Efficient Expression and Processing of Ebola Virus Glycoprotein Induces Morphological Changes in BmN Cells but Cannot Rescue Deficiency of Bombyx Mori Nucleopolyhedrovirus GP64
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Line and Viruses
2.2. Gp64-Knockout Bacmid Construction
2.3. Generation of Recombinant Bacmids
2.4. Transfection and Infection of BmN Cells
2.5. GP1,2 Expression Analysis in BmN Cells
2.6. Immunofluorescence Analysis of GP1,2 Localization
2.7. Electron Microscope Analysis
3. Results
3.1. Construction of the gp64-Null Bacmid BmBac∆gp64 and Bacmids Harboring the Ebola GP1,2 Gene
3.2. EBOV-GP is Expressed and Cleaved in BmN Cells but Cannot Rescue GP64 Deficiency
3.3. The GP64 Signal Peptide Results in Ebola GP Localization to the Plasma Membrane of BmN Cells
3.4. GP Expression Causes Protrusion Formation Around BmN Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gire, S.K.; Goba, A.; Andersen, K.G.; Sealfon, R.S.; Park, D.J.; Kanneh, L.; Jalloh, S.; Momoh, M.; Fullah, M.; Dudas, G.; et al. Genomic surveillance elucidates ebola virus origin and transmission during the 2014 outbreak. Sciences 2014, 345, 1369–1372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez, A.; Kiley, M.P.; Holloway, B.P.; Auperin, D.D. Sequence analysis of the ebola virus genome: Organization, genetic elements, and comparison with the genome of marburg virus. Virus Res. 1993, 29, 215–240. [Google Scholar] [CrossRef] [Scilit]
- Volchkov, V.E.; Feldmann, H.; Volchkova, V.A.; Klenk, H.-D. Processing of the ebola virus glycoprotein by the proprotein convertase furin. Proc. Natl. Acad. Sci. USA 1998, 95, 5762–5767. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brecher, M.; Schornberg, K.L.; Delos, S.E.; Fusco, M.L.; Saphire, E.O.; White, J.M. Cathepsin cleavage potentiates the ebola virus glycoprotein to undergo a subsequent fusion-relevant conformational change. J. Virol. 2012, 86, 364–372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makino, A.; Kawaoka, Y. Generation of vero cells expressing ebola virus glycoprotein. J. Vet. Med. Sci. 2009, 71, 505–507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nieto-Gomez, R.; Angulo, C.; Monreal-Escalante, E.; Govea-Alonso, D.O.; De Groot, A.S.; Rosales-Mendoza, S. Design of a multiepitopic zaire ebolavirus protein and its expression in plant cells. J. Biotechnol. 2019, 295, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Papaneri, A.B.; Bernbaum, J.G.; Blaney, J.E.; Jahrling, P.B.; Schnell, M.J.; Johnson, R.F. Controlled viral glycoprotein expression as a safety feature in a bivalent rabies-ebola vaccine. Virus Res. 2015, 197, 54–58. [Google Scholar] [CrossRef] [Scilit]
- Volchkov, V.E.; Volchkova, V.A.; Slenczka, W.; Klenk, H.-D.; Feldmann, H. Release of viral glycoproteins during ebola virus infection. Virology 1998, 245, 110–119. [Google Scholar] [CrossRef] [Scilit]
- Alvarez, C.P.; Lasala, F.; Carrillo, J.; Muniz, O.; Corbi, A.L.; Delgado, R. C-type lectins dc-sign and l-sign mediate cellular entry by ebola virus in cis and in trans. J. Virol. 2002, 76, 6841–6844. [Google Scholar] [CrossRef] [Scilit]
