Viral Proteins U41 and U70 of Human Herpesvirus 6A Are Dispensable for Telomere Integration
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Viruses
2.2. Plasmid Construction and Lentivirus Production
2.3. 293T Single Strand Annealing (SSA) DNA Repair Reporter
2.4. SDS-PAGE and Immunoblotting
2.5. In Vitro HHV-6 Integration Assay
2.6. RT-qPCR Analysis of U70 and U41 Levels during Infection
2.7. qPCR Analysis
2.8. HHV-6A Genome Fluorescent In Situ Hybridization (FISH)
3. Results
3.1. HHV-6A U41 and U70 in Single Strand Annealing (SSA) DNA Repair
3.2. Generation of a U41 and U70 Knockdown Cell Line
3.3. Effect of U41/U70 Knockdown on HHV-6 Integration
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Yamanishi, K.; Okuno, T.; Shiraki, K.; Takahashi, M.; Kondo, T.; Asano, Y.; Kurata, T. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet 1988, 331, 1065–1067. [Google Scholar] [CrossRef]
- De Bolle, L.; Naesens, L.; De Clercq, E. Update on human herpesvirus 6 biology, clinical features, and therapy. Clin. Microbiol. Rev. 2005, 18, 217–245. [Google Scholar] [CrossRef] [PubMed]
- Readhead, B.; Haure-Mirande, J.V.; Funk, C.C.; Richards, M.A.; Shannon, P.; Haroutunian, V.; Sano, M.; Liang, W.S.; Beckmann, N.D.; Price, N.D.; et al. Multiscale analysis of independent alzheimer’s cohorts finds disruption of molecular, genetic, and clinical networks by human herpesvirus. Neuron 2018, 99, 64–82.e7. [Google Scholar] [CrossRef] [PubMed]
- Nacheva, E.P.; Ward, K.N.; Brazma, D.; Virgili, A.; Howard, J.; Leong, H.N.; Clark, D.A. Human herpesvirus 6 integrates within telomeric regions as evidenced by five different chromosomal sites. J. Med. Virol. 2008, 80, 1952–1958. [Google Scholar] [CrossRef] [PubMed]
- Arbuckle, J.H.; Pantry, S.N.; Medveczky, M.M.; Prichett, J.; Loomis, K.S.; Ablashi, D.; Medveczky, P.G. Mapping the telomere integrated genome of human herpesvirus 6a and 6b. Virology 2013, 442, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Arbuckle, J.H.; Medveczky, M.M.; Luka, J.; Hadley, S.H.; Luegmayr, A.; Ablashi, D.; Lund, T.C.; Tolar, J.; De Meirleir, K.; Montoya, J.G.; et al. The latent human herpesvirus-6a genome specifically integrates in telomeres of human chromosomes in vivo and in vitro. Proc. Natl. Acad. Sci. USA 2010, 107, 5563–5568. [Google Scholar] [CrossRef] [PubMed]
- Daibata, M.; Taguchi, T.; Nemoto, Y.; Taguchi, H.; Miyoshi, I. Inheritance of chromosomally integrated human herpesvirus 6 DNA. Blood 1999, 94, 1545–1549. [Google Scholar] [PubMed]
- Tanaka-Taya, K.; Sashihara, J.; Kurahashi, H.; Amo, K.; Miyagawa, H.; Kondo, K.; Okada, S.; Yamanishi, K. Human herpesvirus 6 (hhv-6) is transmitted from parent to child in an integrated form and characterization of cases with chromosomally integrated hhv-6 DNA. J. Med. Virol. 2004, 73, 465–473. [Google Scholar] [CrossRef] [PubMed]
- Hubacek, P.; Muzikova, K.; Hrdlickova, A.; Cinek, O.; Hyncicova, K.; Hrstkova, H.; Sedlacek, P.; Stary, J. Prevalence of hhv-6 integrated chromosomally among children treated for acute lymphoblastic or myeloid leukemia in the czech republic. J. Med. Virol. 2009, 81, 258–263. [Google Scholar] [CrossRef] [PubMed]
