Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco
Abstract
:1. Introduction
2. Results
2.1. Cloning and Sequence Analysis of FmNAC1 Genes and Prediction of the Protein Tertiary Structure
2.2. Phylogenetic Analysis of the FmNAC1 Gene Reveals Relationships with Homologous NAC1 Sequences in Plants
2.3. Subcellular Localization of the FmNAC1 Protein
2.4. Expression Pattern of FmNAC1 in F. mandshurica
2.5. Genetic Transformation of FmNAC1 Overexpression in Tobacco and Identification of FmNAC1-OE Transgenic Tobacco Lines
2.6. Growth Phenotype Analysis of FmNAC1-OE Transgenic Tobacco
2.7. Cold-Resistance Analysis of FmNAC1-OE Tobacco Plants
2.8. Analysis of the Physiological Indexes of FmNAC1-OE Transgenic Tobacco Plants under Low-Temperature Stress
2.9. Gene Expression in FmNAC1-OE Transgenic Tobacco Plants
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. Cloning and Identification of the FmNAC1 Gene
4.3. Experimental Approach for FmNAC1 Protein Subcellular Localization
4.4. Abiotic Stresses and Hormone Signal Treatments
4.5. Agrobacterium-Mediated Genetic Transformation in Tobacco
4.6. Identification and Propagation of Transgenic Tobacco
4.7. Determination of Physiological Traits
4.8. Analysis of Low-Temperature Tolerance in Transgenic Tobacco Plants
4.9. Analysis of Gene Expression
4.10. Statistical Analysis of Data
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Zhao, X.; Zhang, X.; Liu, Z.; Lv, Y.; Song, T.; Cui, J.; Chen, T.; Li, J.; Zeng, F.; Zhan, Y. Comparing the effects of N and P deficiency on physiology and growth for fast- and slow-growing provenances of Fraxinus mandshurica. Forests 2021, 12, 1760. [Google Scholar] [CrossRef]
- Cao, Y.; He, L.; Song, F.; Li, C.; Ji, Q.; Liu, J.; Peng, G.; Li, B.; Zeng, F.; Zhan, Y. Physiological and gene expression response of interspecific hybrids of Fraxinus mandshurica × Fraxinus americana to MJ or SNP under drought. Forests 2023, 14, 1277. [Google Scholar] [CrossRef]
- Hu, L.-J.; Uchiyama, K.; Shen, H.-L.; Saito, Y.; Tsuda, Y.; Ide, Y. Nuclear DNA microsatellites reveal genetic variation but a lack of phylogeographical structure in an endangered species, Fraxinus mandshurica, across north-east China. Ann. Bot. 2008, 102, 195–205. [Google Scholar] [CrossRef] [PubMed]
- Kong, D.M.; Preece, J.E.; Shen, H.L. Somatic embryogenesis in immature cotyledons of Manchurian ash (Fraxinus mandshurica Rupr.). Plant Cell Tissue Organ Cult. (PCTOC) 2012, 108, 485–492. [Google Scholar] [CrossRef]
- Wang, M.; Zhang, W.-W.; Li, N.; Liu, Y.-Y.; Zheng, X.-B.; Hao, G.-Y. Photosynthesis and growth responses of Fraxinus mandshurica Rupr. seedlings to a gradient of simulated nitrogen deposition. Ann. For. Sci. 2018, 75, 1. [Google Scholar] [CrossRef]
- Chinnusamy, V.; Zhu, J.; Zhu, J.K. Cold stress regulation of gene expression in plants. Trends Plant Sci. 2007, 12, 444–451. [Google Scholar] [CrossRef] [PubMed]
- Mahajan, S.; Tuteja, N. Cold, salinity and drought stresses: An overview. Arch. Biochem. Biophys. 2005, 444, 139–158. [Google Scholar] [CrossRef] [PubMed]
- Thomashow, M.F. Plant cold acclimation: Freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Biol. 1999, 50, 571–599. [Google Scholar] [CrossRef]
- Liu, C.T.; Wang, W.; Mao, B.G.; Chu, C. Cold stress tolerance in rice: Physiological changes, molecular mechanism, and future prospects. Yi chuan = Hereditas 2018, 40, 171–185. [Google Scholar]
