Next Article in Journal
An Improved Grid-Based Carbon Accounting Model for Forest Disturbances from Remote Sensing and TPO Survey Data
Next Article in Special Issue
Intercropping Shapes the Metabolome and Microbiome of Medicinal Giant Lily (Cardiocrinum giganteum) in Bamboo, Chinese Fir, and Mixed Forests
Previous Article in Journal
Effects of Ectomycorrhizae and Hyphae on Soil Fungal Community Characteristics Across Forest Gap Positions
Previous Article in Special Issue
The Impact of Bamboo (Phyllostachys edulis) Expansion on the Water Use Patterns of Broadleaf Trees
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics

1
Sanya Research Base, International Centre for Bamboo and Rattan, Sanya 572022, China
2
National Agricultural Exhibition Center, China Agricultural Museum, Beijing 100125, China
3
International Center for Bamboo and Rattan, Key Laboratory of National Forestry and Grassland Administration, Beijing for Bamboo & Rattan Science and Technology, Beijing 100102, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(12), 2132; https://doi.org/10.3390/f15122132
Submission received: 3 October 2024 / Revised: 21 November 2024 / Accepted: 28 November 2024 / Published: 2 December 2024

Abstract

Phyllostachys edulis, an economically and ecologically significant bamboo species, has substantial research value in applications as a bamboo substitute for plastic and in forest carbon sequestration. However, frequent seasonal low-temperature events due to global climate change affect the growth, development, and productivity of P. edulis. Calcium signaling, serving as a versatile second messenger, is involved in various stress responses and nitrogen metabolism. In this study, we analyzed the calcium signaling dynamics and regulatory strategies in P. edulis under chilling stress. Differentially expressed genes (DEGs) from the CBF families, AMT families, NRT families, and Ca2+ sensor families, including CaM, CDPK, and CBL, were identified using transcriptomics. Additionally, we explored the law of Ca2+ flux and distribution in the roots of P. edulis under chilling stress and validated these findings by assessing the content or activity of Ca2+ sensor proteins and nitrogen transport proteins in the roots. The results indicated that the Ca2+ sensor families of CaM, CDPK, and CBL in P. edulis exhibited significant transcriptional changes under chilling stress. Notably, PH02Gene03957, PH02Gene42787, and PH02Gene19300 were significantly upregulated, while the expressions of PH02Gene08456, PH02Gene01209, and PH02Gene37879 were suppressed. In particular, the expression levels of the CBF family gene PH02Gene14168, a downstream target gene of the calcium channels, increased significantly. P. edulis exhibited an influx of Ca2+ at the root, accompanied by oscillating negative peaks under chilling stress. Spatially, the cytosolic calcium concentration ([Ca2+]cyt) within the root cells increased. The CIPK family genes, interacting with Ca2+-CBL in downstream signaling pathways, showed significant differential expressions. In addition, the expressions of the NRT and AMT family genes changed correspondingly. Our study demonstrates that Ca2+ signaling is involved in the regulatory network of P. edulis under chilling stress. [Ca2+]cyt fluctuations in the roots of P. edulis are induced by chilling stress, reflecting an influx of extracellular Ca2+. Upon binding to Ca2+, downstream target genes from the CBF family are activated. Within the Ca2+–CBL–CIPK signaling network, the CIPK family plays a crucial role in nitrogen metabolism pathways.

