HSV as A Platform for the Generation of Retargeted, Armed, and Reporter-Expressing Oncolytic Viruses
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Plasmids
2.3. Engineering of the Recombinant HSVs
2.3.1. Structure of the HSV Backbone
2.3.2. Mutagenesis of gB
2.3.3. Insertion of mIL12 Cassette
2.3.4. Production of Recombinant Viruses
2.4. Viral Tropism
2.5. Virus Growth
2.6. Viral Spread Assay
2.7. Cytotoxicity Assay
2.8. ELISA for mIL12
2.9. GLuc Assay
3. Results
3.1. Construction of Cell Lines Expressing the Targeted Receptors PSMA, EGFRvIII and EGFR
3.2. The PSMA-Retargeted R-593
3.3. The EGFRvIII-Retargeted R-613
3.4. The EGFR-Retargeted R-611
3.5. The Insertion of the scFvs to PSMA, EGFRvIII, or EGFR in the Backbone of R-LM249 Failed to Generate Viable Recombinants
3.6. R-291 Carries Mutations in gB Which Increase the Spread in Murine Cells
3.7. A Novel Insertion Site for Expression of the Heterologous mIL12 Gene
3.8. Detection of Viral Replication through Expression of the Gaussia Luciferase (GLuc) Reporter
4. Discussion
4.1. Platform to Engineer Novel Retargeted HSVs
4.2. Effects of Mutations in gB on Cell-to Cell Spread of Retargeted o-HSVs
4.3. Functional Insertion of Transgenes in HSV Genome
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Filley, A.C.; Dey, M. Immune System, Friend or Foe of Oncolytic Virotherapy? Front Oncol. 2017, 7, 106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cassady, K.A.; Haworth, K.B.; Jackson, J.; Markert, J.M.; Cripe, T.P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses 2016, 8, 43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bartlett, D.L.; Liu, Z.; Sathaiah, M.; Ravindranathan, R.; Guo, Z.; He, Y.; Guo, Z.S. Oncolytic viruses as therapeutic cancer vaccines. Mol. Cancer 2013, 12, 103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, P.; Hu-Lieskovan, S.; Wargo, J.A.; Ribas, A. Primary, Adaptive, and Acquired Resistance to Cancer Immunotherapy. Cell 2017, 168, 707–723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamid, O.; Hoffner, B.; Gasal, E.; Hong, J.; Carvajal, R.D. Oncolytic immunotherapy: Unlocking the potential of viruses to help target cancer. Cancer Immunol. Immunother. 2017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keller, B.A.; Bell, J.C. Oncolytic viruses-immunotherapeutics on the rise. J. Mol. Med. 2016, 94, 979–991. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campadelli-Fiume, G.; De Giovanni, C.; Gatta, V.; Nanni, P.; Lollini, P.L.; Menotti, L. Rethinking herpes simplex virus: The way to oncolytic agents. Rev. Med. Virol. 2011, 21, 213–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cattaneo, R.; Miest, T.; Shashkova, E.V.; Barry, M.A. Reprogrammed viruses as cancer therapeutics: Targeted, armed and shielded. Nat. Rev. Microbiol. 2008, 6, 529–540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miest, T.S.; Cattaneo, R. New viruses for cancer therapy: Meeting clinical needs. Nat. Rev. Microbiol. 2014, 12, 23–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Russell, S.J.; Peng, K.W.; Bell, J.C. Oncolytic virotherapy. Nat. Biotechnol. 2012, 30, 658–670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cattaneo, R.; Russell, S.J. How to develop viruses into anticancer weapons. PLoS Pathog. 2017, 13, e1006190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B.L.; Robinson, M.; Han, Z.Q.; Branston, R.H.; English, C.; Reay, P.; McGrath, Y.; Thomas, S.K.; Thornton, M.; Bullock, P.; et al. ICP34.5 deleted herpes simplex virus with enhanced oncolytic, immune stimulating, and anti-tumour properties. Gene Ther. 2003, 10, 292–303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andtbacka, R.H.; Kaufman, H.L.; Collichio, F.; Amatruda, T.; Senzer, N.; Chesney, J.; Delman, K.A.; Spitler, L.E.; Puzanov, I.; Agarwala, S.S.; et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. J. Clin. Oncol. 