- Potenza, L.; Barozzi, P.; Masetti, M.; Pecorari, M.; Bresciani, P.; Gautheret-Dejean, A.; Riva, G.; Vallerini, D.; Tagliazucchi, S.; Codeluppi, M.; et al. Prevalence of human herpesvirus-6 chromosomal integration (cihhv-6) in italian solid organ and allogeneic stem cell transplant patients. Am. J. Transplant. 2009, 9, 1690–1697. [Google Scholar] [CrossRef] [PubMed]
- Ward, K.N.; Leong, H.N.; Thiruchelvam, A.D.; Atkinson, C.E.; Clark, D.A. Human herpesvirus 6 DNA levels in cerebrospinal fluid due to primary infection differ from those due to chromosomal viral integration and have implications for diagnosis of encephalitis. J. Clin. Microbiol. 2007, 45, 1298–1304. [Google Scholar] [CrossRef] [PubMed]
- Endo, A.; Watanabe, K.; Ohye, T.; Suzuki, K.; Matsubara, T.; Shimizu, N.; Kurahashi, H.; Yoshikawa, T.; Katano, H.; Inoue, N.; et al. Molecular and virological evidence of viral activation from chromosomally integrated human herpesvirus 6a in a patient with x-linked severe combined immunodeficiency. Clin. Infect. Dis. 2014, 59, 545–548. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.L.; Carlin, K.; Ljungman, P.; Politikos, I.; Boussiotis, V.; Boeckh, M.; Shaffer, M.L.; Zerr, D.M. Human herpesvirus-6b reactivation is a risk factor for grades ii to iv acute graft-versus-host disease after hematopoietic stem cell transplantation: A systematic review and meta-analysis. Biol. Blood Marrow Transplant. 2018, 24, 2324–2336. [Google Scholar] [CrossRef] [PubMed]
- Marci, R.; Gentili, V.; Bortolotti, D.; Lo Monte, G.; Caselli, E.; Bolzani, S.; Rotola, A.; Di Luca, D.; Rizzo, R. Presence of hhv-6a in endometrial epithelial cells from women with primary unexplained infertility. PLoS ONE 2016, 11, e0158304. [Google Scholar] [CrossRef] [PubMed]
- Kuhl, U.; Lassner, D.; Wallaschek, N.; Gross, U.M.; Krueger, G.R.; Seeberg, B.; Kaufer, B.B.; Escher, F.; Poller, W.; Schultheiss, H.P. Chromosomally integrated human herpesvirus 6 in heart failure: Prevalence and treatment. Eur. J. Heart Fail. 2015, 17, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Gravel, A.; Dubuc, I.; Morissette, G.; Sedlak, R.H.; Jerome, K.R.; Flamand, L. Inherited chromosomally integrated human herpesvirus 6 as a predisposing risk factor for the development of angina pectoris. Proc. Natl. Acad. Sci. USA 2015, 112, 8058–8063. [Google Scholar] [CrossRef] [PubMed]
- Montejo, M.; Ramon Fernandez, J.; Testillano, M.; Valdivieso, A.; Aguirrebengoa, K.; Varas, C.; Olaizola, A.; De Urbina, J.O. Encephalitis caused by human herpesvirus-6 in a liver transplant recipient. Eur. Neurol. 2002, 48, 234–235. [Google Scholar] [CrossRef] [PubMed]
- Hill, J.A.; Magaret, A.S.; Hall-Sedlak, R.; Mikhaylova, A.; Huang, M.L.; Sandmaier, B.M.; Hansen, J.A.; Jerome, K.R.; Zerr, D.M.; Boeckh, M. Outcomes of hematopoietic cell transplantation using donors or recipients with inherited chromosomally integrated hhv-6. Blood 2017, 130, 1062–1069. [Google Scholar] [CrossRef] [PubMed]
- Coulam, C.B.; Bilal, M.; Salazar Garcia, M.D.; Katukurundage, D.; Elazzamy, H.; Fernandez, E.F.; Kwak-Kim, J.; Beaman, K.; Dambaeva, S.V. Prevalence of hhv-6 in endometrium from women with recurrent implantation failure. Am. J. Reprod. Immunol. 2018, 80, e12862. [Google Scholar] [CrossRef] [PubMed]