- Jung, J.-H.; Domijan, M.; Klose, C.; Biswas, S.; Ezer, D.; Gao, M.; Khattak, A.K.; Box, M.S.; Charoensawan, V.; Cortijo, S.; et al. Phytochromes function as thermosensors in Arabidopsis. Science 2016, 354, 886–889. [Google Scholar] [CrossRef]
- Legris, M.; Klose, C.; Burgie, E.S.; Rojas, C.C.R.; Neme, M.; Hiltbrunner, A.; Wigge, P.A.; Schäfer, E.; Vierstra, R.D.; Casal, J.J. Phytochrome B integrates light and temperature signals in Arabidopsis. Science 2016, 354, 897–900. [Google Scholar] [CrossRef] [PubMed]
- Fujii, Y.; Kodama, Y. Refinements to light sources used to analyze the chloroplast cold-avoidance response over the past century. Plant Signal. Behav. 2018, 13, 9206–9211. [Google Scholar] [CrossRef] [PubMed]
- Cook, D.; Fowler, S.; Fiehn, O.; Thomashow, M.F. A prominent role for the CBF cold response pathway in configuring the low-temperature metabolome of Arabidopsis. Proc. Natl. Acad. Sci. USA 2004, 101, 15243–15248. [Google Scholar] [CrossRef] [PubMed]
- Hannah, M.A.; Heyer, A.G.; Hincha, D.K. A global survey of gene regulation during cold acclimation in Arabidopsis thaliana. PLoS Genet. 2005, 1, e26. [Google Scholar] [CrossRef] [PubMed]
- Maruyama, K.; Takeda, M.; Kidokoro, S.; Yamada, K.; Sakuma, Y.; Urano, K.; Fujita, M.; Yoshiwara, K.; Matsukura, S.; Morishita, Y.; et al. Metabolic pathways involved in cold acclimation identified by integrated analysis of metabolites and transcripts regulated by DREB1A and DREB2A. Plant Physiol. 2009, 150, 1972–1980. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, K.; Takasaki, H.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. NAC transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta (BBA)-Gene Regul. Mech. 2012, 1819, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Ooka, H.; Satoh, K.; Doi, K.; Nagata, T.; Otomo, Y.; Murakami, K.; Matsubara, K.; Osato, N.; Kawai, J.; Carninci, P.; et al. Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res. 2003, 10, 239–247. [Google Scholar] [CrossRef] [PubMed]
- Hu, R.; Qi, G.; Kong, Y.; Kong, D.; Gao, Q.; Zhou, G. Comprehensive analysis of NAC domain transcription factor gene family in Populus trichocarpa. BMC Plant Biol. 2010, 10, 145. [Google Scholar] [CrossRef] [PubMed]
- Cao, F.; Guo, C.; Wang, X.; Wang, X.; Yu, L.; Zhang, H.; Zhang, J. Genome-wide identification, evolution, and expression analysis of the NAC gene family in chestnut (Castanea mollissima). Front. Genet. 2024, 15, 1337578. [Google Scholar] [CrossRef]
- Yang, Z.; An, Y.; Ye, Q.; Zhang, N.; Liu, X.; He, F.; Zeng, Y.; Tang, M.; Yang, Z.; Li, K. Genome-Wide Identification and Expression Analysis of Salt-Tolerance-Associated NAC Family Genes in Cyclocarya paliurus. Forests 2024, 15, 479. [Google Scholar] [CrossRef]
- Ahmed, J.; Sajjad, Y.; Gatasheh, M.K.; Ibrahim, K.E.; Huzafa, M.; Khan, S.A.; Situ, C.; Abbasi, A.M.; Hassan, A. Genome-wide identification of NAC transcription factors and regulation of monoterpenoid indole alkaloid biosynthesis in Catharanthus roseus. Front. Plant Sci. 2023, 14, 1286584. [Google Scholar] [CrossRef] [PubMed]
- Puranik, S.; Sahu, P.P.; Srivastava, P.S.; Prasad, M. NAC proteins: Regulation and role in stress tolerance. Trends Plant Sci. 2012, 17, 369–381. [Google Scholar] [CrossRef]
- Nuruzzaman, M.; Sharoni, A.M.; Kikuchi, S. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front. Microbiol. 2013, 4, 248. [Google Scholar] [CrossRef] [PubMed]