2015, 33, 2780–2788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ledford, H. Cancer-fighting viruses win approval. Nature 2015, 526, 622–623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, J.C.; Coffin, R.S.; Davis, C.J.; Graham, N.J.; Groves, N.; Guest, P.J.; Harrington, K.J.; James, N.D.; Love, C.A.; McNeish, I.; et al. A phase I study of OncoVEXGM-CSF, a second-generation oncolytic herpes simplex virus expressing granulocyte macrophage colony-stimulating factor. Clin. Cancer Res. 2006, 12, 6737–6747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaufman, H.L.; Amatruda, T.; Reid, T.; Gonzalez, R.; Glaspy, J.; Whitman, E.; Harrington, K.; Nemunaitis, J.; Zloza, A.; Wolf, M.; et al. Systemic versus local responses in melanoma patients treated with talimogene laherparepvec from a multi-institutional phase II study. J. Immunother. Cancer 2016, 4, 12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaufman, H.L.; Bines, S.D. OPTIM trial: A Phase III trial of an oncolytic herpes virus encoding GM-CSF for unresectable stage III or IV melanoma. Future Oncol. 2010, 6, 941–949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Geevarghese, S.K.; Geller, D.A.; de Haan, H.A.; Horer, M.; Knoll, A.E.; Mescheder, A.; Nemunaitis, J.; Reid, T.R.; Sze, D.Y.; Tanabe, K.K.; et al. Phase I/II study of oncolytic herpes simplex virus NV1020 in patients with extensively pretreated refractory colorectal cancer metastatic to the liver. Hum. Gene Ther. 2010, 21, 1119–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrington, K.J.; Hingorani, M.; Tanay, M.A.; Hickey, J.; Bhide, S.A.; Clarke, P.M.; Renouf, L.C.; Thway, K.; Sibtain, A.; McNeish, I.A.; et al. Phase I/II study of oncolytic HSV GM-CSF in combination with radiotherapy and cisplatin in untreated stage III/IV squamous cell cancer of the head and neck. Clin. Cancer Res. 2010, 16, 4005–4015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goins, W.F.; Krisky, D.M.; Wechuck, J.B.; Huang, S.; Glorioso, J.C. Construction and production of recombinant herpes simplex virus vectors. Methods Mol. Biol. 2008, 433, 97–113. [Google Scholar] [PubMed]
- Kemeny, N.; Brown, K.; Covey, A.; Kim, T.; Bhargava, A.; Brody, L.; Guilfoyle, B.; Haag, N.P.; Karrasch, M.; Glasschroeder, B.; et al. Phase I, open-label, dose-escalating study of a genetically engineered herpes simplex virus, NV1020, in subjects with metastatic colorectal carcinoma to the liver. Hum. Gene Ther. 2006, 17, 1214–1224. [Google Scholar] [PubMed]
- Wang, P.Y.; Swain, H.M.; Kunkler, A.L.; Chen, C.Y.; Hutzen, B.J.; Arnold, M.A.; Streby, K.A.; Collins, M.H.; Dipasquale, B.; Stanek, J.R.; et al. Neuroblastomas vary widely in their sensitivities to herpes simplex virotherapy unrelated to virus receptors and susceptibility. Gene Ther. 2016, 23, 135–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, G.; Roizman, B. Characterization of a recombinant herpes simplex virus 1 designed to enter cells via the IL13Ralpha2 receptor of malignant glioma cells. J. Virol. 2005, 79, 5272–5277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, G.; Roizman, B. Construction and properties of a herpes simplex virus 1 designed to enter cells solely via the IL-13alpha2 receptor. Proc. Natl. Acad. Sci. USA 2006, 103, 5508–5513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamiyama, H.; Zhou, G.; Roizman, B. Herpes simplex virus 1 recombinant virions exhibiting the amino terminal fragment of urokinase-type plasminogen activator can enter cells via the cognate receptor. Gene Ther. 2006, 13, 621–629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menotti, L.; Cerretani, A.; Campadelli-Fiume, G. A herpes simplex virus recombinant that exhibits a single-chain antibody to HER2/neu enters cells through the mammary tumor receptor, independently of the gD receptors. J. Virol. 2006, 80, 5531–5539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menotti, L.; Cerretani, A.; Hengel, H.; Campadelli-Fiume, G. Construction of a fully retargeted herpes simplex virus 1 recombinant capable of entering cells solely via human epidermal growth factor receptor 2. J. Virol. 