Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Fungal Isolates
2.2. Wood Material
2.3. Spore Trapping Experiments
2.4. DNA Extraction
2.5. Real-Time PCR and Conventional PCR
2.6. Growth Rates at Different Temperatures
2.7. Wood Degradation
2.8. Statistical Analysis
3. Results
3.1. Design of Primers and Dual-Labelled Probes for the Detection of F. fomentarius s.l. and F. inzengae/Fomes sp. from Asia and Survey in Belgian Beech Forests
3.2. Performance of the qPCR Methods Developed for the Detection of F. fomentarius s.l. and the Lineages F. inzengae/Fomes sp. from Asia
3.3. Identification of Fomes inzengae as an Endophyte in Belgian Beech Forests
3.4. Periods of Spore Release
3.5. Growth at Different Temperatures for F. inzengae and F. fomentarius s.s.
3.6. Wood Degradation
4. Discussion
4.1. Rapid Detection Tools for Two Species of the F. fomentarius s.l. Complex
4.2. Fomes inzengae Is Present in Beech Wood in Belgian Forests
4.3. Aerial Inoculum of F. inzengae Varies Greatly from Year to Year
4.4. Fomes inzengae and F. fomentarius s.s. Display Different Ecological Characteristics
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bolte, A.; Czajkowski, T.; Kompa, T. The north-eastern distribution range of European beech—A review. Forestry 2007, 80, 413–429. [Google Scholar] [CrossRef]
- Caudullo, G.; Welk, E.; San-Miguel-Ayanz, J. Chorological maps for the main European woody species. Data Brief 2017, 12, 662–666. [Google Scholar] [CrossRef] [PubMed]
- Alderweireld, M.; Burnay, F.; Pitchugin, M.; Lecomte, H. Inventaire Forestier Wallon—Résultats 1994–2012; SPW: Jambes, Belgium, 2015; pp. 48–61. ISBN 978-2-8056-0171-2. [Google Scholar]
- Scharnweber, T.; Manthey, M.; Criegee, C.; Bauwe, A.; Schröder, C.; Wilmking, M. Drought matters—Declining precipitation influences growth of Fagus sylvatica L. and Quercus robur L. in north-eastern Germany. For. Ecol. Manag. 2011, 262, 947–961. [Google Scholar] [CrossRef]
- Latte, N.; Lebourgeois, F.; Claessens, H. Growth partitioning within beech trees (Fagus sylvatica L.) varies in response to summer heat waves and related droughts. Trees 2016, 30, 189–201. [Google Scholar] [CrossRef]
- Latte, N.; Perin, J.; Kint, V.; Lebourgeois, F.; Claessens, H. Major Changes in Growth Rate and Growth Variability of Beech (Fagus sylvatica L.) Related to Soil Alteration and Climate Change in Belgium. Forests 2016, 7, 174. [Google Scholar] [CrossRef]
- Pirronitto, S.; Teng, F.; Chandelier, A. Le dépérissement du hêtre en Ardenne: Résultat d’une étude menée de 2019 à 2022. Forêt.Nature 2023, 164, 35–42. [Google Scholar]
- Zimmermann, J.; Hauck, M.; Dulamsuren, C.; Leuschner, C. Climate Warming-Related Growth Decline Affects Fagus sylvatica, But Not Other Broad-Leaved Tree Species in Central European Mixed Forests. Ecosystems 2015, 18, 560–572. [Google Scholar] [CrossRef]
- Arend, M.; Link, R.M.; Zahnd, C.; Hoch, G.; Schuldt, B.; Kahmen, A. Lack of hydraulic recovery as a cause of post-drought foliage reduction and canopy decline in European beech. New Phytol. 2022, 234, 1195–1205. [Google Scholar] [CrossRef]