- Takada, A.; Fujioka, K.; Tsuiji, M.; Morikawa, A.; Higashi, N.; Ebihara, H.; Kobasa, D.; Feldmann, H.; Irimura, T.; Kawaoka, Y. Human macrophage c-type lectin specific for galactose and n-acetylgalactosamine promotes filovirus entry. J. Virol. 2004, 78, 2943–2947. [Google Scholar] [CrossRef] [Scilit]
- Marzi, A.; Akhavan, A.; Simmons, G.; Gramberg, T.; Hofmann, H.; Bates, P.; Lingappa, V.R.; Pöhlmann, S. The signal peptide of the ebolavirus glycoprotein influences interaction with the cellular lectins dc-sign and dc-signr. J. Virol. 2006, 80, 6305–6317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, E.H.; Chandran, K. Filovirus entry into cells–new insights. Curr. Opin. Virol. 2012, 2, 206–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nanbo, A.; Imai, M.; Watanabe, S.; Noda, T.; Takahashi, K.; Neumann, G.; Halfmann, P.; Kawaoka, Y. Ebolavirus is internalized into host cells via macropinocytosis in a viral glycoprotein-dependent manner. PLoS Pathog. 2010, 6, e1001121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saeed, M.F.; Kolokoltsov, A.A.; Albrecht, T.; Davey, R.A. Cellular entry of ebola virus involves uptake by a macropinocytosis-like mechanism and subsequent trafficking through early and late endosomes. PLoS Pathog. 2010, 6, e1001110. [Google Scholar] [CrossRef] [Scilit]
- Carette, J.E.; Raaben, M.; Wong, A.C.; Herbert, A.S.; Obernosterer, G.; Mulherkar, N.; Kuehne, A.I.; Kranzusch, P.J.; Griffin, A.M.; Ruthel, G.; et al. Ebola virus entry requires the cholesterol transporter niemann-pick c1. Nature 2011, 477, 340–343. [Google Scholar] [CrossRef] [Scilit]
- Chandran, K.; Sullivan, N.J.; Felbor, U.; Whelan, S.P.; Cunningham, J.M. Endosomal proteolysis of the ebola virus glycoprotein is necessary for infection. Sciences 2005, 308, 1643–1645. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Hao, B.; Cheng, C.; Liang, F.; Shen, X.; Cheng, X. Entry of bombyx mori nucleopolyhedrovirus into bmn cells by cholesterol-dependent macropinocytic endocytosis. Biochem. Biophys. Res. Commun. 2014, 453, 166–171. [Google Scholar] [CrossRef] [Scilit]
- Racoosin, E.L.; Swanson, J.A. Macropinosome maturation and fusion with tubular lysosomes in macrophages. J. Cell. Biol. 1993, 121, 1011–1020. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Li, C.; Tang, X.; Liu, L.; Nan, W.; Shen, X.; Hao, B. Transport via macropinocytic vesicles is crucial for productive infection with bombyx mori nucleopolyhedrovirus. Viruses 2019, 11, 668. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; Hao, B.; Sun, X.; Deng, F.; Wang, H.; Hu, Z. Construction of the bac-to-bac system of bombyx mori nucleopolyhedroviru. Virol. Sin. 2007, 22, 218. [Google Scholar]
- Huang, J.; Hao, B.; Deng, F.; Sun, X.; Wang, H.; Hu, Z. Open reading frame bm21 of bombyx mori nucleopolyhedrovirus is not essential for virus replication in vitro, but its deletion extends the median survival time of infected larvae. J. Gen. Virol. 2008, 89, 922–930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Francica, J.R.; Varela-Rohena, A.; Medvec, A.; Plesa, G.; Riley, J.L.; Bates, P. Steric shielding of surface epitopes and impaired immune recognition induced by the ebola virus glycoprotein. PLoS Pathog. 