2008, 20, 10153–10161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menotti, L.; Nicoletti, G.; Gatta, V.; Croci, S.; Landuzzi, L.; De Giovanni, C.; Nanni, P.; Lollini, P.L.; Campadelli-Fiume, G. Inhibition of human tumor growth in mice by an oncolytic herpes simplex virus designed to target solely HER-2-positive cells. Proc. Natl. Acad. Sci. USA 2009, 106, 9039–9044. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uchida, H.; Marzulli, M.; Nakano, K.; Goins, W.F.; Chan, J.; Hong, C.S.; Mazzacurati, L.; Yoo, J.Y.; Haseley, A.; Nakashima, H.; et al. Effective treatment of an orthotopic xenograft model of human glioblastoma using an EGFR-retargeted oncolytic herpes simplex virus. Mol. Ther. 2013, 21, 561–569. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campadelli-Fiume, G.; Petrovic, B.; Leoni, V.; Gianni, T.; Avitabile, E.; Casiraghi, C.; Gatta, V. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses 2016, 8, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambini, E.; Reisoli, E.; Appolloni, I.; Gatta, V.; Campadelli-Fiume, G.; Menotti, L.; Malatesta, P. Replication-competent herpes simplex virus retargeted to HER2 as therapy for high-grade glioma. Mol. Ther. 2012, 20, 994–1001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reisoli, E.; Gambini, E.; Appolloni, I.; Gatta, V.; Barilari, M.; Menotti, L.; Malatesta, P. Efficacy of HER2 retargeted herpes simplex virus as therapy for high-grade glioma in immunocompetent mice. Cancer Gene Ther. 2012, 19, 788–795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nanni, P.; Gatta, V.; Menotti, L.; De Giovanni, C.; Ianzano, M.; Palladini, A.; Grosso, V.; Dall’ora, M.; Croci, S.; Nicoletti, G.; et al. Preclinical Therapy of Disseminated HER-2(+) Ovarian and Breast Carcinomas with a HER-2-Retargeted Oncolytic Herpesvirus. PLoS Pathog. 2013, 9, e1003155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leoni, V.; Gatta, V.; Palladini, A.; Nicoletti, G.; Ranieri, D.; Dall’Ora, M.; Grosso, V.; Rossi, M.; Alviano, F.; Bonsi, L.; et al. Systemic delivery of HER2-retargeted oncolytic-HSV by mesenchymal stromal cells protects from lung and brain metastases. Oncotarget 2015, 6, 34774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gatta, V.; Petrovic, B.; Campadelli-Fiume, G. The Engineering of a Novel Ligand in gH Confers to HSV an Expanded Tropism Independent of gD Activation by Its Receptors. PLoS Pathog. 2015, 11, e1004907. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petrovic, B.; Gianni, T.; Gatta, V.; Campadelli-Fiume, G. Insertion of a ligand to HER2 in gB retargets HSV tropism and obviates the need for activation of the other entry glycoproteins. PLoS Pathog. 2017, 13, e1006352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leoni, V.; Gatta, V.; Casiraghi, C.; Nicosia, A.; Petrovic, B.; Campadelli-Fiume, G. A Strategy for Cultivation of Retargeted Oncolytic Herpes Simplex Viruses in Non-cancer Cells. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leoni, V.; Petrovic, B.; Gianni, T.; Gatta, V.; Campadelli-Fiume, G. The simultaneous insertion of two ligands in gD for the cultivation of oncolytic HSVs in non-cancer cells and the retargeting to cancer receptors. J. Virol. 2017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petrovic, B.; Leoni, V.; Gatta, V.; Zaghini, A.; Vannini, A.; Campadelli-Fiume, G. Dual ligand insertion in gB and in gD of oncolytic HSVs for the retargeting to a producer Vero cell line and to cancer cells. J. Virol. 2017. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.Y.; Bu, L.X.; DeBenedetti, A.; Williams, B.J.; Rennie, P.S.; Jia, W.W. Transcriptional and translational dual-regulated oncolytic herpes simplex virus type 1 for targeting prostate tumors. Mol. Ther. 2010, 18, 929–935. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazzacurati, L.; Marzulli, M.; Reinhart, B.; Miyagawa, Y.; Uchida, H.; Goins, W.F.; Li, A.; Kaur, B.; Caligiuri, M.; Cripe, T.; et al. Use of miRNA response sequences to block off-target replication and increase the safety of an unattenuated, glioblastoma-targeted oncolytic HSV. Mol. Ther. 2015, 23, 99–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anastasiadou, E.; Garg, N.; Bigi, R.; Yadav, S.; Campese, A.F.; Lapenta, C.; Spada, M.; Cuomo, L.; Botta, A.; Belardelli, F.; et al. Epstein-Barr virus infection induces miR-21 in terminally differentiated malignant B cells. Int. J. Cancer 2015, 137, 1491–1497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, G.; Galvan, V.; Campadelli-Fiume, G.; Roizman, B. Glycoprotein D or J delivered in trans blocks apoptosis in SK-N-SH cells induced by a herpes simplex virus 1 mutant lacking intact genes expressing both glycoproteins. J. Virol. 2000, 74, 11782–11791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ricci, C.; Landuzzi, L.; Rossi, I.; De Giovanni, C.; Nicoletti, G.; Astolfi, A.; Pupa, S.; Menard, S.; Scotlandi, K.; Nanni, P.; et al. Expression of HER/erbB family of receptor tyrosine kinases and induction of differentiation by glial growth factor 2 in human rhabdomyosarcoma cells. Int. J. Cancer 2000, 87, 29–36. [Google Scholar] [CrossRef]
- Banelli, B.; Carra, E.; Barbieri, F.; Wurth, R.; Parodi, F.; Pattarozzi, A.; Carosio, R.; Forlani, A.; Allemanni, G.; Marubbi, D.; et al. The histone demethylase KDM5A is a key factor for the resistance to temozolomide in glioblastoma. Cell Cycle 2015, 14, 3418–3429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakamura, T.; Peng, K.W.; Harvey, M.; Greiner, S.; Lorimer, I.A.; James, C.D.; Russell, S.J. Rescue and propagation of fully retargeted oncolytic measles viruses. Nat. Biotechnol. 2005, 23, 209–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cocchi, F.; Menotti, L.; Mirandola, P.; Lopez, M.; Campadelli-Fiume, G. The ectodomain of a novel member of the immunoglobulin subfamily related to the poliovirus receptor has the attributes of a bona fide receptor for herpes simplex virus types 1 and 2 in human cells. J. Virol. 1998, 72, 9992–10002. [Google Scholar] [PubMed]
- Leoni, V.; Vannini, A.; Gatta, V.; Rambaldi, J.; Sanapo, M.; Zaghini, A.; Lollini, P.-L.; Nanni, P.; Casiraghi, C.; Campadelli-Fiume, G. A retargeted fully-virulent oncolytic HSV armed with IL-12 elicits local immunity and vaccine therapy towards distant tumors. PLoS Pathog. 2018. submitted. [Google Scholar]
- Ejercito, P.M.; Kieff, E.D.; Roizman, B. Characterization of herpes simplex virus strains differing in their effects on social behaviour of infected cells. J. Gen. Virol. 1968, 2, 357–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanaka, M.; Kagawa, H.; Yamanashi, Y.; Sata, T.; Kawaguchi, Y. Construction of an excisable bacterial artificial chromosome containing a full-length infectious clone of herpes simplex virus type 1: Viruses reconstituted from the clone exhibit wild-type properties in vitro and in vivo. J. Virol. 2003, 77, 1382–1391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horoszewicz, J.S.; Leong, S.S.; Chu, T.M.; Wajsman, Z.L.; Friedman, M.; Papsidero, L.; Kim, U.; Chai, L.S.; Kakati, S.; Arya, S.K.; et al. The LNCaP cell line—A new model for studies on human prostatic carcinoma. Prog. Clin. Biol. Res. 1980, 37, 115–132. [Google Scholar] [PubMed]
- Cailleau, R.; Young, R.; Olive, M.; Reeves, W.J., Jr. Breast tumor cell lines from pleural effusions. J. Natl. Cancer Inst. 1974, 53, 661–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghosh, A.; Wang, X.; Klein, E.; Heston, W.D. Novel role of prostate-specific membrane antigen in suppressing prostate cancer invasiveness. Cancer Res. 2005, 65, 727–731. [Google Scholar] [PubMed]
- Fogh, J.; Wright, W.C.; Loveless, J.D. Absence of HeLa cell contamination in 169 cell lines derived from human tumors. J. Natl. Cancer Inst. 1977, 58, 209–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ponten, J.; Macintyre, E.H. Long term culture of normal and neoplastic human glia. Acta Pathol. Microbiol. Scand. 1968, 74, 465–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Greenberg, N.M. Transgenic models for prostate cancer research. Urol. Oncol. 1996, 2, 119–122. [Google Scholar] [CrossRef] [Scilit]