1. Introduction

Moso bamboo (Phyllostachys edulis) belongs to the Poaceae family and is a typical clonal plant, with both economic and ecological uses. Moso bamboo has a well-developed underground rhizome system, fast reproduction, rapid growth, and a high yield. P. edulis plays a crucial role in the “Bamboo as a Substitute for Plastic Initiative”, mitigating the supply–demand conflict for wood and contributing to carbon sequestration in response to climate change. According to the Intergovernmental Panel on Climate Change (IPCC), extreme global climate changes have intensified in recent years, which has increased the probability of encountering sudden and seasonal low-temperature stress [1]. Temperature, a critical factor for bamboo growth, affects physiological activities such as shoot emergence and rhizome expansion, thereby limiting the productivity and geographical distribution of P. edulis [2,3].
Low-temperature stress includes chilling stress (0–5 °C) and freezing stress (<0 °C), with 4 °C generally considered to be the threshold for chilling injury in the majority of plant species [4]. Chilling stress consistently triggers a cascade of alterations within plants, which includes damage to cell membranes associated with ion leakage, fluctuations in the content of proline (Pro), and the accumulation of reactive oxygen species (ROS) [5,6,7]. Furthermore, it promotes the synthesis of stress-responsive enzymes, including superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD), which serve to regulate the concentration of free radicals and preserve the equilibrium between antioxidants and free radicals [8,9,10].
Calcium ions (Ca2+) act as a pivotal second messenger, playing a key role in the signaling pathways that mediate plant responses to both biotic and abiotic stresses. The emergence and termination of calcium signal cascades are governed by the intricate modulation of intracellular Ca2+ levels, which encompass transient spikes and declines, as well as rhythmic oscillations. In response to extracellular environmental perturbations, plant cells encode a unique “calcium signature”, which serves as a biochemical fingerprint of their tailored biotic and abiotic stress response pathways. When plants are under stress, Ca2+ can be encoded in the form of spikes, waves, and oscillations, which are captured by Ca2+ sensors. The decoding process activates downstream defense signals, triggering the signaling pathways involved in plant growth and development [11,12]. The process of “decoding” by calcium signals has been extensively studied, with the decoding of calcium signals being facilitated by a variety of Ca2+ sensors. In plants, Ca2+ sensors are categorized into two types of Ca2+ sensor proteins with distinct structural features and functions, as follows: sensor responder proteins and sensor relay proteins. Sensor responder proteins include calcium-dependent protein kinases (CDPKs), while sensor relay proteins include calmodulins (CaMs) and calcineurin B-like proteins (CBLs). Sensor responder proteins, CDPKs, upon Ca2+ binding, modulate downstream signaling pathways either by modulating their kinase activities or undergoing conformational changes [13,14,15]. After binding to Ca2+, sensor relay proteins must interact with target proteins to regulate downstream signaling pathways, with key players including CaM and CBL [16,17,18,19]. Upon binding with Ca2+, these proteins modulate their own activity or that of target proteins, regulating the expression of downstream target genes and influencing cellular functions [20].
A previous study suggested that the COLD1 gene modulates G-protein signaling, conferring chilling tolerance in rice, and a single-nucleotide polymorphism (SNP) within COLD1 is associated with the adaptation to cold environments in japonica rice [21]. Intracellular Ca2+ dynamics are crucial for mediating the signal transduction pathways and inducing appropriate cellular stress responses. The overexpression of PsCor413pm2, a cold-regulated (COR) gene isolated from Phlox subulata, enhances low-temperature tolerance in Arabidopsis by affecting Ca2+ flux and the expressions of the stress-related genes COR and CBF [22]. CbFAD3 confers multiple-stress tolerance to tobacco through the C18:3-induced integrated regulation of the membrane, Ca2+, ROS, and stress-responsive genes [23]. Upon binding with Ca2+, the CBL family of Ca2+ sensors interact with calcineurin B-like interacting protein kinases (CIPKs), regulating the expression of downstream target genes [20]. Advanced genetic research has established the central role of the CBL–CIPK signaling system in modulating plant adaptive responses to adverse environmental conditions. Notably, CIPKs play crucial roles under chilling stress. Specifically, a point mutation in OsCIPK7 resulted in a conformational and kinase activity change, leading to an increased tolerance to chilling stress [24]. It is of particular interest that CIPKs are critically involved in the nitrogen assimilation process, exerting regulatory control over the post-translational modification mechanisms that dictate the nitrogen metabolic pathways. Studies on the CBL–CIPK signaling network have shown that, under fluctuating nitrate (NO3) concentrations, the CBL9–CIPK23 complex phosphorylates the nitrate transporter CHL1, altering its transport affinity and sensing ability for NO3. In response to elevated ammonium (NH4+) levels, the CBL1–CIPK23 complex inhibits the activity of AMT1-type ammonium transporters to prevent excessive NH4+ accumulation [25]. Both nitrate transport proteins (NRTs) and ammonium transport proteins (AMTs) are involved in nitrogen absorption and transport. Collectively, these studies indicate that plants have evolved a variety of physiological and molecular mechanisms to cope with cold stress, with a critical reliance on Ca2+ signaling pathways [26].
Previous studies have indicated that significant changes occur in the physiological indicators and ICE genes of P. edulis when P. edulis seedlings are subjected to 4 °C chilling stress, and a series of coordinated responses, including elevated reactive oxygen species (ROS) levels, a pronounced increase in the proline (Pro) concentration, and enhanced activities of superoxide dismutase (SOD) and peroxidase (POD) (p < 0.05), are subsequently triggered. Concurrently, the PeICE gene undergoes significant upregulation, implicating its involvement in the cold acclimation process [27]. However, the physiological response mechanism of P. edulis to chilling stress based on signaling has not been systematically reported.
To fill this research gap, our study subjected P. edulis seedlings to chilling stress at 4 °C. We employed Non-Invasive Micro-Test Technology (NMT) to measure the net fluxes of Ca2+, NH4+, and NO3. Additionally, Confocal Laser Scanning Microscopy was utilized for the fluorescence imaging of Ca2+. The enzymatic activity and protein content associated with chilling stress were assessed. Through transcriptomics, differentially expressed genes (DEGs) from various families were identified, including CBF (C-repeat binding factor), AMT (ammonium transporter), NRT (nitrate transporter), and Ca2+ sensor families, such as calmodulin (CaM), calcium-dependent protein kinase (CDPK), and CBL (calcineurin B-like) proteins. This study concentrated on the signaling pathways and regulatory strategies in P. edulis seedlings under chilling stress. The goal of this research was to enhance comprehension of the chilling resistance mechanisms in P. edulis, providing data to facilitate the early detection of low-temperature stress and to inform bamboo breeding programs and the development of evidence-based cultivation strategies, ultimately enhancing this bamboo’s economic and environmental sustainability.

2. Materials and Methods

2.1. Plant Materials and Chilling Treatment

One-year-old P. edulis seedings, originating from the same parent clone and exhibiting a similar growth vigor, were utilized in this study. The one-year-old P. edulis seedlings were cultivated in Hongya, Sichuan (103.28° E, 29.52° N) (Figure 1). The experimental treatments were divided into the following two types: cold-shock and continuous chilling stress treatments.

2.1.1. Cold-Shock Treatment Experiment

The roots of P. edulis were treated using the experimental setup depicted in Figure 2, with one-year-old seedling root segments immobilized in the measuring solution. For the cold-shock treatment, the kinetics of transient Ca2+, NH4+, and NO3 fluxes under chilling stress (4 °C) were measured in the seedling’s meristematic zone. During detection, a 35 mm small Petri dish was placed inside a 90 mm large Petri dish containing low-temperature insulation medium. Initially, the small Petri dish was filled with test solution at 25 °C, and measurements were taken for 5 min at this temperature. Subsequently, the test solution at 25 °C in the small Petri dish was replaced with pre-chilled test solution at 4 °C, while the large Petri dish was also filled with 4 °C low-temperature insulation liquid. Concurrently, Ca2+ flux was measured for an additional 10 min.