- Langer, G.J.; Buβkamp, J. Vitality loss of beech: A serious threat to Fagus sylvatica in Germany in the context of global warming. J. Plant Dis. Prot. 2023, 130, 1101–1115. [Google Scholar] [CrossRef]
- Neycken, A.; Scheggia, M.; Lévesque, M. Long term growth decline precedes sudden crown dieback of European beech. Agric. For. Meteorol. 2022, 324, 109103. [Google Scholar] [CrossRef]
- Gilmartin, E.C.; Jusino, M.A.; Pyne, E.J.; Banik, M.T.; Lindner, D.L.; Boddy, L. Fungal Endophytes and Origins of Decay in Beech (Fagus Sylvatica) Sapwood. Fungal Ecol. 2022, 59, 101161. [Google Scholar] [CrossRef]
- Srivastava, S.; Kumar, R.; Singh, V.P. Wood Decaying Fungi; Lambert Academic Publishing: Saarbrücken, Germany, 2013; p. 76. ISBN 978-3659326370. [Google Scholar]
- Phillips, D.H.; Burdekin, D.A. Diseases beech (Fagus sylvatica). In Diseases of Forest and Ornamental Trees; Phillips, D.H., Burdekin, D.A., Eds.; The Macmillan Press Ltd.: London, UK; Basingstoke, UK, 1992; pp. 259–271. ISBN 978-1-349-10955-5. [Google Scholar]
- Baum, S.; Sieber, T.N.; Schwarze, F.W.M.R.; Fink, S. Latent infections of Fomes fomentarius in the xylem of European beech (Fagus sylvatica). Mycol. Prog. 2003, 2, 141–148. [Google Scholar] [CrossRef]
- Boddy, L.; Rayner, A.D.M. Origins of decay in living deciduous trees: The role of moisture content and a re-appraisal of the expanded concept of tree decay. New Phytol. 1983, 94, 623–641. [Google Scholar] [CrossRef]
- Judova, J.; Dubikova, K.; Gaperova, S.; Gaper, J.; Pristas, P. The occurrence and rapid discrimination of Fomes fomentarius genotypes by ITS-RFLP analysis. Fungal Biol. 2012, 116, 155–160. [Google Scholar] [CrossRef] [PubMed]
- McCormick, M.A.; Grand, L.F.; Post, J.B.; Cubeta, M.A. Phylogenetic and Phenotypic Characterization of Fomes Fasciatus and Fomes Fomentarius in the United States. Mycologia 2013, 105, 1524–1534. [Google Scholar] [CrossRef] [PubMed]
- Pristas, P.; Gaperova, S.; Gaper, J.; Judova, J. Genetic variability in Fomes fomentarius reconfirmed by translation elongation factor 1-α DNA sequences and 25S LSU rRNA sequences. Biologia 2013, 68, 816–820. [Google Scholar] [CrossRef]
- Dresch, P.; D’Aguanno, M.N.; Rosam, K.; Grienke, U.; Rollinger, J.M.; Peintner, U. Fungal strain matters: Colony growth and bioactivity of the European medicinal polypores Fomes fomentarius, Fomitopsis pinicola and Piptoporus betulinus. AMB Express 2015, 5, 4. [Google Scholar] [CrossRef]
- Peintner, U.; Kuhnert-Finkernagel, R.; Wille, V.; Biasioli, F.; Shiryaev, A.; Perini, C. How to resolve cryptic species of polypores: An example in Fomes. IMA Fungus 2019, 10, 17. [Google Scholar] [CrossRef]
- Garrido-Benavent, I.; Velasco-Santos, J.M.; Perez-de-Gregoria, M.A.; Pasaban, P.M. Fomes inzengae (Ces. & De Not.) Cooke en la Península Ibérica. Butll. Soc. Micol. Valencia 2020, 24, 151–170. [Google Scholar]