- Lorimer, I.A.; Lavictoire, S.J. Targeting retrovirus to cancer cells expressing a mutant EGF receptor by insertion of a single chain antibody variable domain in the envelope glycoprotein receptor binding lobe. J. Immunol. Methods 2000, 237, 147–157. [Google Scholar] [CrossRef] [Scilit]
- Warming, S.; Costantino, N.; Court, D.L.; Jenkins, N.A.; Copeland, N.G. Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 2005, 33, e36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uchida, H.; Chan, J.; Goins, W.F.; Grandi, P.; Kumagai, I.; Cohen, J.B.; Glorioso, J.C. A double mutation in glycoprotein gB compensates for ineffective gD-dependent initiation of herpes simplex virus type 1 infection. J. Virol. 2010, 84, 12200–12209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brunetti, C.R.; Burke, R.L.; Hoflack, B.; Ludwig, T.; Dingwell, K.S.; Johnson, D.C. Role of mannose-6-phosphate receptors in herpes simplex virus entry into cells and cell-to-cell transmission. J. Virol. 1995, 69, 3517–3528. [Google Scholar] [PubMed]
- Chang, S.S.; Gaudin, P.B.; Reuter, V.E.; O’Keefe, D.S.; Bacich, D.J.; Heston, W.D. Prostate-Specific Membrane Antigen: Much More Than a Prostate Cancer Marker. Mol. Urol. 1999, 3, 313–320. [Google Scholar] [PubMed]
- Cocchi, F.; Menotti, L.; Di Ninni, V.; Lopez, M.; Campadelli-Fiume, G. The herpes simplex virus JMP mutant enters receptor-negative J cells through a novel pathway independent of the known receptors nectin1, HveA, and nectin2. J. Virol. 2004, 78, 4720–4729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez, C. Genetics of natural resistance to herpesvirus infections in mice. Nature 1975, 258, 152–153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moesta, A.K.; Cooke, K.; Piasecki, J.; Mitchell, P.; Rottman, J.B.; Fitzgerald, K.; Zhan, J.; Yang, B.; Le, T.; Belmontes, B.; et al. Local Delivery of OncoVEXmGM-CSF Generates Systemic Antitumor Immune Responses Enhanced by Cytotoxic T-Lymphocyte-Associated Protein Blockade. Clin. Cancer Res. 2017, 23, 6190–6202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hutzen, B.; Chen, C.Y.; Wang, P.Y.; Sprague, L.; Swain, H.M.; Love, J.; Conner, J.; Boon, L.; Cripe, T.P. TGF-beta Inhibition Improves Oncolytic Herpes Viroimmunotherapy in Murine Models of Rhabdomyosarcoma. Mol. Ther. Oncolytics 2017, 7, 17–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gan, H.K.; Kaye, A.H.; Luwor, R.B. The EGFRvIII variant in glioblastoma multiforme. J. Clin. Neurosci. 2009, 16, 748–754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sugawa, N.; Ekstrand, A.J.; James, C.D.; Collins, V.P. Identical splicing of aberrant epidermal growth factor receptor transcripts from amplified rearranged genes in human glioblastomas. Proc. Natl. Acad. Sci. USA 1990, 87, 8602–8606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pedersen, M.W.; Meltorn, M.; Damstrup, L.; Poulsen, H.S. The type III epidermal growth factor receptor mutation. Biological significance and potential target for anti-cancer therapy. Ann. Oncol. 2001, 12, 745–760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holbro, T.; Hynes, N.E. ErbB receptors: Directing key signaling networks throughout life. Annu. Rev. Pharmacol. Toxicol. 2004, 44, 195–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gottschalk, N.; Kimmig, R.; Lang, S.; Singh, M.; Brandau, S. Anti-epidermal growth factor receptor (EGFR) antibodies overcome resistance of ovarian cancer cells to targeted therapy and natural cytotoxicity. Int. J. Mol. Sci. 2012, 13, 12000–12016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kao, J.; Salari, K.; Bocanegra, M.; Choi, Y.L.; Girard, L.; Gandhi, J.; Kwei, K.A.; Hernandez-Boussard, T.; Wang, P.; Gazdar, A.F.; et al. Molecular profiling of breast cancer cell lines defines relevant tumor models and provides a resource for cancer gene discovery. PLoS ONE 2009, 4, e6146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trinchieri, G. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 2003, 3, 133–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hellums, E.K.; Markert, J.M.; Parker, J.N.; He, B.; Perbal, B.; Roizman, B.; Whitley, R.J.; Langford, C.P.; Bharara, S.; Gillespie, G.Y. Increased efficacy of an interleukin-12-secreting herpes simplex virus in a syngeneic intracranial murine glioma model. Neuro-Oncology 2005, 7, 213–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Whitley, R.J.; Markert, J.M. Viral therapy of glioblastoma multiforme. Proc. Natl. Acad. Sci. USA 2013, 110, 11672–11673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, W.; Fulci, G.; Wakimoto, H.; Cheema, T.A.; Buhrman, J.S.; Jeyaretna, D.S.; Stemmer Rachamimov, A.O.; Rabkin, S.D.; Martuza, R.L. Combination of oncolytic herpes simplex viruses armed with angiostatin and IL-12 enhances antitumor efficacy in human glioblastoma models. Neoplasia 2013, 15, 591–599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veinalde, R.; Grossardt, C.; Hartmann, L.; Bourgeois-Daigneault, M.; Bell, J.; D, J.; von Kalle, C.; Ungerechts, G.; Engeland, C. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology 2017, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toda, M.; Martuza, R.L.; Kojima, H.; Rabkin, S.D. In situ cancer vaccination: An IL-12 defective vector/replication-competent herpes simplex virus combination induces local and systemic antitumor activity. J. Immunol. 1998, 160, 4457–4464. [Google Scholar] [PubMed]
- Thomas, E.D.; Meza-Perez, S.; Bevis, K.S.; Randall, T.D.; Gillespie, G.Y.; Langford, C.; Alvarez, R.D. IL-12 Expressing oncolytic herpes simplex virus promotes anti-tumor activity and immunologic control of metastatic ovarian cancer in mice. J. Ovarian Res. 2016, 9, 70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cody, J.J.; Scaturro, P.; Cantor, A.B.; Yancey Gillespie, G.; Parker, J.N.; Markert, J.M. Preclinical evaluation of oncolytic deltagamma(1)34.5 herpes simplex virus expressing interleukin-12 for therapy of breast cancer brain metastases. Int. J. Breast Cancer 2012, 2012, 628697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, D.M.; Foreman, P.M.; Nabors, L.B.; Riley, K.O.; Gillespie, G.Y.; Markert, J.M. Design of a Phase I Clinical Trial to Evaluate M032, a Genetically Engineered HSV-1 Expressing IL-12, in Patients with Recurrent/Progressive Glioblastoma Multiforme, Anaplastic Astrocytoma, or Gliosarcoma. Hum. Gene Ther. Clin. Dev. 2016, 27, 69–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zawatzky, R.; Gresser, I.; DeMaeyer, E.; Kirchner, H. The role of interferon in the resistance of C57BL/6 mice to various doses of herpes simplex virus type 1. J. Infect. Dis. 1982, 146, 405–410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, J.F.; Qi, W.X.; Liu, M.Y.; Li, Y. The combination of NK and CD8+T cells with CCL20/IL15-armed oncolytic adenoviruses enhances the growth suppression of TERT-positive tumor cells. Cell. Immunol. 2017, 318, 35–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaston, D.C.; Odom, C.I.; Li, L.; Markert, J.M.; Roth, J.C.; Cassady, K.A.; Whitley, R.J.; Parker, J.N. Production of bioactive soluble interleukin-15 in complex with interleukin-15 receptor alpha from a conditionally-replicating oncolytic HSV-1. PLoS ONE 2013, 8, e81768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.H.; Zhang, S.N.; Choi, K.J.; Choi, I.K.; Kim, J.H.; Lee, M.G.; Kim, H.; Yun, C.O. Therapeutic and tumor-specific immunity induced by combination of dendritic cells and oncolytic adenovirus expressing IL-12 and 4-1BBL. Mol. Ther. 2010, 18, 264–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.S.; Kim-Schulze, S.; Kim, D.W.; Kaufman, H.L. Host lymphodepletion enhances the therapeutic activity of an oncolytic vaccinia virus expressing 4-1BB ligand. Cancer Res. 2009, 69, 8516–8525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dinsart, C.; Pervolaraki, K.; Stroh-Dege, A.; Lavie, M.; Ronsse, I.; Rommelaere, J.; Van Damme, J.; Van Raemdonck, K.; Struyf, S. Recombinant Parvoviruses Armed to Deliver