2.1.2. Chilling Treatment Experiment

Utilizing a photoperiodic incubator, one-year-old P. edulis seedlings were subjected to a 4 °C chilling treatment (chilling stress) and 25 °C control treatment. The relative humidity was maintained at 70%–80%, with a photosynthetic photon flux density of 20,000 LX throughout the treatment. Root sampling was performed after 2, 4, and 6 h of treatment, with three replicates for each condition. A total of nine plants were collected per group. The samples were carefully washed and stored for subsequent transcriptomics and physiological analyses, ensuring that the water temperature used for washing matched the treatment temperature to maintain consistency.

2.2. RNA Extraction, Illumina Library Construction, and Sequencing

Total RNA was extracted from the roots of P. edulis. The RNA purity was checked using the NanoPhotometer® spectrophotometer (IMPLEN, Los Angeles, CA, USA). RNA quantification was performed using a Qubit RNA Assay Kit and a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). Additionally, the RNA integrity was evaluated with an RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). Illumina sequencing library construction followed the method previously described [28,29]. The cDNA libraries were sequenced on the Illumina HiSeq platform by Wuhan MetWare Biological Science and Technology Co., Ltd. (Wuhan, China).

2.3. Sequencing Data Analysis

After the removal of adapter sequences and the elimination of low-quality reads containing unknown nucleotides, clean reads were extracted. A check for the distribution of GC content was conducted. For the assembly of these clean reads, the Trinity software (version r20140717) was employed. Unigene amino acid sequences were queried against the Pfam database using HMMER (version 3.0) with an E-value threshold of <0.01. Expression levels were estimated by comparing the sequenced reads to the unigene library with Bowtie and RSEM. Gene expression was quantified using FPKM values, normalized, and DEGs were identified between conditions A and B using DESeq2 with the criteria |Log2Fold Change| ≥ 1 and FDR < 0.05. The DEGs were classified based on their expression patterns, as follows: genes with positive condition values were considered to be upregulated, while those with negative values were deemed downregulated. Gene ontology (GO) enrichment was conducted using the topGO based on the Wallenius non-central hypergeometric distribution. KEGG pathway enrichment for the DEGs was performed using KOBAS 2.0. Statistical significance was determined with an alpha level set at 0.05.

2.4. Real-Time Quantitative Reverse Transcription PCR Analysis of DEGs

According to the gene sequences obtained, genes relevant to the calcium signaling pathways and showing a significant change in expression were selected for quantitative real-time PCR (qRT-PCR) to confirm the reliability of the transcriptome data. The total volume for each reaction was 10 μL, comprising 1 μL of specific primers (0.5 μL of forward primer and 0.5 μL of reverse primer), 1 μL of cDNA, 5 μL of 2 × SG Green qPCR Mix, and 3 μL of nuclease-free water. The cycling program was as follows: 3 min at 95 °C, followed by denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s, and extension at 72 °C for 35 s (40 cycles). The Tip41 gene was used as the internal control. All gene expression analyses included three biological replicates. The relative expression was calculated using the 2−ΔΔCt method. The primer pairs are listed in Table 1.

2.5. Net Ca2+, Net NH4+, and NO3 Fluxes Measurements

The net Ca2+, NH4+ and NO3 fluxes were measured using Non-Invasive Micro-Test Technology (NMT Physiolyzer, Younger USA LLC, Amherst, MA 01002, USA, Xuyue Company, Beijing, China), as described previously [30]. The composition of the test solution utilized for the measurement of Ca2+, NH4+, and NO3 fluxes, as well as the NMT detection sites for root ion fluxes, are detailed in Table 2.
In this study, a flux microsensor (Φ4.5 ± 0.5 μM) characterized by a Nernstian slope of ≥22 mV per decade was utilized, adhering to the following established standards for various ion sensitivities: a divalent cation slope of ≥22 mV/decade, a monovalent cation slope of ≥50 mV/decade, and a monovalent anion slope of ≤−50 mV/decade. The flux microsensor executed reciprocal movements, perpendicular to the sample surfaces, spanning a distance of 30 μM at a frequency of approximately 0.3 Hz. The microsensor’s tips were filled with electrolyte solution for approximately 1.0 cm in length (Figure 3). These sensors were front-filled with 40–50 μM columns of selective liquid ion exchange cocktails (Ca2+, NH4+, and NO3 LIX, XY-SJ-Ca, Xuyue (Beijing) Sci.&Tech. Co., Ltd., Beijing, China). Each microsensor was fitted with an Ag/AgCl wire flux microsensor holder (model YG003-Y11, Xuyue (Beijing) Sci.&Tech. Co., Ltd., Beijing, China) to establish electrical contact with the electrolyte solution.
Following each test, the microsensors were recalibrated using the same procedure and standards to ensure consistency and accuracy. Each analysis was conducted with six biological replicates.

2.6. Confocal Laser Scanning Microscopy for Fluorescence Imaging

The Ca2+ fluorescent probe, Fluo-3 AM (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China), was dissolved in anhydrous dimethyl sulfoxide (DMSO) (AAT Bioquest, Sunnyvale, CA, USA) to a final concentration of 1 mmol/L. The root was incubated at room temperature in the dark for 40 min. Subsequently, the root tips of P. edulis were rinsed with the buffer solution and further incubated for an additional 20 min to ensure the complete dissolution of the esterified probe. The samples were then mounted on a glass slide with 0.5 mL of Hank’s balanced salt solution for preparation. The distribution of the probe in the root tips of P. edulis was observed using a confocal laser scanning microscope (Stellaris 5, Leica, Germany), with excitation at a wavelength of 488 nm, which estimated the Ca2+ concentration dynamics in a specific area.

