. Hung. Vet. J. 2019, 141, 55–62. [Google Scholar]
- Achenbach, J.E.; Gallardo, C.; Nieto-Pelegrín, E.; Rivera-Arroyo, B.; Degefa-Negi, T.; Arias, M.; Jenberie, S.; Mulisa, D.D.; Gizaw, D.; Gelaye, E.; et al. Identification of a new genotype of African swine fever virus in domestic pigs from Ethiopia. Transbound. Emerg. Dis. 2017, 64, 1393–1404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malogolovkin, A.; Burmakina, G.; Titov, I.; Sereda, A.; Gogin, A.; Baryshnikovam, E.; Kolbasov, D. Comparative analysis of African swine fever virus genotypes and serogroups. Emerg. Infect. Dis. 2015, a21, 312–315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallardo, C.; Fernandez-Pinero, J.; Pelayo, V.; Gazaev, I.; Markowska-Daniel, I.; Pridotkas, G.; Nieto, R.; Fernandez-Pacheco, P.; Bokhan, S.; Nevolko, O.; et al. Genetic variation among African swine fever genotype II viruses, eastern and central Europe. Emerg. Infect. Dis. 2014, 20, 1544–1547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olesen, A.S.; Lohse, L.; Dalgaard, M.D.; Wozniakowski, G.; Belsham, G.J.; Botner, A.; Rasmussen, T.B. Complete genome sequence of an African swine fever virus (ASFV POL/2015/Podlaskie) determined directly from pig erythrocyte-associated nucleic acid. J. Virol. Methods 2018, 261, 14–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arias, M.; de la Torre, A.; Dixon, L.; Gallardo, C.; Jori, F.; Laddomada, A.; Martins, C.; Parkhouse, R.M.; Revilla, Y.; Rodriguez, F.A.J.; et al. Approaches and Perspectives for Development of African Swine Fever Virus Vaccines. Vaccines 2017, 5, 35. [Google Scholar] [CrossRef] [Scilit]
- Rock, D.L. Challenges for African swine fever vaccine development-… perhaps the end of the beginning. Vet. Microbiol. 2017, 206, 52–58. [Google Scholar] [CrossRef] [Scilit]
- Benson, D.A.; Cavanaugh, M.; Clark, K.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res. 2013, 41, D36–D42. [Google Scholar] [CrossRef] [Scilit]
- Manual of diagnostic tests and vaccines for terrestrial animals Office International des Epizooties (Paris). Chapitre 3.8.1. Available online: http://www.oie.int/international-standard-setting/terrestrial-manual/access-online/ (accessed on 31 May 2019).
- Forth, J.H.; Tignon, M.; Cay, A.B.; Forth, L.F.; Höper, D.; Blome, S.; Beer, M. Comparative Analysis of Whole-Genome Sequence of African Swine Fever Virus Belgium 2018/1. Emerg. Infect. Dis. 2019, 25, 1249–1252. [Google Scholar] [CrossRef] [Scilit]
- Zani, L.; Forth, J.H.; Forth, L.; Nurmoja, I.; Leidenberger, S.; Henke, J.; Carlson, J.; Breidenstein, C.; Viltrop, A.; Höper, D.; et al. Deletion at the 5′-end of Estonian ASFV strains associated with an attenuated phenotype. Sci. Rep. 2018, 8, 6510. [Google Scholar] [CrossRef] [Scilit]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
- Kozlov, A.M.; Darriba, D.; Flouri, T.; Morel, B.; Stamatakis, A. RAxML-NG: A fast, scalable, and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 2019, 35, 4453–4455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. Trimal: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Darriba, D.; Posada, D.; Kozlov, A.M.; Stamatakis, A.; Morel, B.; Flouri, T. ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Biorxiv 2019, 612903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tavaré, S. Some probabilistic and statistical problems in the analysis of DNA sequences. Lectures Math. Life Sci. 1986, 17, 57–86. [Google Scholar]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Forth, J.H.; Forth, L.F.; King, J.; Groza, O.; Hübner, A.; Olesen, A.S.; Höper, D.; Dixon, L.K.; Netherton, C.L.; Rasmussen, T.B.; et al. Deep-Sequencing Workflow for the Fast and Efficient Generation of High-Quality African Swine Fever Virus Whole-Genome Sequences. Viruses 2019, 11, 846. [Google Scholar] [CrossRef] [Scilit]