- Uauy, C.; Distelfeld, A.; Fahima, T.; Blechl, A.; Dubcovsky, J. A NAC gene regulating senescence improves grain protein, zinc, and iron content in wheat. Science 2006, 314, 1298–1301. [Google Scholar] [CrossRef] [PubMed]
- Tran, L.S.P.; Nakashima, K.; Sakuma, Y.; Simpson, S.D.; Fujita, Y.; Maruyama, K.; Fujita, M.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 2004, 16, 2481–2498. [Google Scholar] [CrossRef] [PubMed]
- Bielefeld, E.C.; Kopke, R.D.; Jackson, R.L.; Coleman, J.K.; Liu, J.; Henderson, D. Noise protection with N-acetyl-l-cysteine (NAC) using a variety of noise exposures, NAC doses, and routes of administration. Acta Oto-Laryngol. 2007, 127, 914–919. [Google Scholar] [CrossRef]
- Ernst, H.A.; Olsen, A.N.; Skriver, K.; Larsen, S.; Leggio, L.L. Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Rep. 2004, 5, 297–303. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; You, J.; Xie, K.; Xie, W.; Xiong, L. Systematic sequence analysis and identification of tissue-specific or stress-responsive genes of NAC transcription factor family in rice. Mol. Genet. Genom. 2008, 280, 547–563. [Google Scholar] [CrossRef]
- Shao, H.; Wang, H.; Tang, X. NAC transcription factors in plant multiple abiotic stress responses: Progress and prospects. Front. Plant Sci. 2015, 6, 902. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.K.; Kjaersgaard, T.; Nielsen, M.M.; Galberg, P.; Petersen, K.; O’Shea, C.; Skriver, K. The Arabidopsis thaliana NAC transcription factor family: Structure–function relationships and determinants of ANAC019 stress signaling. Biochem. J. 2010, 426, 183–196. [Google Scholar] [CrossRef]
- Yin, Q.; Qin, W.; Zhou, Z.; Wu, A.; Deng, W.; Li, Z.; Shan, W.; Chen, J.; Kuang, J.; Lu, W. Banana MaNAC1 activates secondary cell wall cellulose biosynthesis to enhance chilling resistance in fruit. Plant Biotechnol. J. 2024, 22, 413–426. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Li, N.; Wen, D.; Yu, J.; Hong, J.; Wu, M.; Cheng, L.; Meng, S. Identification of stress responsive NAC genes in Casuarina equisetifolia L. and its expression analysis under abiotic stresses. Agronomy 2024, 14, 535. [Google Scholar] [CrossRef]
- Xu, P.; Ma, W.; Feng, H.; Cai, W. NAC056 transcription factor confers freezing tolerance by positively regulating the expression of CBFs and NIA1 in Arabidopsis. Plant Commun. 2024. [Google Scholar] [CrossRef] [PubMed]
- Bu, Q.; Jiang, H.; Li, C.-B.; Zhai, Q.; Zhang, J.; Wu, X.; Sun, J.; Xie, Q.; Li, C. Role of the Arabidopsis thaliana NAC transcription factors ANAC019 and ANAC055 in regulating jasmonic acid-signaled defense responses. Cell Res. 2008, 18, 756–767. [Google Scholar] [CrossRef] [PubMed]
- Zhong, R.; Richardson, E.A.; Ye, Z.H. Two NAC domain transcription factors, SND1 and NST1, function redundantly in regulation of secondary wall synthesis in fibers of Arabidopsis. Planta 2007, 225, 1603–1611. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Basnayake, B.M.V.S.; Zhang, H.; Li, G.; Li, W.; Virk, N.; Mengiste, T.; Song, F. The Arabidopsis ATAF1, a NAC transcription factor, is a negative regulator of defense responses against necrotrophic fungal and bacterial pathogens. Mol. Plant-Microbe Interact. 2009, 22, 1227–1238. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.K.; Hagedorn, P.H.; De Torres-Zabala, M.; Grant, M.R.; Rung, J.H.; Collinge, D.B.; Lyngkjaer, M.F. Transcriptional regulation by an NAC (NAM–ATAF1, 2–CUC2) transcription factor attenuates ABA signaling for efficient basal defense toward Blumeria graminis f. sp. hordei in Arabidopsis. Plant J. 2008, 56, 867–880. [Google Scholar] [CrossRef] [PubMed]