- Náplavová, K.; Gáper, J.; Gáperová, S.; Beck, T.; Pristaš, P.; Soares, C.; Lima, N. Genetic and plant host differences of Fomes fomentarius in selected parts of Southern Europe. Plant Biosyst. 2020, 154, 125–127. [Google Scholar] [CrossRef]
- Tomṡovsky, M.; Kaeochulsri, S.; Kudláček, T.; Dálya, L.B. Ecological, morphological and phylogenetic survey of Fomes fomentarius and F. inzengae (Agaricomycetes, Polyporaceae) co-occuring in the same geographic area in Central Europe. Mycol. Prog. 2023, 22, 79. [Google Scholar] [CrossRef]
- Van der Perre, R.; Bythell, S.; Bogaert, P.; Claessens, H.; Ridremont, F.; Tricot, C.; Vincke, C.; Ponette, Q. La carte bioclimatique de Wallonie: Un nouveau découpage écologique du territoire pour le choix des essences forestières. Forêt. Nature 2015, 135, 47–58. [Google Scholar]
- Garbelotto, M.; Smith, T.; Schweigkofler, W. Variation in Rates of Spore Deposition of Fusarium circinatum, the Causal Agent of Pine Pitch Canker, over a 12-Month-Period at Two Locations in Northern California. Phytopathology 2008, 98, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Parfitt, D.; Hunt, J.; Dockrell, D.; Rogers, H.; Boddy, L. Do all trees carry the seeds of their own destruction? PCR reveals numerous wood decay fungi latently present in sapwood of a wide range of angiosperm trees. Fungal Ecol. 2010, 3, 338–346. [Google Scholar] [CrossRef]
- Gardes, M.; Bruns, T.D. ITS primers with enhanced specificity for basidiomycetes: Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. ISBN 978-0-12-372180-8. [Google Scholar]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- NBN EN 113-2; Durability of Wood and Wood-Based Products—Test Method Against Wood Destroying Basidiomycetes—Part 2: Assessment of Inherent or Enhanced Durability. European Committee for Standardization: Brussels, Belgium, 2021.
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 2 February 2023).
- Wickham, H.; François, R.; Henry, L.; Müller, K. dplyr: A Grammar of Data Manipulation. R Package Version 0.8.0.1. 2019. Available online: https://CRAN.R-project.org/package=dplyr (accessed on 2 February 2023).
- Signorell, A. DescTools: Tools for Descriptive Statistics. Available online: https://cran.r-project.org/web/packages/DescTools/index.html (accessed on 2 February 2023).
- Fox, J.; Weisberg, S.; Price, B. Car: Companion to Applied Regression. Available online: https://cran.r-project.org/web/packages/car/index.html (accessed on 2 February 2023).
- Hothorn, T.; Bretz, F.; Westfall, P. Simultaneous Inference in General Parametric Models. Biom. J. 2008, 50, 346–363. [Google Scholar] [CrossRef]
- Kay, M.; Elkin, L.A.; Higgins, J.J.; Wobbrock, J.O. mjskay/ARTool: ARTool 0.11.0 (v0.11.0). Available online: https://zenodo.org/records/4721941 (accessed on 2 February 2023).
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis, 2nd ed.; Springer: New York, NY, USA, 2016; p. 260. ISBN 978-3-319-24277-4. Available online: https://ggplot2.tidyverse.org (accessed on 2 February 2023).