2010, 6, e1001098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sullivan, N.J.; Peterson, M.; Yang, Z.Y.; Kong, W.P.; Duckers, H.; Nabel, E.; Nabel, G.J. Ebola virus glycoprotein toxicity is mediated by a dynamin-dependent protein-trafficking pathway. J. Virol. 2005, 79, 547–553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Francica, J.R.; Matukonis, M.K.; Bates, P. Requirements for cell rounding and surface protein down-regulation by ebola virus glycoprotein. Virology 2009, 383, 237–247. [Google Scholar] [CrossRef] [Scilit]
- Ye, L.; Lin, J.; Sun, Y.; Bennouna, S.; Lo, M.; Wu, Q.; Bu, Z.; Pulendran, B.; Compans, R.W.; Yang, C. Ebola virus-like particles produced in insect cells exhibit dendritic cell stimulating activity and induce neutralizing antibodies. Virology 2006, 351, 260–270. [Google Scholar] [CrossRef] [Scilit]
- Pallesen, J.; Murin, C.D.; de Val, N.; Cottrell, C.A.; Hastie, K.M.; Turner, H.L.; Fusco, M.L.; Flyak, A.I.; Zeitlin, L.; Crowe, J.E., Jr.; et al. Structures of ebola virus gp and sgp in complex with therapeutic antibodies. Nat. Microbiol. 2016, 1, 16128. [Google Scholar] [CrossRef] [Scilit]
- Lennemann, N.J.; Herbert, A.S.; Brouillette, R.; Rhein, B.; Bakken, R.A.; Perschbacher, K.J.; Cooney, A.L.; Miller-Hunt, C.L.; Ten Eyck, P.; Biggins, J.; et al. Vesicular stomatitis virus pseudotyped with ebola virus glycoprotein serves as a protective, noninfectious vaccine against ebola virus challenge in mice. J. Virol. 2017, 91, e00479-17. [Google Scholar] [CrossRef] [Scilit]
- Bergren, N.A.; Miller, M.R.; Monath, T.P.; Kading, R.C. Assessment of the ability of v920 recombinant vesicular stomatitis-zaire ebolavirus vaccine to replicate in relevant arthropod cell cultures and vector species. Hum. Vac. Immunother. 2018, 14, 994–1002. [Google Scholar] [CrossRef] [Scilit]
- Aviles, J.; Bello, A.; Wong, G.; Fausther-Bovendo, H.; Qiu, X.; Kobinger, G. Optimization of prime-boost vaccination strategies against mouse-adapted ebolavirus in a short-term protection study. J. Infect. Dis. 2015, 212 (Suppl. 2), S389–S397. [Google Scholar] [CrossRef] [Scilit]
- Xiao, J.H.; Rijal, P.; Schimanski, L.; Tharkeshwar, A.K.; Wright, E.; Annaert, W.; Townsend, A. Characterization of influenza virus pseudotyped with ebolavirus glycoprotein. J. Virol. 2018, 92, e00941-17. [Google Scholar] [CrossRef] [Scilit]
- Yonezawa, A.; Cavrois, M.; Greene, W.C. Studies of ebola virus glycoprotein-mediated entry and fusion by using pseudotyped human immunodeficiency virus type 1 virions: Involvement of cytoskeletal proteins and enhancement by tumor necrosis factor alpha. J. Virol. 2005, 79, 918–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suder, E.; Furuyama, W.; Feldmann, H.; Marzi, A.; de Wit, E. The vesicular stomatitis virus-based ebola virus vaccine: From concept to clinical trials. Hum. Vac. Immunother. 2018, 14, 2107–2113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monath, T.P.; Fast, P.E.; Modjarrad, K.; Clarke, D.K.; Martin, B.K.; Fusco, J.; Nichols, R.; Heppner, D.G.; Simon, J.K.; Dubey, S.; et al. Rvsvdeltag-zebov-gp (also designated v920) recombinant vesicular stomatitis virus pseudotyped with ebola zaire glycoprotein: Standardized template with key considerations for a risk/benefit assessment. Vac. X 2019, 1, 100009. [Google Scholar]