- Shan, W.; Kuang, J.F.; Lu, W.J.; Chen, J.Y. Banana fruit NAC transcription factor MaNAC1 is a direct target of MaICE1 and involved in cold stress through interacting with MaCBF1. Plant Cell Environ. 2014, 37, 2116–2127. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Chen, Z.; Wu, Y.; Mu, M.; Jiang, J.; Nie, W.; Zhao, S.; Cui, G.; Yin, X. Genome-wide identification and characterization of NAC transcription factor family members in Trifolium pratense and expression analysis under lead stress. BMC Genom. 2024, 25, 128. [Google Scholar] [CrossRef]
- Tao, W.; Xue, M.M.; Ying, C.; Cui, C.W.; Zhen, X.X.; Zixi, L.; Li, H.G.; Wen, N.Z. SlNAC3 suppresses cold tolerance in tomatoes by enhancing ethylene biosynthesis. Plant Cell Environ. 2024, 47, 3132–3146. [Google Scholar]
- Hu, X.; Xie, F.; Liang, W.; Liang, Y.; Zhang, Z.; Zhao, J.; Hu, G.; Qin, Y. HuNAC20 and HuNAC25, two novel NAC genes from Pitaya, confer cold tolerance in transgenic Arabidopsis. Int. J. Mol. Sci. 2022, 23, 2189. [Google Scholar] [CrossRef] [PubMed]
- Liang, N.; Zhan, Y.; Yu, L.; Wang, Z.; Zeng, F. Characteristics and expression analysis of FmTCP15 under abiotic stresses and hormones and interact with DELLA protein in Fraxinus mandshurica Rupr. Forests 2019, 10, 343. [Google Scholar] [CrossRef]
- Hao, Y.-Q.; Lu, G.-Q.; Wang, L.-H.; Wang, C.-L.; Guo, H.-M.; Li, Y.-F.; Cheng, H.-M. Overexpression of AmDUF1517 enhanced tolerance to salinity, drought, and cold stress in transgenic cotton. J. Integr. Agric. 2018, 17, 2204–2214. [Google Scholar] [CrossRef]
- Liu, S.; Guan, Y.; Weng, Y.; Liao, B.; Tong, L.; Hao, Z.; Chen, J.; Shi, J.; Cheng, T. Genome-wide identification of the NAC gene family and its functional analysis in Liriodendron. BMC Plant Biol. 2023, 23, 415. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Shi, H.; Hu, Z.; Liu, A.; Amombo, E.; Chen, L.; Fu, J. ABA is involved in regulation of cold stress response in bermudagrass. Front. Plant Sci. 2017, 8, 1613. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; Zhan, Y.; Zeng, F.; Zhao, X.; Wang, X. Drought physiology and gene expression characteristics of Fraxinus interspecific hybrids. Plant Growth Regul. 2016, 78, 179–193. [Google Scholar] [CrossRef]
- Bouslama, M.; Schapaugh, W.T., Jr. Stress tolerance in soybeans. I. Evaluation of three screening techniques for heat and drought tolerance 1. Crop Sci. 1984, 24, 933–937. [Google Scholar] [CrossRef]
- Ni, Z.; Kim, E.D.; Ha, M.; Lackey, E.; Liu, J.; Zhang, Y.; Sun, Q.; Chen, Z.J. Altered circadian rhythms regulate growth vigor in hybrids and allopolyploids. Nature 2009, 457, 327–331. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Gong, Z. One SNP in COLD1 determines cold tolerance during rice domestication. J. Genet. Genom. 2015, 42, 133–134. [Google Scholar] [CrossRef] [PubMed]
- Yue, C.; Cao, H.-L.; Wang, L.; Zhou, Y.-H.; Huang, Y.-T.; Hao, X.-Y.; Wang, Y.-C.; Wang, B.; Yang, Y.-J.; Wang, X.-C. Effects of cold acclimation on sugar metabolism and sugar-related gene expression in tea plant during the winter season. Plant Mol. Biol. 2015, 88, 591–608. [Google Scholar] [CrossRef]