2.7. The Detection of Enzymatic Activity and Protein Content

In this study, we utilized enzyme-linked immunosorbent assay (ELISA) (Sinobest bio CO., Ltd., Shanghai, China) to quantify the key protein content in P. edulis seedling roots. Specifically, we focused on the levels of calmodulin (CaM), calcium-binding protein-like (CBL), nitrate transporters (NRTs), and ammonium transporters (AMTs), all of which play crucial roles in nutrient uptake and stress management. Adhering to the manufacturer’s guidelines, we measured optical densities at 450 nm to construct standard curves for accurate target protein quantification.
The activities of calcium-dependent protein kinases (CDPKs) and calcineurin B-like interacting protein kinases (CIPKs) in the roots from the tested plants were examined with the corresponding activity detection kit (Sinobest bio CO., Ltd., Shanghai, China) using roots detached from the treated plants. To ensure the accuracy and reproducibility of the results, ten replicate experiments were conducted.

2.8. Statistical and Visualization Analysis

Data analysis was conducted using Excel 2019 (version 16.64) (Microsoft, Redmond, WA, USA), SPSS (version 19.0) (SPSS Inc., Chicago, IL, USA), and RStudio software (version 3.6.2) products. The values are presented as the mean ± standard error (SE). Data were subjected to analysis of variance through the Student’s t-test and one-way analysis of variance (ANOVA) to determine significant differences, with p < 0.05 (*) and p < 0.01 (**) considered as the significance thresholds.

3. Results

3.1. Enrichment Analysis of Differentially Expressed Genes of P. edulis Under Chilling Stress

To identify the major functional terms enriched with DEGs, a GO enrichment analysis was conducted. The GO functional classifications of the DEGs between the control and chilling stress, shown in Figure 4, reveal the variations. The roots of the P. edulis seedlings subjected to chilling stress demonstrate a pronounced enrichment of DEGs within the three following principal Gene Ontology domains: biological processes (BPs), molecular functions (MFs), and cellular components (CCs). Specifically, the molecular function domain exhibits the most substantial enrichment, with 1447 DEGs identified. Notably, 30 genes were significantly enriched in calcium ion binding, including 20 upregulated and 10 downregulated differentially expressed genes. Additionally, calcium-dependent phospholipid binding was significantly enriched in four differentially expressed genes, which included one upregulated and three downregulated genes (Figure 4).
For the KEGG enrichment analysis, our study identified the key biological pathways involved in the response to chilling stress in P. edulis. The results highlighted the successful enrichment of 3185 DEGs into 86 metabolic pathways. Notably, six pathways with statistical significance (p ≤ 0.05) were identified as being significantly enriched, including 28 upregulated and 26 downregulated differentially expressed genes. The enrichment status of plant hormone signal transduction, the MAPK signaling pathway, phenylalanine, the biosynthesis of amino acids, and nitrogen metabolism pathways in the KEGG database deserves attention due to their potential roles in the stress response mechanism (Figure 5).
Regarding the GO and KEGG enrichment, our study revealed the key gene ontology terms and biological pathways associated with the response to chilling stress in P. edulis. It was observed that multiple metabolic pathways in the KEGG database, such as plant hormone signal transduction, the MAPK signaling pathway, and nitrogen metabolism, were all associated with calcium signaling [31]. The MAPK signaling pathway requires upstream Ca2+ signaling to mediate plant stress resistance responses. Under chilling stress, the Ca2+ signal activates CPKs and CBL-CIPKs, which initiate the MAPK cascade, leading to the phosphorylation of downstream effector proteins [32,33]. Under cold stress, the leaves of R. chrysanthum exhibited the significant enrichment of several pathways, including the MAPK cascade, ABA biosynthesis and signaling, plant–pathogen interactions, linoleic acid metabolism, and glycerophospholipid metabolism. The regulatory network, composed of the Ca2+ signal, ABA, and the MAPK cascade, triggers reactive oxygen species (ROS) production and induces stomatal closure. These interconnected pathways collectively contribute to the regulation of cold tolerance in R. chrysanthum [34]. Fatty acid metabolism contributes to plant stress tolerance by modulating the cell membrane structure and function under environmental stress, thereby affecting Ca2+ permeability [35]. Under cold stress, key transcription factors in the nitrogen metabolism pathway may jointly regulate the cold response with Ca2+ signaling [36,37]. Nitrogen and cold signals may phosphorylate different amino acid residues of NLP7 through various CPK proteins, with NLP7 acting downstream of CPK28 to decode cold-specific Ca2+ signals and regulate the expression of cold-responsive genes [38,39]. Calcium signaling is crucial in pathways that respond to cold stress by modulating [Ca2+]cyt. It plays a key role in plants’ adaptation and stress resistance to environmental stressors. Accordingly, this study analyzed the regulation of the calcium signaling pathway and found that genes upregulated under chilling stress were enriched in CALM and CAMK within the pathway. These are all part of the Ca2+ sensor proteins (Figure 6).