- Sun, C.; Zhang, Y.; Feng, L.; Pan, W.; Zhang, M.; Hong, Z.; Ma, X.; Chen, X.; Chen, L. Epidemiology of adenovirus type 5 neutralizing antibodies in healthy people and aids patients in guangzhou, southern china. Vaccine 2011, 29, 3837–3841. [Google Scholar] [CrossRef] [Scilit]
- Nwanegbo, E.; Vardas, E.; Gao, W.; Whittle, H.; Sun, H.; Rowe, D.; Robbins, P.D.; Gambotto, A. Prevalence of neutralizing antibodies to adenoviral serotypes 5 and 35 in the adult populations of the gambia, south africa, and the united states. Clin. Diagn. Lab. Immunol. 2004, 11, 351–357. [Google Scholar] [CrossRef] [Scilit]
- Russo, S.; Montermini, L.; Berkovitz-Siman-Tov, R.; Ponti, W.; Poli, G. Expression of bovine leukemia virus env glycoprotein in insect cells by recombinant baculovirus. FEBS Lett. 1998, 436, 11–16. [Google Scholar] [CrossRef] [Scilit]




| Primers | Sequence (5′–3′, Restriction Endonuclease Site Underlined) |
|---|---|
| Upstream arm | AACAAAAAAGCAATCTCATAACCACCATGGAGAACACCAAGTTTGGCGGCGCACCAATAACTGCCTTAA |
| Downstream arm | CTATACAATTTTTTTTATTACAAATAATGATACAATTTTTATTATTACATCTGTCCTTCCTGTGCGA |
| GP64UP | CGCGAATTCGACAGATATTTAAATAAACCAAAC |
| CmRP | CTGTCCTTCCTGTGCGA |
| PGP64-F: | GGCAGGCCTGACAGATATTTAAATAAGCCAAAC (StuI) |
| PGP64-R | CGCTCTAGATGAGGCATCTTATATACCCGA (XbaI) |
| GP1,2 F | CGCTCTAGAATGGGCGTTACAGGAATATTG (XbaI) |
| GP1,2 no SP F | GGCTCTAGACCACTTGGAGTCATCCACAAT (XbaI) |
| GP1,2 R | CCCAAGCTTCTAAAAGACAAATTTGCATAT (HindIII) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Liu, N.; Xu, F.; Ayepa, E.; Amanze, C.; Sun, L.; Shen, Y.; Yang, M.; Yang, S.; Shen, X.; et al. Efficient Expression and Processing of Ebola Virus Glycoprotein Induces Morphological Changes in BmN Cells but Cannot Rescue Deficiency of Bombyx Mori Nucleopolyhedrovirus GP64. Viruses 2019, 11, 1067. https://doi.org/10.3390/v11111067
Huang J, Liu N, Xu F, Ayepa E, Amanze C, Sun L, Shen Y, Yang M, Yang S, Shen X, et al. Efficient Expression and Processing of Ebola Virus Glycoprotein Induces Morphological Changes in BmN Cells but Cannot Rescue Deficiency of Bombyx Mori Nucleopolyhedrovirus GP64. Viruses. 2019; 11(11):1067. https://doi.org/10.3390/v11111067
Chicago/Turabian StyleHuang, Jinshan, Na Liu, Fanbo Xu, Ellen Ayepa, Charles Amanze, Luping Sun, Yaqin Shen, Miao Yang, Shuwen Yang, Xingjia Shen, and et al. 2019. "Efficient Expression and Processing of Ebola Virus Glycoprotein Induces Morphological Changes in BmN Cells but Cannot Rescue Deficiency of Bombyx Mori Nucleopolyhedrovirus GP64" Viruses 11, no. 11: 1067. https://doi.org/10.3390/v11111067
APA StyleHuang, J., Liu, N., Xu, F., Ayepa, E., Amanze, C., Sun, L., Shen, Y., Yang, M., Yang, S., Shen, X., & Hao, B. (2019). Efficient Expression and Processing of Ebola Virus Glycoprotein Induces Morphological Changes in BmN Cells but Cannot Rescue Deficiency of Bombyx Mori Nucleopolyhedrovirus GP64. Viruses, 11(11), 1067. https://doi.org/10.3390/v11111067