- Heidarvand, L.; Maali-Amiri, R. Physio-biochemical and proteome analysis of chickpea in early phases of cold stress. J. Plant Physiol. 2013, 170, 459–469. [Google Scholar] [CrossRef]
- Suzuki, N.; Koussevitzky, S.; Mittler, R.; Miller, G. ROS and redox signaling in the response of plants to abiotic stress. Plant Cell Environ. 2012, 35, 259–270. [Google Scholar] [CrossRef] [PubMed]
- Yarra, R.; Wei, W. The NAC-type transcription factor GmNAC20 improves cold, salinity tolerance, and lateral root formation in transgenic rice plants. Funct. Integr. Genom. 2021, 21, 473–487. [Google Scholar] [CrossRef] [PubMed]
- Jin, C.; Li, K.-Q.; Xu, X.-Y.; Zhang, H.-P.; Chen, H.-X.; Chen, Y.-H.; Hao, J.; Wang, Y.; Huang, X.-S.; Zhang, S.-L. A novel NAC transcription factor, PbeNAC1, of Pyrus betulifolia confers cold and drought tolerance via interacting with PbeDREBs and activating the expression of stress-responsive genes. Front. Plant Sci. 2017, 8, 1049. [Google Scholar] [CrossRef] [PubMed]
- Achard, P.; Gong, F.; Cheminant, S.; Alioua, M.; Hedden, P.; Genschik, P. The cold-inducible CBF1 factor–dependent signaling pathway modulates the accumulation of the growth-repressing DELLA proteins via its effect on gibberellin metabolism. Plant Cell 2008, 20, 2117–2129. [Google Scholar] [CrossRef] [PubMed]
- Hao, Y.J.; Wei, W.; Song, Q.X.; Chen, H.W.; Zhang, Y.Q.; Wang, F.; Zou, H.F.; Lei, G.; Tian, A.G.; Zhang, W.K.; et al. Soybean NAC transcription factors promote abiotic stress tolerance and lateral root formation in transgenic plants. Plant J. Cell Mol. Biol. 2011, 68, 302–313. [Google Scholar] [CrossRef] [PubMed]
- Diao, P.; Chen, C.; Zhang, Y.; Meng, Q.; Lv, W.; Ma, N. The role of NAC transcription factor in plant cold response. Plant Signal. Behav. 2020, 15, 1785668. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Li, C.; Chen, X.; Li, S.; Liang, N.; Wang, H.; Zhan, Y.; Zeng, F. Basic helix-loop-helix transcription factor PxbHLH02 enhances drought tolerance in Populus (Populus simonii × P. nigra). Tree Physiol. 2023, 43, 185–202. [Google Scholar] [CrossRef] [PubMed]
- Tang, M.; Xue, W.; Li, X.; Wang, L.; Wang, M.; Wang, W.; Yin, X.; Chen, B.; Qu, X.; Li, J.; et al. Mitotically heriTable epigenetic modifications of CmMYB6 control anthocyanin biosynthesis in Chrysanthemum. New Phytol. 2022, 236, 1075–1088. [Google Scholar] [CrossRef]
- Kahrizi, D.; Ghaheri, M.; Yari, Z.; Yari, K.; Bahraminejad, S. Investigation of different concentrations of MS media effects on gene expression and steviol glycosides accumulation in Stevia rebaudiana Bertoni. Cell. Mol. Biol. 2018, 64, 23–27. [Google Scholar] [CrossRef]
- Clarke, J.D. Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for plant DNA isolation. Cold Spring Harb. Protoc. 2009, 2009, pdb.prot5177. [Google Scholar] [CrossRef] [PubMed]
- Bradrord, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
Amino Acid Sequences of Species | Similarity |
---|---|
Olea europaea (XP_022848339.1) | 85.14% |
Sesamum indicum (XP_011095676.1) | 61.23% |
Coffea arabic (XP_027061236.1) | 61.76% |
Nicotiana tomentosiformis (XP_009605814.1) | 59.52% |
Camellia sinensis (XP_028081260.1) | 62.94% |
Beta vulgaris subsp. Vulgaris (XP_010666181.1) | 56.36% |
Nelumbo nucifera (XP_010258675.1) | 59.18% |
Theobroma cacao (XP_007022298.1) | 57.61% |