CXCL4L1 and CXCL10 Are Impaired in Their Antiangiogenic and Antitumoral Effects in a Kaposi Sarcoma Tumor Model Due To the Chemokines’ Interference with the Virus Cycle. Hum. Gene Ther. 2017, 28, 295–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balliet, J.W.; Kushnir, A.S.; Schaffer, P.A. Construction and characterization of a herpes simplex virus type I recombinant expressing green fluorescent protein: Acute phase replication and reactivation in mice. Virology 2007, 361, 372–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gierasch, W.W.; Zimmerman, D.L.; Ward, S.L.; Vanheyningen, T.K.; Romine, J.D.; Leib, D.A. Construction and characterization of bacterial artificial chromosomes containing HSV-1 strains 17 and KOS. J. Virol. Methods 2006, 135, 197–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alessandrini, F.; Ceresa, D.; Appolloni, I.; Marubbi, D.; Malatesta, P. Noninvasive Monitoring of Glioma Growth in the Mouse. J. Cancer 2016, 7, 1791–1797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marquardt, A.; Halle, S.; Seckert, C.K.; Lemmermann, N.A.; Veres, T.Z.; Braun, A.; Maus, U.A.; Forster, R.; Reddehase, M.J.; Messerle, M.; et al. Single cell detection of latent cytomegalovirus reactivation in host tissue. J. Gen. Virol. 2011, 92 Pt 6, 1279–1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Recombinant Virus * | Derived From | RETARGETING | ADDITIONAL MODIFICATIONS | Ref. | |||
|---|---|---|---|---|---|---|---|
| Insertion of scFv to ** | Insertion in | Genetic Modification *** | Site of Insertion | Purpose | |||
| R-593 | PSMA | gD Δ6–38 | This paper | ||||
| R-611 | EGFR | gD Δ6–38 | This paper | ||||
| R-613 | EGFRvIII | gD Δ6–38 | This paper | ||||
| R-615 | R-613 | EGFRvIII | gD Δ6–38 | mIL12 **** | US1-US2 | immunotherapy | This paper |
| R-613GLuc | R-613 | EGFRvIII | gD Δ6–38 | GLuc **** | UL37-UL38 | luciferase secretion | This paper |
| R-615GLuc | R-615 | EGFRvIII | gD Δ6–38 | mIL12 and GLuc | US1-US2 and UL37-UL38 | immunotherapy and luciferase secretion | This paper |
| R-LM113 | HER2 | gD Δ6–38 | [27] | ||||
| R-115 | R-LM113 | HER2 | gD Δ6–38 | mIL12 | US1-US2 | immunotherapy | This paper |
| R-LM249 | HER2 | gD Δ61–218 | [28] | ||||
| R-291 | R-LM249 | HER2 | gD Δ61–218 | D285N + A549T in gB | UL27 (gB) | enhanced infection or spread | This paper |
| Recombinant viral genome * | |||||||
| BAC-591 | PSMA | gD Δ61–218 | This paper | ||||
| BAC-621 | EGFR | gD Δ61–218 | This paper | ||||
| BAC-623 | EGFRvIII | gD Δ61–218 | This paper | ||||
| NO RETARGETING | |||||||
| Wt-virus and recombinant | Natural receptors | ||||||
| HSV-1(F) | Nectin1, HVEM | [49] | |||||
| R-LM5 | HSV-1(F) | Nectin1, HVEM | BAC sequences | UL3-UL4 | Genetic engineering in bacteria | [27] | |
| Cell Line | Infecting Recombinant Virus | Displayed Receptor | Genetic Modification | Tissue/Cell Type | Ref. |
|---|---|---|---|---|---|
| Human cancer | |||||
| LNCaP | R-593, R-LM5 | Natural HSV receptors *, PSMA | none | hu prostate adenocarcinoma | [51] |
| MDA-MB-231 | R-LM5, R-611 | Natural HSV receptors *, EGFR | none | hu mammary adenocarcinoma | [52] |
| hGic-G7 | R-LM5 | Natural HSV receptors * | none | hu glioblastoma | [45] |
| hGic-G15 | R-613, R-LM5 | Natural HSV receptors *, EGFRvIII | none | hu glioblastoma | [45] |
| PC3-PIP-PSMA | R-593 | Natural HSV receptors *, PSMA | express hu PSMA | hu prostate adenocarcinoma | [53] |
| Rh4 | R-LM5 | Natural HSV receptors * | none | hu muscle rhabdomyosarcoma | [44] |
| SK-OV-3 | R-LM5, R-LM113, R-115, R-LM249, R-291, R-611 | Natural HSV receptors *, HER2, EGFR | none | hu ovary adenocarcinoma | [54] |
| U251** | R-LM5 | Natural HSV receptors *, EGFR | none | hu glioma | [55] |
| U251-EGFRvIII | R-613, R-615, R-613GLuc, R-615GLuc, R-LM5 | Natural HSV receptors *, EGFR, EGFRvIII | express hu EGFRvIII | hu glioma | This paper |
| Animal cell lines | |||||
| B16-HER2 | R-LM249, R-291 | HER2 | express hu HER2 | mu melanoma | [48] |
| CHO-EGFR | R-611 | EGFR | express hu EGFR | hamster ovary | [46] |