3.2. Expression Analysis of Calcium Signaling-Related Genes in P. edulis Under Chilling Stress

The KEGG pathway enrichment analysis indicated that DEGs of the CALM and CAMK families involved in the calcium signaling pathway were primarily enriched when P. edulis was under cold stress (Figure 6). By analyzing and filtering through the annotation files, we identified the DEGs associated with Ca2+ sensors and constructed a heatmap of gene expression. The analysis revealed that, under chilling stress, the genes related to Ca2+ sensors in the P. edulis roots exhibited significant differential expression at the transcriptional level. We identified 13 DEGs associated with the calcium-dependent protein kinase (CDPK) family. Additionally, we identified a total of 9 and 18 DEGs within the CaM and CBL protein families, respectively (Figure 7). Ca2+ sensor responder proteins directly regulate downstream processes by altering their kinase activity or conformation upon binding with Ca2+. Analysis of the differential gene expression heatmap for the sensor responder CDPK family revealed that, aside from PH02Gene08456 and PH02Gene09519, other family members such as PH02Gene03957 and PH02Gene10238 exhibited significant increases in their expression under cold stress (Figure 7a).
Additionally, after sensor relay proteins (e.g., CBLs) bind to Ca2+, they must interact with target proteins (e.g., CIPKs) to regulate downstream signaling. Under chilling stress, significant transcriptional changes occurred in CBLs and CaMs in the roots of P. edulis, with upregulation observed in some genes (e.g., PH02Gene42787 and PH02Gene19300) and downregulation in others (e.g., PH02Gene30913 and PH02Gene37879) (Figure 7b,c). Our research indicates that Ca2+ sensor proteins play critical roles in P. edulis, particularly in the regulation of the calcium signaling network during the chilling stress response. It is worth noting that, upon binding with Ca2+, CBLs still require interaction with CBL-interacting protein kinases (CIPKs) to form the Ca2+–CBL–CIPK signal transduction network, which is essential for decoding calcium signals and further regulating the expression of downstream target genes [25]. Our analysis of CIPK-related DEGs revealed that, under cold stress, genes such as PH02Gene23237 and PH02Gene35868 are upregulated, while the expressions of the PH02Gene42846 and PH02Gene06793 genes are suppressed (Figure 7d).
Interestingly, existing studies have highlighted the critical importance of CBL-interacting CIPKs in nitrogen metabolism. CIPK within the calcium signaling pathway is significantly linked to nitrogen metabolism [25]. The analysis of differential gene expressions under chilling stress conditions revealed significant upregulation in the transcriptional activity of several pivotal nitrogen transporter genes, including PH02Gene13036 from the NRT family and PH02Gene34530 from the AMT family, among others (Figure 8). This indicates that CIPKs and related genes play key roles in this plant’s chilling stress adaptation.
C-repeat binding factors (CBFs) play a pivotal role as transcription factors in the calcium signaling pathway of plants, essential for their chilling stress response [31]. In this study, we conducted a differential gene expression analysis of CBF family members in P. eduli roots. Compared to the control group, the 4 °C chilling treatment group displayed significant transcriptional variations in CBF-related genes. Specifically, PH02Gene14168 and PH02Gene04394 exhibited upregulation, whereas PH02Gene40881 and PH02Gene23251 showed downregulation (Figure 9).
The further validation of select genes, including Ca2+ sensor proteins and nitrogen transporter families, was detected using qRT-PCR. Nine genes were randomly selected from the transcriptome data for expression level assessment. The qRT-PCR results correlated well with the transcriptome sequencing data, as depicted in Figure 10, thereby confirming the reliability of our transcriptome sequencing approach.

3.3. The Ca2+ Flux and Distribution Law Under Chilling Stress in the Root Tips of P. edulis

Ca2+ links various signal pathways together and participates in many biochemical reactions, with altered Ca2+ levels observed when plants are exposed to biotic and abiotic stressors. The initiation and termination of calcium signaling are the result of increases and decreases, as well as fluctuations, in [Ca2+]cyt levels [20]. These calcium fluctuations increase the efficiency and specificity of gene expression [40]. Upon cold-shock treatment of the P. edulis seedlings’ roots, [Ca2+]cyt fluctuations occurred rapidly at the root tips, characterized by negative peaks (calcium spikes), indicative of a rapid Ca2+ influx (Figure 11a). Under 4 °C cold stress, the P. edulis seedlings were treated for 2 h, 4 h, and 6 h, respectively. The study found that the intensity of Ca2+ influx in the roots decreased in the order of 2 h > 4 h > 6 h > control. Compared to the control groups, the 2 h and 4 h chilling stress groups showed a stronger Ca2+ influx. However, the statistical analysis showed no significant difference in the Ca2+ flux between the control group and the samples after 2, 4, and 6 h of chilling stress (Figure 11a).
After the Ca2+ signal is encoded by Ca2+ increases, decreases, and fluctuations, it needs to be combined with Ca2+ sensor proteins for decoding to activate downstream defense signals, which initiates various physiological responses to respond to environmental changes. Figure 11b confirms the changes in Ca2+ sensor proteins during calcium signaling decoding by examining the increases in CDPK activity, CaM, and CBL content under 4 °C chilling stress. Notably, after binding Ca2+, CBL must interact with CIPK to initiate specific biochemical reactions. Our findings indicate that the CIPK activity in P. edulis roots was also enhanced under 4 °C chilling stress. This finding is consistent with the enrichment results of the Ca2+ sensor proteins in the calcium signaling pathway (Figure 6), and further validates the differential gene expression analysis of the Ca2+ sensor proteins presented in Figure 7.
Fluorescence probe labeling and laser confocal microscopy were utilized to observe the root tips of P. edulis. The green signal, indicating strength and distribution, visualizes the Ca2+ fluorescence probe. Upon exposure to 4 °C chilling stress, we observed specific changes in the Ca2+ concentration at the root tips. In the control group, the fluorescence probe was localized in the cell wall and nucleus (Figure 11c, L1 and L2), whereas in the chilling stress treatment, the distribution of the fluorescence probe was also observed in the cytoplasm (Figure 11c, L3 and L4). Combined with the altered Ca2+ flux depicted in Figure 11a, these findings suggest that the changes observed in Ca2+ dynamics under chilling stress can primarily be attributed to the release from intracellular calcium reservoirs, facilitating the influx of Ca2+ (Figure 11c).