Herrania umbratica (XP_021288005.1) | 59.67% |
Populus euphratica (XP_011012784.1) | 61.34% |
Populus alba (XP_034910133.1) | 61.66% |
Populus trichocarpa (XP_002310688.1) | 61.66% |
Manihot esculenta (XP_021606973.1) | 58.6% |
Medicago truncatula (XP_003595973.1) | 57.5% |
Hevea brasiliensis (XP_021644348.1) | 61.66% |
Jatropha curcas (XP_012072721.1) | 59.28% |
Ricinus communis (XP_002529954.1) | 58.07% |
Pyrus × bretschneideri (XP_009336675.1) | 57.06% |
Prunus avium (XP_021832498.1) | 56.02% |
Juglans regia (XP_018838950.1) | 58.97% |
Juglans microcarpa × Juglans regia (XP_040989265.1) | 60.26% |
Carya illinoinensis (XP_042951768.1) | 59.55% |
Quercus lobata (XP_030961789.1) | 56.8% |
Lupinus angustifolius (XP_019443758.1) | 57.28% |
Cicer arietinum (XP_004488843.1) | 58.46% |
Abrus precatorius (XP_027343628.1) | 58.28% |
Glycine soja (XP_028244150.1) | 59.74% |
Cajanus cajan (XP_020223961.1) | 59.18% |
Phaseolus vulgaris (XP_007149262.1) | 60.65% |
Vigna angularis (XP_017423259.1) | 61.09% |
Gene | GenBank Accession Number | Primer Name | Primer Sequence | Melting Temperature |
---|---|---|---|---|
FmNAC1 | MG269829.1 | FmNAC1-F | 5′-TCTATCACCTCCGCCATC-3′ | 53.1 °C |
FmNAC1-R | 5′-TCAATAATGGTTCCACTGC-3′ | 52.3 °C |
Gene | GenBank Accession Number | Primer Name | Primer Sequence | Melting Temperature |
---|---|---|---|---|
NbIAA | XM_016592822.1 | q NbIAA-F | 5′GCCTCCTTCCACATTCCC3′ | 57 °C |
q NbIAA-R | 5′AGTCCACGTTTCGCACCA3′ | 57.4 °C | ||
NbAUX1 | NM_001326023.1 | q NbAUX1-F | 5′AGGCTACTGCCCTACCAC3′ | 52 °C |
qNbAUX1-R | 5′CAGCAACTGTATTCCCACA3′ | 51.8 °C | ||
NbICE | XM_016610394.1 | q NbICE-F | 5′CCCATCATTCCATTTGCT3′ | 53.3 °C |
q NbICE-R | 5′CCATTATCCCACTTCCTCT3′ | 51.1 °C | ||
NbDREB | NM_001325812.1 | q NbDREB-F | 5′GGCTTGGCACTTTCCCTT3′ | 57.3 °C |
qNbDREB-R | 5′AATAGCGCCTCCTCATCC3′ | 54.3 °C | ||
NbCBF | NM_001325227.1 | q NbCBF-F | 5′GGGGAATAAGGAGGAGAA3′ | 51 °C |
q NbCBF-R | 5′CTGAAGTCGGGATGGGTA3′ | 53.2 °C | ||
NbCAT | NM_001325412.1 | q NbCAT-F | 5′AATCATAGCCACGCCACC3′ | 56.2 °C |
q NbCAT-R | 5′CGAATAGTAAAGACCAGGGA3′ | 52.2 °C | ||
NbSOD | XM_016581519.1 | q NbSOD-F | 5′GATCTGGGAAGAGGTGGA3′ | 51.7 °C |
q NbSOD-R | 5′CAGCCCTAATGATAAACTGA3′ | 50.5 °C | ||
NbTU | XM_016640346.1 | qNbTU-F | 5′ATGTTGTTAGGAAGGAGGCT3′ | 53.2 °C |
qNbTU-R | 5′ATCATGCGGTCAGGGTAT3′ | 52.6 °C | ||
FmNAC1 | MG269829.1 | qFmNAC1-F | 5′AATGGATAATCGGCTGTG3′ | 50.9 °C |
qFmNAC1-R | 5′CCTTACGAAGAATCGGTCTA3′ | 52.4 °C | ||
FmTU | qPT-PCR | qFmTU-F | 5′AGGACGCTGCCAACAACTTT3′ | 59.8 °C |
qFmTU-R | 5′TTGAGGGGAAGGGTAAATAGTG3′ | 58.0 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, Y.; He, L.; Lu, S.; Wang, Y.; Zhang, C.; Zhan, Y. Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco. Forests 2024, 15, 1405. https://doi.org/10.3390/f15081405
Cao Y, He L, Lu S, Wang Y, Zhang C, Zhan Y. Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco. Forests. 2024; 15(8):1405. https://doi.org/10.3390/f15081405
Chicago/Turabian StyleCao, Yang, Liming He, Shengdian Lu, Yuling Wang, Chenxi Zhang, and Yaguang Zhan. 2024. "Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco" Forests 15, no. 8: 1405. https://doi.org/10.3390/f15081405
APA StyleCao, Y., He, L., Lu, S., Wang, Y., Zhang, C., & Zhan, Y. (2024). Function of the NAC1 Gene from Fraxinus mandshurica in Cold Resistance and Growth Promotion in Tobacco. Forests, 15(8), 1405. https://doi.org/10.3390/f15081405