- Wallaschek, N.; Sanyal, A.; Pirzer, F.; Gravel, A.; Mori, Y.; Flamand, L.; Kaufer, B.B. The telomeric repeats of human herpesvirus 6a (hhv-6a) are required for efficient virus integration. PLoS Pathog. 2016, 12, e1005666. [Google Scholar] [CrossRef] [PubMed]
- Wallaschek, N.; Gravel, A.; Flamand, L.; Kaufer, B.B. The putative u94 integrase is dispensable for human herpesvirus 6 (hhv-6) chromosomal integration. J. Gen. Virol. 2016, 97, 1899–1903. [Google Scholar] [CrossRef] [PubMed]
- Schaffer, P.A.; Tevethia, M.J.; Benyesh-Melnick, M. Recombination between temperature-sensitive mutants of herpes simplex virus type 1. Virology 1974, 58, 219–228. [Google Scholar] [CrossRef]
- Schumacher, A.J.; Mohni, K.N.; Kan, Y.; Hendrickson, E.A.; Stark, J.M.; Weller, S.K. The hsv-1 exonuclease, ul12, stimulates recombination by a single strand annealing mechanism. PLoS Pathog. 2012, 8, e1002862. [Google Scholar] [CrossRef] [PubMed]
- Reuven, N.B.; Staire, A.E.; Myers, R.S.; Weller, S.K. The herpes simplex virus type 1 alkaline nuclease and single-stranded DNA binding protein mediate strand exchange in vitro. J. Virol. 2003, 77, 7425–7433. [Google Scholar] [CrossRef] [PubMed]
- Reuven, N.B.; Antoku, S.; Weller, S.K. The ul12.5 gene product of herpes simplex virus type 1 exhibits nuclease and strand exchange activities but does not localize to the nucleus. J. Virol. 2004, 78, 4599–4608. [Google Scholar] [CrossRef] [PubMed]
- Sanyal, A.; Wallaschek, N.; Glass, M.; Flamand, L.; Wight, D.J.; Kaufer, B.B. The nd10 complex represses lytic human herpesvirus 6a replication and promotes silencing of the viral genome. Viruses 2018, 10, 401. [Google Scholar] [CrossRef] [PubMed]
- Stark, J.M.; Pierce, A.J.; Oh, J.; Pastink, A.; Jasin, M. Genetic steps of mammalian homologous repair with distinct mutagenic consequences. Mol. Cell. Biol. 2004, 24, 9305–9316. [Google Scholar] [CrossRef] [PubMed]
- Kaufer, B.B. Detection of integrated herpesvirus genomes by fluorescence in situ hybridization (fish). Methods Mol. Biol. 2013, 1064, 141–152. [Google Scholar] [PubMed]
- Gravel, A.; Dubuc, I.; Wallaschek, N.; Gilbert-Girard, S.; Collin, V.; Hall-Sedlak, R.; Jerome, K.R.; Mori, Y.; Carbonneau, J.; Boivin, G.; et al. Cell culture systems to study human herpesvirus 6a/b chromosomal integration. J. Virol. 2017, 91. [Google Scholar] [CrossRef] [PubMed]
- Weller, S.K.; Lee, K.J.; Sabourin, D.J.; Schaffer, P.A. Genetic analysis of temperature-sensitive mutants which define the gene for the major herpes simplex virus type 1 DNA-binding protein. J. Virol. 1983, 45, 354–366. [Google Scholar] [PubMed]
- Gao, M.; Knipe, D.M. Genetic evidence for multiple nuclear functions of the herpes simplex virus icp8 DNA-binding protein. J. Virol. 1989, 63, 5258–5267. [Google Scholar] [PubMed]
- Conley, A.J.; Knipe, D.M.; Jones, P.C.; Roizman, B. Molecular genetics of herpes simplex virus. Vii. Characterization of a temperature-sensitive mutant produced by in vitro mutagenesis and defective in DNA synthesis and accumulation of gamma polypeptides. J. Virol. 1981, 37, 191–206. [Google Scholar] [PubMed]
- Thomson, B.J.; Weindler, F.W.; Gray, D.; Schwaab, V.; Heilbronn, R. Human herpesvirus 6 (hhv-6) is a helper virus for adeno-associated virus type 2 (aav-2) and the aav-2 rep gene homologue in hhv-6 can mediate aav-2 DNA replication and regulate gene expression. Virology 1994, 204, 304–311. [Google Scholar] [CrossRef] [PubMed]