3.4. Changes in NO3 and NH4+ Flux and Nitrogen Transporter Protein Contents

Given that CIPK plays an important role in nitrogen metabolism, we analyzed the fluxes of NH4+ and NO3 in the root tips of the P. edulis seedlings under the chilling stress treatment at 4 °C, using a 25 °C treatment as the control (Figure 12a–d). Chilling stress induced a shift in the P. edulis roots from endocytosis to exocytosis for NH4+, while also inhibiting the net influx of NO3, leading to the suppression of NO3 absorption in the roots of P. edulis. Our results demonstrate that the inhibition of ammonium (NH4+-N) uptake by chilling stress was more pronounced in P. eduli than that of nitrate (NO3-N) uptake. This is inconsistent with the results of another study, which may be due to the different locations of the roots tested [41]. Under chilling stress, the content of ATM in the roots of P. edulis did not show significant changes (Figure 12e). However, the content of NRT showed a significant decrease under all chilling treatments, except for the 4 h duration (Figure 12f). Throughout the process of responding to cold stress, the content of AMT in the roots of P. edulis was consistently higher than that of NRT (Figure 12g). Under the cold-shock treatment, the absorption ratio of NH4+ and NO3 in the roots of P. edulis showed a decreasing trend (Figure 12h). The absorption of NH4+ and NO3 by roots may be influenced by the function of AMT and NRT family transport proteins. Under chilling stress, the expression or activity of these proteins may be inhibited, affecting nitrogen uptake.

4. Discussion

These results show that calcium signaling is involved in regulating the response of P. edulis to chilling stress. Specific changes in calcium signal characteristics were not only manifested in an altered Ca2+ flux in the roots, but also in a calcium surge in the cytoplasm. Ca2+ sensor proteins, including CaM, CDPK, and CBL, showed significant changes in the roots of P. edulis under chilling stress conditions. Of particular note, under biotic and abiotic stresses, CBL serves as an important class of calcium sensors in plants, and CBL needs to interact with CIPK after binding to Ca2+ in order to carry out signaling to the downstream target genes [37,42]. Interaction with CBL CIPK, a family of key downstream proteins, is involved in the post-translational regulatory mechanism of nitrogen metabolism, which provides a research crossroads between the calcium signaling pathway and nitrogen metabolism.
Nitrogen uptake and metabolism in P. edulis are important for its enhanced resistance and productivity. It has been pointed out that NO3 is not only a nutrient element, but also a signaling molecule in plants [43]. The Ca2+–CBL–CIPK signaling network plays a key role in plants in response to chilling stress, in which the calcium sensor protein, CBL, plays an important role in the nitrogen metabolism pathway. Studies on the association between NO3, NH4+ transporter uptake, and the CBL–CIPK signaling network found that the CBL9–CIPK23 complex is able to phosphorylate the nitrate transporter CHL1 and alter its transporter affinity and perception of nitrate nitrogen under fluctuating NO3 concentrations. In addition, in response to high concentrations of NH4+, CBL1–CIPK23 inhibited the activity of the AMT1-type NH4+ transporter to avoid the excessive accumulation of NH4+ [25]. DEG analysis revealed that CIPK and nitrogen transporter protein (NRT and AMT)-related genes underwent significant expression changes under cold stress, and in particular, the expressions of genes such as PH02Gene13036 and PH02Gene34530 were significantly elevated, which was consistent with that of the related genes detected by qRT-PCR [41]. However, the trends in NRT and AMT protein content were not significant between the control and 4 °C chilling treatment (control vs. chilling stress). In this study, it was found that the inhibition of NH4+-N uptake by a low temperature was more severe compared to NO3-N uptake when P. edulis suffered chilling stress. This result was contrary to the findings of Liu et al., and may be due to the differences in the location of the roots examined and the time of exposure to chilling stress [41]. The low temperature inhibited the net NO3 influx in the roots, leading to the inhibition of NO3 uptake in the roots of P. edulis, which was consistent with the findings of Liu et al. [41]. In the KEGG analysis of the DEGs in P. edulis under chilling stress, although the calcium signaling pathway was not identified as being significantly enriched (p ≤ 0.05), our analysis revealed the association of important pathways such as nitrogen metabolism with calcium signaling. This finding implies that calcium signaling may play a broad role as a second messenger in the stress response to chilling stress in P. edulis.
The importance of CBF as a key factor in balancing plant response to chilling stress and growth cannot be overlooked [44,45]. CBF proteins, belonging to the AP2/ERF (APETALA2/ethylene-responsive factor) family of transcription factors (TFs), were first reported in 1997 in the model plant Arabidopsis thaliana. The AP2 conserved functional domain of CBFs specifically recognizes and binds to the downstream promoter region containing the cis-regulatory elements CRT/DRE to activate the expression of cold-responsive genes. CBFs, as important targets for improving cold tolerance traits in plants, are overexpressed in a variety of grasses, including rice (Oryza sativa L.), maize (Zea mays), wheat (Triticum aestivum L.), and barley (Hordeum vulgare L.), and have been demonstrated to significantly enhance the freezing tolerance of transgenic plants [46]. Notably, our study shows that, in P. edulis, the rise in Ca2+ concentration after exposure to cold damage activates calcium-sensing protein kinases that further phosphorylate and activate CBF transcription factors. CBF target genes downstream of calcium channels were activated under chilling stress, confirming the conservation of the CBF-mediated signaling pathway in P. edulis, which is consistent with previous research results in model plants and related crops [46,47,48]. The activation of the CBF pathway represents a pivotal mechanism for plants to respond to chilling stress. Plants are likely to detect chilling stress via plasma membrane proteins, including the chilling-tolerance-divergence 1 (COLD1), which subsequently triggers a cytosolic Ca2+ signal and initiates the activation of protein kinases. These protein kinases are hypothesized to activate downstream transcription factors, such as calmodulin-binding transcription activators (CAMTAs) and ICE1, via sumoylation and phosphorylation processes. Subsequently, ICE1-activated CBF modulates the expression of COR genes, ultimately enhancing plants’ tolerance to low temperatures [33,49,50].
The goal of this study was to elucidate the calcium signaling characteristics and regulatory mechanisms of P. edulis under chilling stress, with a view to provide new data to support the current theoretical studies on the cold resistance of P. edulis. However, there might be some limitations to our study, because it was performed on P. edulis seedlings in a lab, not in their natural environment. Future research should apply these theories more to naturally growing P. edulis forests to maximize the uptake potential of the P. edulis root system by studying the interactions between the bamboo root system and the soil, as well as the concerted reaction between soil factors, especially the interrelationship between calcium and nitrogen. In addition, considering problems such as the reduced soil productivity that may result from the fertilization of bamboo forests, we propose combining knowledge of soil disciplines to come up with an integrated solution. This will not only increase the productivity of bamboo, but also improve soil health and promote the sustainable development of bamboo forests.