- Bao, J.; Wang, Q.; Lin, P.; Liu, C.; Li, L.; Wu, X.; Chi, T.; Xu, T.; Ge, S.; Liu, Y.; et al. Genome comparison of African swine fever virus China/2018/AnhuiXCGQ strain and related European p72 Genotype II strains. Transbound. Emerg. Dis. 2019, 66, 1167–1176. [Google Scholar] [CrossRef] [Scilit]
- Chapman, D.A.; Darby, A.C.; Da Silva, M.; Upton, C.; Radford, A.D.; Dixon, L.K. Genomic analysis of highly virulent Georgia 2007/1 isolate of African swine fever virus. Emerg. Infect. Dis. 2011, 17, 599–605. [Google Scholar] [CrossRef] [Scilit]
- Bacciu, D.; Deligios, M.; Sanna, G.; Madrau, M.P.; Sanna, M.L.; Dei Giudici, S.; Oggiano, A. Genomic analysis of Sardinian 26544/OG10 isolate of African swine fever virus. Virol. Rep. 2016, 6, 81–89. [Google Scholar] [CrossRef] [Scilit]
- Mazur-Panasiuk, N.; Woźniakowski, G.; Niemczuk, K. The first complete genomic sequences of African swine fever virus isolated in Poland. Sci. Rep. 2019, 9, 4556. [Google Scholar] [CrossRef] [Scilit]
- Wen, X.; He, X.; Zhang, X.; Zhang, X.; Liu, L.; Guan, Y.; Zhang, Y.; Bu, Z. Genome sequences derived from pig and dried blood pig feed samples provide important insights into the transmission of African swine fever virus in China in 2018. Emerg. Microbes Infect. 2019, 8, 303–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bishop, R.P.; Fleischauer, C.; de Villiers, E.P.; Okoth, E.A.; Arias, M.; Gallardo, C.; Upton, C. Comparative analysis of the complete genome sequences of Kenyan African swine fever virus isolates within p72 genotypes IX and X. Virus Genes. 2015, 50, 303–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chapman, D.A.; Tcherepanov, V.; Upton, C.; Dixon, L.K. Comparison of the genome sequences of non-pathogenic and pathogenic African swine fever virus isolates. J. Gen. Virol. 2008, 89, 397–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiagen virotype ASFV PCR Kit Handbook. Available online: https://www.qiagen.com/gb/resources/resourcedetail?id=44c53965-e115-4065-8199-f35f0aeed805&lang=en (accessed on 2 November 2019).
- Prince, W.S.; Baker, D.L.; Dodge, A.H.; Ahmed, A.E.; Chestnut, R.W.; Sinicropi, D.V. Pharmacodynamics of recombinant human DNase I in serum. Clin. Exp. Immunol. 1998, 113, 289–296. [Google Scholar] [CrossRef] [Scilit]
- Kroll, M.H.; Elin, R.J. Relationships between magnesium and protein concentrations in serum. Clin. Chem. 1985, 31, 244–246. [Google Scholar]
- Roche High Pure Viral Nucleic Acid Kit user manual. Available online: https://pim-eservices.roche.com/LifeScience/Document/452cc82c-055e-e511-f1bd-00215a9b3428 (accessed on 2 November 2019).
- Vincent, A.T.; Derome, N.; Boyle, B.; Culley, A.I.; Charette, S.J. Next-generation sequencing (NGS) in the microbiological world: How to make the most of your money. J. Microbiol. Methods 2017, 138, 60–71. [Google Scholar] [CrossRef] [Scilit]





| Regions | Primers |
|---|---|
| 14067–14379 | >seqASF_14234-F CTGAGATAGCCAAATCAAAATAC |
| >seqASF_14234-R CGATTGTAAACTGTATAGTTAATCG | |
| 15551–15809 | >seqASFV_15670-F CAAAGCAGCCTGTATATGCAATACC |
| >seqASFV_15670-R CAATCATTCTATTGTAAACTGTAGAG | |
| 19845–20072 | >seqASFV_20022-F TAGTACATCAATGTTGTAAGTTTG |
| >seqASFV_20022-R CTATCTAAACGTGCTTCTATGAATTC |
| Method | Samples of ASFV_HUN_2018 | Viral Reads of the Total (%) | Number of Viral Reads | Mean Coverage | Std. Dev. |
|---|---|---|---|---|---|
| Ion PGM System | S43 | 90.4 | 179,325 | 197 | 129.1 |
| Ion PGM System | S41 | 87.7 | 152,865 | 158 | 106.5 |
| NextSeq Illumina | S1 | 50 | 6,835,057 | 2557 | 1624.9 |
| NextSeq Illumina | S20 | 77 | 7,115,377 | 2692 | 1897.6 |
| Differences between ASFV Belgium 2018/1 and ASFV_HUN_2018 | ||||
| Type | Mutation | Position | Localisation | Description of Differences |
| Indel | deletC | 1384. | non-coding region | |
| Indel | deletT | 2956. | non-coding region | |
| Indel | deletA | 12570. | ASFV G ACD 00190 CDS | The ASFV_HUN_2018 contains the “common version” of gene. The adenine insertion is unique in the ASFV Belgium 2018/1. |
| Indel | delet4C | 15670. | MGF 110-13L | The length of this cytosine rich region is variable among isolates. |