- Trempe, F.; Gravel, A.; Dubuc, I.; Wallaschek, N.; Collin, V.; Gilbert-Girard, S.; Morissette, G.; Kaufer, B.B.; Flamand, L. Characterization of human herpesvirus 6a/b u94 as atpase, helicase, exonuclease and DNA-binding proteins. Nucleic Acids Res. 2015, 43, 6084–6098. [Google Scholar] [CrossRef] [PubMed]




| Cloning Step/qPCR | Sequence (5′ → 3′) | |
|---|---|---|
| shRNA U70#1 | For | CACCGGAGTGGATGGATCGGAAGACATCAAGAGTGTCTTCCGATCCATCCACTCTTTTTT |
| Rev | CAGCAAAAAAGAGTGGATGGATCGGAAGACACTCTTGATGTCTTCCGATCCATCCACTCC | |
| shRNA U70#2 | For | ATCAAAAAAGACGGCGACTAAGTTGTATGACTCTTGATCATACAACTTAGTCGCCGTCGAGG |
| Rev | GGTACCTCGACGGCGACTAAGTTGTATGATCAAGAGTCATACAACTTAGTCGCCGTCTTTTT | |
| shRNA U41#1 | For | CACCGGTTTCTGCTCCCGTTTCTACTTCAAGAGAGTAGAAACGGGAGCAGAAACTTTTTT |
| Rev | CAGCAAAAAAGTTTCTGCTCCCGTTTCTACTCTCTTGAAGTAGAAACGGGAGCAGAAAC | |
| shRNA U41#2 | For | ATCAAAAAAAGATTTCTCGACCACGGTTAAACTCTTGATTTAACCGTGGTCGAGAAATCGAGG |
| Rev | GGTACCTCGATTTCTCGACCACGGTTAAATCAAGAGTTTAACCGTGGTCGAGAAATCTTTTTT | |
| Puromycin to hygromycin resistance gene | For | GCATGGATCCGCCACCATGAAGAAACCTG |
| Rev | CTGCACGCGTTCATTCCTTGGCTCTGGG | |
| U70-HA amplification for cloning | For | CTACACTCGAGGCCACCATGGATCTTGATCAAATATCTGAAACAC |
| Rev | CTCAGGGATCCACCGCATAATCCGGCACATCATACGGATAACTACCACCAGGTGTTTTCGGTTTTCTTACACATG | |
| U41-HA amplification for cloning | For | TTAGCTAGCCACCATGGCTGATGAAAACG |
| Rev | TGTACTCGAGTTACGCATAATCCGGCACATC | |
| Stop insertion SDM for U70 | For | GAAAACACCTTAAGGTGGTAGTTATC |
| Rev | GGTTTTCTTACACATGCCGC | |
| ß2M qPCR | For | CCAGCAGAGAATGGAAAGTCAA |
| Rev | TCTCCATTCTTCAGTAAGTCAACTTCA | |
| Probe | FAM-ATGTGTCTGGGTTTCATCCATCCGACA-TAMRA | |
| U86 qPCR | For | TGTACATGGGCTGTAGGAGTTGA |
| Rev | ACATCCTCTGCTTCCAATCTACAATC | |
| Probe | FAM-TTCCGAAGCAAAGCGCACCTGG-TAMRA | |
| U70 qPCR | For | GGGCCGTAAACTTATTGAGG |
| Rev | CAGCTTGCACAATTCACTCA | |
| Probe | FAM-TCCATCCACTCTTGTGCCGCA-TAMRA | |
| U41 qPCR | For | CACGATTGACAACATTTCCC |
| Rev | GGGTAATGCGCATACTGAGA | |
| Probe | FAM-TCGCCGAACAATTTACCAGATGATTG-TAMRA | |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wight, D.J.; Wallaschek, N.; Sanyal, A.; Weller, S.K.; Flamand, L.; Kaufer, B.B. Viral Proteins U41 and U70 of Human Herpesvirus 6A Are Dispensable for Telomere Integration. Viruses 2018, 10, 656. https://doi.org/10.3390/v10110656
Wight DJ, Wallaschek N, Sanyal A, Weller SK, Flamand L, Kaufer BB. Viral Proteins U41 and U70 of Human Herpesvirus 6A Are Dispensable for Telomere Integration. Viruses. 2018; 10(11):656. https://doi.org/10.3390/v10110656
Chicago/Turabian StyleWight, Darren J., Nina Wallaschek, Anirban Sanyal, Sandra K. Weller, Louis Flamand, and Benedikt B. Kaufer. 2018. "Viral Proteins U41 and U70 of Human Herpesvirus 6A Are Dispensable for Telomere Integration" Viruses 10, no. 11: 656. https://doi.org/10.3390/v10110656
APA StyleWight, D. J., Wallaschek, N., Sanyal, A., Weller, S. K., Flamand, L., & Kaufer, B. B. (2018). Viral Proteins U41 and U70 of Human Herpesvirus 6A Are Dispensable for Telomere Integration. Viruses, 10(11), 656. https://doi.org/10.3390/v10110656