- Faticov, M.; Desprez-Loustau, M.L.; Levente, K.; Massot, M.; Faivre d’Acier, J.; Mutz, J.; Nemeth, M.Z.; Roslin, T.; Tack, A.J.M. Niche differentiation within a cryptic pathogen complex: Climatic drivers and hyperparasitism at multiple spatial scales. Ecography 2022, 2, e06062. [Google Scholar] [CrossRef]
- Wang, R.; Tsui, C.K.M.; You, C. Cryptic species diversity and phylogenetic relationship in the rust Genus Chrysomyxa from China. J. Fungi 2022, 8, 83. [Google Scholar] [CrossRef]
- Sakalidid, M.L.; Slippers, B.; Wingfield, B.D.; Hardy, G.E.S.J.; Burgess, T.I. The challenge of understanding the origin, pathways and extent of fungal invasions: Global populations of the Neofusicoccum parvum-N. ribis species complex. Divers. Distrib. 2013, 19, 873–883. [Google Scholar] [CrossRef]
- Ghelardini, L.; Pepori, A.L.; Luchi, N.; Capretti, P.; Santini, A. Drivers of Emerging Fungal Diseases of Forest Trees. For. Ecol. Manag. 2016, 381, 235–246. [Google Scholar] [CrossRef]
- Gonthier, P.; Nicolotti, G.; Linzer, R.; Guglielmo, F.; Garbelotto, M. Invasion of European pine stands by a North American forest pathogen and its hybridization with a native interfertile taxon. Mol. Ecol. 2007, 16, 1389–1400. [Google Scholar] [CrossRef] [PubMed]
- Gonthier, P.; Guglielmo, L.; Giordano, L.; Garbelotto, M. The American forest pathogen Heterobasidion irregulare colonizes unexpected habitats after its introduction in Italy. Ecol. Appl. 2012, 22, 2135–2143. [Google Scholar] [CrossRef] [PubMed]
- Badalyan, S.; Zhuykova, E.; Mukhin, V. The Phylogenetic Analysis of Armenian Collections of Medicinal Tinder Polypore Fomes Fomentarius (Agaricomycetes, Polyporaceae). Ital. J. Mycol. 2022, 51, 23–33. [Google Scholar] [CrossRef]
- Badalyan, S.; Zhuykova, E.; Mukhin, V. Genetic variability of the medicinal tinder bracket polypore, Fomes fomentarius (Agaricomycetes), from the Asian part of Russia. Int. J. Med. Mushrooms 2018, 20, 561–568. [Google Scholar]
- Cristini, V.; Nop, P.; Zlámal, J.; Vand, M.H.; Šeda, V.; Tippner, J. Fomes Fomentarius and F. inzengae—A Comparison of Their Decay Patterns on Beech Wood. Microorganisms 2023, 11, 679. [Google Scholar] [CrossRef]
- Alcazar, P.; Galan, C.; Carinanos, P.; Dominguez-Vilches, E. A new adhesive for airborne pollen sampling in Spain. Aerobiologia 2003, 19, 57–61. [Google Scholar] [CrossRef]
- Chandelier, A.; Helson, M.; Dvorak, M.; Gischer, F. Detection and quantification of airborne inoculum of Hymenoscyphus pseudoalbidus using real-time PCR assays. Plant Pathol. 2014, 63, 1296–1305. [Google Scholar] [CrossRef]
- Bari, E.; Taghiyari, H.R.; Mohebby, B.; Clausen, C.A.; Schmidt, O.; Tajick Ghanbary, M.A.; Vaseghi, M.J. Mechanical properties and chemical composition of beech wood exposed for 30 and 120 days to white-rot fungi. Holzforschung 2015, 69, 587–593. [Google Scholar] [CrossRef]
Type of Material | Location (Stand Nr) | Number of Isolates | Collection Period |
---|---|---|---|
Monokaryotic | Louette-Saint-Pierre (2) | 6 a | April 2020 |
Monokaryotic | Séviscourt (3) | 6 | April 2020 |
Monokaryotic | Sainte-Cécile (4) | 2 | April 2020 |
Monokaryotic | Nassogne (5) | 10 b | April 2020 |
Monokaryotic | Carlsbourg (6) | 2 | April 2020 |
Monokaryotic | Spa (7) | 9 | April 2020 |
Monokaryotic | Elsenborn (8) | 1 | April 2020 |