5. Conclusions

This study reveals that Ca2+ signaling is integral to the regulatory network of P. edulis’s response to chilling stress. Variations in the Ca2+ flux within the roots of P. edulis seedlings under chilling stress may trigger specific calcium signaling pathways, such as Ca2+ flux fluctuations and the spatial redistribution of Ca2+, which are vital for the plant’s response to chilling stress. The interaction of Ca2+ with calcium sensor proteins triggers and activates the downstream CBF family of defense signals, indicating that the CBF-mediated signaling pathway is conserved in P. edulis under chilling stress. Concurrently, the Ca2+–CBL–CIPK signaling cascade plays a significant role in the chilling stress response, with the CIPK family significantly influencing nitrogen metabolic pathways. In summary, the specificity of Ca2+ signaling in P. edulis, which includes the precise control of Ca2+ flux, the engagement of Ca2+ sensor proteins, and the intricate regulation of downstream target genes such as CBFs, collectively constitutes the intricate adaptive strategy that enables this plant to cope with chilling stress. The findings of this study on the chilling resistance mechanisms in P. edulis seedlings enhance the scientific understanding of P. edulis’s tolerance to cold stress, have practical implications for improving bamboo cultivation practices, and ultimately improve the financial and ecological viability of bamboo cultivation.

Author Contributions

Conceptualization, X.J. and C.C.; Methodology, X.J. and C.C.; Software, X.J. and Y.W.; Validation, X.J. and P.G.; Formal analysis, X.J.; Investigation, X.J., C.C. and P.G.; Resources, X.J., C.C. and Y.W.; Data curation, X.J.; Writing—original draft, X.J.; Writing—review & editing, X.J.; Visualization, X.J. and C.C.; Supervision, X.J.; Project administration, X.J., P.G. and Y.W.; Funding acquisition, C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the project “Selection and Breeding Technology Research of Economic Bamboo Species Suitable for Hainan” (1630032024001) under the Fundamental Research Funds of the ICBR Sanya Research Base, International Centre for Bamboo and Rattan.