| Indel | delet2G | 17845. | non-coding region | |
| Indel | delet3G | 20001. | ASFV G ACD 00350 CDS | The length of this guanine rich region is variable among isolates. |
| Indel | deletG | 21799. | non-coding region | |
| Point mutation | T->C | 26419. | MGF 360-10L | N->S, This nucleotide position is variable among the isolates. |
| Indel | insT | 27422. | non-coding region | |
| Indel | insT | 73257. | non-coding region | |
| Point mutation | G->A | 88348. | C315R | V->I The “common version” of gene contains the codon of valine. The isoleucine is unique in the ASFV_HUN_2018. |
| Indel | insG | 103310. | non-coding region | |
| Point mutation | T->C | 109659. | B263R | This synonym nucleotide change is unique in the ASFV_HUN_2018. |
| Point mutation | A->G | 145065. | D117L | L->P The “common version” of gene contains codon of proline. This amino acid change is unique in the ASFV Belgium 2018/1. |
| Quasispecies | W (A/T) | 190462. | non-coding region | Coverage: 318 Adenine 58%; Thymine 42% |
| Quasispecies | S (C/G) | 190470. | non-coding region | Coverage: 298 Cytosine: 41%, Guanine 59% |
| Differences between China/2018/AnhuiXCGQ and ASFV_HUN_2018 | ||||
| Type | Mutation | Position | Localisation | Description of Differences |
| Indel | insA | 1063. | non-coding region | |
| Indel | insC | 1392. | non-coding region | |
| Indel | ins2C | 14235. | MGF 110-14L | The length of this cytosine rich region is variable among isolates. |
| Indel | ins4G | 17631. | non-coding region | |
| Indel | deletG | 17845. | non-coding region | |
| Indel | delet2G | 20001. | ASFV G ACD 00350 CDS | The length of this guanine rich region is variable among isolates. |
| Point mutation | G->A | 88348. | C315R | V->I The “common version” of gene contains the codon of valine. This amino acide is unique in the ASFV_HUN_2018. |
| Point mutation | T->C | 109659. | B263R | This synonym nucleotide change is unique in the ASFV_HUN_2018. |
| Point mutation | A->G | 129413. | O174L | S->P This amino acide change is unique in the China/2018/AnhuiXCGQ |
| Point mutation | A->G | 129517. | O174L | F->S This amino acide change is unique in the China/2018/AnhuiXCGQ |
| Point mutation | A->G | 129542 | O174L | S->P This amino acide change is unique in the China/2018/AnhuiXCGQ |
| Indel | insA | 190122. | DP60R | The length of this cytosine rich region is variable among isolates. |
| Quasispecies | W (A/T) | 190462. | non-coding region | Coverage: 318 Adenine 58%; Thymine 42% |
| Quasispecies | S (C/G) | 190470. | non-coding region | Coverage: 298 Cytosine: 41%, Guanine 59% |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Olasz, F.; Mészáros, I.; Marton, S.; Kaján, G.L.; Tamás, V.; Locsmándi, G.; Magyar, T.; Bálint, Á.; Bányai, K.; Zádori, Z. A Simple Method for Sample Preparation to Facilitate Efficient Whole-Genome Sequencing of African Swine Fever Virus. Viruses 2019, 11, 1129. https://doi.org/10.3390/v11121129
Olasz F, Mészáros I, Marton S, Kaján GL, Tamás V, Locsmándi G, Magyar T, Bálint Á, Bányai K, Zádori Z. A Simple Method for Sample Preparation to Facilitate Efficient Whole-Genome Sequencing of African Swine Fever Virus. Viruses. 2019; 11(12):1129. https://doi.org/10.3390/v11121129
Chicago/Turabian StyleOlasz, Ferenc, István Mészáros, Szilvia Marton, Győző L. Kaján, Vivien Tamás, Gabriella Locsmándi, Tibor Magyar, Ádám Bálint, Krisztián Bányai, and Zoltán Zádori. 2019. "A Simple Method for Sample Preparation to Facilitate Efficient Whole-Genome Sequencing of African Swine Fever Virus" Viruses 11, no. 12: 1129. https://doi.org/10.3390/v11121129
APA StyleOlasz, F., Mészáros, I., Marton, S., Kaján, G. L., Tamás, V., Locsmándi, G., Magyar, T., Bálint, Á., Bányai, K., & Zádori, Z. (2019). A Simple Method for Sample Preparation to Facilitate Efficient Whole-Genome Sequencing of African Swine Fever Virus. Viruses, 11(12), 1129. https://doi.org/10.3390/v11121129