Monokaryotic | Mogimont (11) | 1 | April 2020 |
Monokaryotic | Bullange (12) | 9 | April 2020 |
Dikaryotic | Séviscourt (3) | 10 | March 2021 |
Dikaryotic | Nassogne (5) | 31 | March 2021 |
Dikaryotic | Spa (7) | 29 c | March 2021 |
Dikaryotic | Vielsalm (9) | 2 | March 2021 |
Dikaryotic | Vaux-Sur-Sure (10) | 30 d | March 2021 |
Target | Primer Name | Sequence | Reference |
---|---|---|---|
F. fomentarius s.l. (test 1) | FomesF5 | 5′ ggatgttggaggcttttgct 3′ | This study |
FomesP2 | 6-FAM-5′ atcggctgtcggtgtgat 3′-BHQ1 | ||
FomesR3 | 5′ agctgtctctgacgagaccat 3′ | ||
F. inzengae & Fomes sp. (Asia) (test 2) | FinzF3 | 5′ cgaatctttgaacgcacctt 3′ | This study |
FinzP | 6-FAM-5′ gccctcgtttgagtcagc 3′-BHQ1 | ||
FinzR3 | 5′ gcaaggaaccaagctaatgc 3′ | ||
F. fomentarius s.l. | FfomF | 5′ gggttgtagctggccttc 3′ | [27] |
FfomR | 5′ ccagcaaaagcctccaatc 3′ | ||
ITS of fungi | ITS1F | 5′cttggtcatttagaggaagtaa 3′ | [28] |
ITS5 | 5′ ggaagtaaaagtcgtaacaagg 3′ | [29] | |
ITS4 | 5′ tcctccgcttattgatatgc 3′ |
Fungal Species | Material for DNA Extraction | Collection Code | Country of Origin | Collection Period |
---|---|---|---|---|
Armillaria gallica | Mycelium | 3342 | France * | 1993 |
Bjerkandera adusta | Mycelium | 2523 | Belgium | 2003 |
Daedaleopsis confragosa | Basidiocarp | Belgium | 2010 | |
Fomes fomentarius s.s. (monokaryotic) | Mycelium | 5705 | Belgium | 2010 |
Fomes fomentarius s.s. (dikaryotic) | Mycelium | 5706 | Belgium | 2021 |
F. inzengae (dikaryotic) | Mycelium | 5704 | Belgium | 2021 |
F. inzengae (monokaryotic) | Mycelium | 5711 | Belgium | 2021 |
Fomitopsis pinicola | Basidiocarp | Belgium | 2019 | |
Fusarium solani | Mycelium | 5733 | Belgium | 2022 |
Ganoderma adspersum | Basidiocarp | Belgium | 2010 | |
Ganoderma applanatum | Basidiocarp | Belgium | 2010 | |
Phytophthroa x cambivora | Mycelium | P3398 | Belgium | 2005 |
Picipes badius | Basidiocarp | Belgium | 2010 | |
Trametes versicolor | Basidiocarp | Belgium | 2018 | |
Trametes hirsuta | Basidiocarp | Belgium | 2018 | |
Trametes versicolor | Mycelium | 3561 | Belgium | 2018 |
Test | Target | Slope | Constant | R2 | Log | LOD |
---|---|---|---|---|---|---|
1 | Fomes fomentarius s.l. | −3.368 | 37.372 | 0.999 | 6 | 10 |
2 | Fomes sp. Asia & F. inzengae | −3.506 | 40.098 | 0.999 | 6 | 10 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pirronitto, S.; Teng, F.; Verheyen, C.; Gaucet, V.; Henin, J.-M.; Jourez, B.; Schmitz, S.; Chandelier, A. Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests. Forests 2024, 15, 221. https://doi.org/10.3390/f15020221
Pirronitto S, Teng F, Verheyen C, Gaucet V, Henin J-M, Jourez B, Schmitz S, Chandelier A. Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests. Forests. 2024; 15(2):221. https://doi.org/10.3390/f15020221
Chicago/Turabian StylePirronitto, Salvatore, Felix Teng, Cécile Verheyen, Vincent Gaucet, Jean-Marc Henin, Benoit Jourez, Sophie Schmitz, and Anne Chandelier. 2024. "Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests" Forests 15, no. 2: 221. https://doi.org/10.3390/f15020221
APA StylePirronitto, S., Teng, F., Verheyen, C., Gaucet, V., Henin, J.-M., Jourez, B., Schmitz, S., & Chandelier, A. (2024). Characterization of Fomes fomentarius s.s. and F. inzengae in Belgian Beech Forests. Forests, 15(2), 221. https://doi.org/10.3390/f15020221