| J | none | none | wt HSV receptor negative | hamster kidney | [47] |
| J-EGFR | R-611 | EGFR | express hu EGFR | hamster kidney | This paper |
| J-EGFRvIII | R-613, R-615, R-613GLuc, R-615GLuc | EGFRvIII | express hu EGFRvIII | hamster kidney | This paper |
| J-HER2 | R-LM113, R-115, R-LM249, R-291 | HER2 | express hu HER2 | hamster kidney | [27] |
| J-nectin1 | R-LM5 | Nectin1 | express hu nectin1 | hamster kidney | [47] |
| J-PSMA | R-593 | PSMA | express hu PSMA | hamster kidney | This paper |
| RS | R-611, R-LM5 | not characterized*** | none | rabbit skin | |
| R6 | BAC-591, BAC-621, BAC-623, R-593, R-611, R-613 | not characterized*** | inducible HSV gD | rabbit skin | [43] |
| TRAMP-PSMA | R-593 | PSMA | express hu PSMA | mu prostate epithelium | [56] |
| Cell line Employed for Titration | Virus |
|---|---|
| SK-OV-3 | HSV-1(F), R-LM5, R-LM113, R-115, R-LM249, R-291, R-611 |
| J-PSMA | R-593 |
| U251-EGFRvIII | R-613, R-615, R-613GLuc, R-615GLuc |
| Recombinant | Template | Forward Primer | Reverse Primer |
|---|---|---|---|
| BAC-291 | gB_D285N_A549T cl 2 | gBint4: GGGCATCGCGGTGGTCTTCAAGGAGAACA | gB_2046_r: GCGGGTGTACACCTCCAGGGGGACAAAC |
| BAC-591 | pSL1180-scFv-PSMA | gD60 + 8SG_J591_f: GCCTCCCGATCACGGTTTACTACGCCCATAGTAGTGGCGGTGGCTCTGGAGAGGTGCAGCTGCAGCAGTCAGGACC | 12SG + gD219_J591_r: AAGCGGGGCAGCATACCGGAtCcACCGGAACCAGAGCCACCGCCACTCGACCGTTTCAGGTCCAGCATGGTCCCAG |
| BAC-593 | BAC-591 | gD5_J591_f: TTGTCGTCATAGTGGGCCTCCATGGGGTCCGCGGCAAATATGCCTTGGCGGAGGTGCAGCTGCAGCAGTCAGGACC | gD39_SG11_r: ATCGGGAGGCTGGGGGGCTGGAACGGGTCCGGTAGGCCCGCCTGGATGTGGGATCCACCGGAACCAGAGCCACCGC |
| BAC-611 | pTNHaa-EGFR | BAC_LM611_f: TTGTCGTCATAGTGGGCCTCCATGGGGTCCGCGGCAAATATGCCTTGGCGGCCGAGGTGCAACTGCAGCAGTC | BAC_LM611_r: AGGCCCGCCTGGATGTGGGATCCACCGGAACCAGAGCCACCGCCACTCGATTTGATCTCGAGTTCTGTCCCCG |
| BAC-613 | pMR1ENV1 | BAC_LM613_f: TTGTCGTCATAGTGGGCCTCCATGGGGTCCGCGGCAAATATGCCTTGGCGCAGGTGAAACTGCAGCAGTCTGG | BAC_LM613_r: AGGCCCGCCTGGATGTGGGATCCACCGGAACCAGAGCCACCGCCACTCGATTTGATTTCCAGCTTGGTGCCATCACC |
| BAC-621 | pTNHaa-EGFR | BAC_LM621_f: GCCTCCCGATCACGGTTTACTACGCCCATAGTAGTGGCGGTGGCTCTGGAGCCGAGGTGCAACTGCAGCAGTC | BAC_LM621_r: AAGCGGGGCAGCATACCGGATCCACCGGAACCAGAGCCACCGCCACTCGATTTGATCTCGAGTTCTGTCCCCG |
| BAC-623 | pMR1ENV1 | BAC_LM623_f: GCCTCCCGATCACGGTTTACTACGCCCATAGTAGTGGCGGTGGCTCTGGACAGGTGAAACTGCAGCAGTCTGG | BAC_LM623_r: AAGCGGGGCAGCATACCGGATCCACCGGAACCAGAGCCACCGCCACTCGATTTGATTTCCAGCTTGGTGCCATCACC |
| BAC-115, BAC-615 | pLM84 | US1/US2_pCMV_f: ATGTCCCCAAATAAAAGACCAAAATCAAAGCGTTTGTCCCAGCGTCTTAATGGCGGGAAGCGTTTTGCGCTGCTTCGCGATGTACGGGC | US1/US2_polyA_r: CCCCGATGTCAATAAACCCCCAAACACCCCCCATGTACGCGTGGTCTGTTTCTCTCCGCCGCCATAGAGCCCACCGCATCCCCAGCATGCCTG |
| BAC-613GLuc, BAC-615GLuc | pCMV-GLuc2 | UL37/38_pcmv(gau)_f: CCGCAGGCGTTGCGAGTACCCCGCGTCTTCGCGGGGTGTTATACGGCCACCGATGTACGGGCCAGATATACGCGTTGAC | UL37/38_polyA(gau)_r: TCCGGACAATCCCCCGGGCCTGGGTCCGCGAACGGGATGCCGGGACTTAACACACAAAAAACCAACACACAGATGTAATG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Menotti, L.; Avitabile, E.; Gatta, V.; Malatesta, P.; Petrovic, B.; Campadelli-Fiume, G. HSV as A Platform for the Generation of Retargeted, Armed, and Reporter-Expressing Oncolytic Viruses. Viruses 2018, 10, 352. https://doi.org/10.3390/v10070352
Menotti L, Avitabile E, Gatta V, Malatesta P, Petrovic B, Campadelli-Fiume G. HSV as A Platform for the Generation of Retargeted, Armed, and Reporter-Expressing Oncolytic Viruses. Viruses. 2018; 10(7):352. https://doi.org/10.3390/v10070352
Chicago/Turabian StyleMenotti, Laura, Elisa Avitabile, Valentina Gatta, Paolo Malatesta, Biljana Petrovic, and Gabriella Campadelli-Fiume. 2018. "HSV as A Platform for the Generation of Retargeted, Armed, and Reporter-Expressing Oncolytic Viruses" Viruses 10, no. 7: 352. https://doi.org/10.3390/v10070352
APA StyleMenotti, L., Avitabile, E., Gatta, V., Malatesta, P., Petrovic, B., & Campadelli-Fiume, G. (2018). HSV as A Platform for the Generation of Retargeted, Armed, and Reporter-Expressing Oncolytic Viruses. Viruses, 10(7), 352. https://doi.org/10.3390/v10070352