Data Availability Statement

Data will be made available on request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Intergovernmental Panel on Climate Change (IPCC). Climate Change 2014: Synthesis Report; IPCC: Geneva, Switzerland, 2015. [Google Scholar]
  2. Su, W.H.; Fan, S.H.; Zhang, W.Y.; Qi, L.H.; Guan, F.Y. Damage of Frost and Snow Disaster to Moso Bamboo Stands and the Influencing Factors in Huangshan, Anhui Province. Sci. Silvae Sin. 2008, 44, 42–49. [Google Scholar]
  3. Aslam, M.; Fakher, B.; Ashraf, M.A.; Cheng, Y.; Wang, B.R.; Qin, Y. Plant Low-Temperature Stress: Signaling and Response. Agronomy 2022, 12, 702. [Google Scholar] [CrossRef]
  4. Yang, C.B.; Yang, H.Z.; Xu, Q.J.; Wang, Y.L.; Sang, Z.; Yuan, H.J. Comparative metabolomics analysis of the response to cold stress of resistant and susceptible Tibetan hulless barley (Hordeum distichon). Phytochemistry 2020, 174, 112346. [Google Scholar] [CrossRef] [PubMed]
  5. Hayat, S.; Hayat, Q.; Alyemeni, M.N.; Wani, A.S.; Pichtel, J.; Ahmad, A. Role of proline under changing environments: A review. Plant Signal. Behav. 2012, 7, 1456–1466. [Google Scholar] [CrossRef]
  6. Eom, S.H.; Ahn, M.-A.; Kim, E.; Lee, H.J.; Lee, J.H.; Wi, S.H.; Kim, S.K.; Lim, H.B.; Hyun, T.K. Plant Response to Cold Stress: Cold Stress Changes Antioxidant Metabolism in Heading Type Kimchi Cabbage (Brassica rapa L. ssp. Pekinensis). Antioxidants 2022, 11, 700. [Google Scholar] [CrossRef]
  7. Wang, H.Y.; Guo, L.; Zha, R.Z.; Gao, Z.P.; Yu, F.; Wei, Q. Histological, metabolomic and transcriptomic analyses reveal mechanisms of cold acclimation of the Moso bamboo (Phyllostachys edulis) leaf. Tree Physiol. 2022, 42, 2336–2352. [Google Scholar] [CrossRef]
  8. Miller, G.; Suzuki, N.; Ciftci-Yilmaz, S.; Mittler, R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef]
  9. Abid, M.; Tian, Z.W.; Ata-Ul-Karim, S.T.; Liu, Y.; Cui, Y.K.; Zahoor, R.; Jiang, D.; Dai, T.B. Improved tolerance to post-anthesis drought stress by pre-drought priming at vegetative stages in drought-tolerant and -sensitive wheat cultivars. Plant Physiol. Biochem. 2016, 106, 218–227. [Google Scholar] [CrossRef] [PubMed]
  10. Huang, Z.; Zhu, P.L.; Zhong, X.J.; Qiu, J.R.; Xu, W.X.; Song, L. Transcriptome Analysis of Moso Bamboo (Phyllostachys edulis) Reveals Candidate Genes Involved in Response to Dehydration and Cold Stresses. Front. Plant Sci. 2022, 19, 960302. [Google Scholar] [CrossRef]
  11. Luan, S. The CBL–CIPK network in plant calcium signaling. Trends Plant Sci. 2009, 14, 37–42. [Google Scholar] [CrossRef]
  12. DeFalco, T.A.; Bender, K.W.; Snedden, W.A. Breaking the code: Ca2+ sensors in plant signalling. Biochem. J. 2009, 425, 27–40. [Google Scholar] [CrossRef] [PubMed]
  13. Harmon, A.C.; Gribskov, M.; Harper, J.F. CDPKs—A kinase for every Ca2+ signal? Trends Plant Sci. 2000, 5, 154–159. [Google Scholar] [CrossRef] [PubMed]
  14. Cheng, S.H.; Willmann, M.R.; Chen, H.C.; Sheen, J. Calcium signaling through protein kinases. The Arabidopsis calcium-dependent protein kinase gene family. Plant Physiol. 2002, 129, 469–485. [Google Scholar] [CrossRef]
  15. Harper, J.F.; Breton, G.; Harmon, A. Decoding Ca2+ signals through plant protein kinases. Annu. Rev. Plant Biol. 2004, 55, 263–288. [Google Scholar] [CrossRef]
  16. Trewavas, A. How plants learn. Proc. Natl. Acad. Sci. USA 1999, 96, 4216–4218. [Google Scholar] [CrossRef]
  17. Kudla, J.; Xu, Q.; Harter, K.; Gruissem, W.; Luan, S. Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proc. Natl. Acad. Sci. USA 1999, 96, 4718–4723. [Google Scholar] [CrossRef]
  18. Luan, S.; Kudla, J.; Rodriguez-Concepcion, M.; Yalovsky, S.; Gruissem, W. Calmodulins and calcineurin B-like proteins: Calcium sensors for specific signal response coupling in plants. Plant Cell 2002, 14, S389–S400. [Google Scholar] [CrossRef]
  19. McCormack, E.; Tsai, Y.C.; Braam, J. Handling calcium signaling: Arabidopsis CaMs and CMLs. Trends Plant Sci. 2005, 10, 383–389. [Google Scholar] [CrossRef]
  20. Batistič, O.; Kudla, J. Analysis of calcium signaling pathways in plants. Biochim. Biophys. Acta 2012, 1820, 1283–1293. [Google Scholar] [CrossRef]
  21. Ma, Y.; Dai, X.Y.; Xu, Y.Y.; Luo, W.; Zheng, X.M.; Zeng, D.; Pan, Y.J.; Lin, X.L.; Liu, H.H.; Zhang, D.J.; et al. COLD1 confers chilling tolerance in rice. Cell 2015, 160, 1209–1221. [Google Scholar] [CrossRef]
  22. Zhou, A.; Liu, E.H.; Li, H.; Li, Y.; Feng, S.; Gong, S.F.; Wang, J.G. PsCor413pm2, a Plasma Membrane-Localized, Cold-Regulated Protein from Phlox subulata, Confers Low Temperature Tolerance in Arabidopsis. Int. J. Mol. Sci. 2018, 19, 2579. [Google Scholar] [CrossRef]
  23. Shi, Y.L.; Yue, X.L.; An, L.Z. Integrated regulation triggered by a cryophyte ω-3 desaturase gene confers multiple-stress tolerance in tobacco. J. Exp. Bot. 2018, 69, 2131–2148. [Google Scholar] [CrossRef]
  24. Zhang, D.J.; Guo, X.Y.; Xu, Y.Y.; Li, H.; Ma, L.; Yao, X.F.; Weng, Y.X.; Guo, Y.; Liu, C.M.; Chong, K. OsCIPK7 point-mutation leads to conformation and kinase-activity change for sensing cold response. J. Integr. Plant Biol. 2019, 61, 1194–1200. [Google Scholar] [CrossRef] [PubMed]
  25. Tang, R.J.; Wang, C.; Li, K.L.; Luan, S. The CBL-CIPK Calcium Signaling Network: Unified Paradigm from 20 Years of Discoveries. Trends Plant Sci. 2020, 25, 604–617. [Google Scholar] [CrossRef] [PubMed]
  26. Iqbal, Z.; Memon, A.G.; Ahmad, A.; Iqbal, M.S. Calcium Mediated Cold Acclimation in Plants: Underlying Signaling and Molecular Mechanisms. Front. Plant Sci. 2022, 13, 855559. [Google Scholar] [CrossRef] [PubMed]
  27. Wang, S.W.; Zhou, M.B. Genome-wide identification of the ICE gene family in moso bamboo and its expression pattern under low temperature stress. J. Zhejiang A&F Univ. 2024, 41, 568–576. [Google Scholar] [CrossRef]
  28. Zhong, S.L.; Joung, J.G.; Zheng, Y.; Chen, Y.R.; Liu, B.; Shao, Y.; Xiang, J.Z.; Fei, Z.J.; Giovannoni, J.J. High-throughput illumina strand-specific RNA sequencing library preparation. Cold Spring Harb. Protoc. 2011, 2011, 940–949. [Google Scholar] [CrossRef] [PubMed]
  29. Podnar, J.; Deiderick, H.; Huerta, G.; Hunicke-Smith, S. Next-Generation Sequencing RNA-Seq Library Construction. Curr. Protoc. Mol. Biol. 2014, 106, 4.21.1–4.21.19. [Google Scholar] [CrossRef]
  30. Xu, Y.; Sun, T.; Yin, L.P. Application of Non-invasive Microsensing System to Simultaneously Measure Both H+, and O2 Fluxes Around the Pollen Tube. J. Integr. Plant Biol. 2006, 48, 823–831. [Google Scholar] [CrossRef]
  31. Lee, E.S.; Park, J.H.; Wi, S.D.; Kang, C.H.H.; Chi, Y.H.; Chae, H.B.; Paeng, S.K.; Ji, M.G.; Kim, W.Y.; Kim, M.G.; et al. Redox-dependent structural switch and CBF activation confer freezing tolerance in plants. Nat. Plants 2021, 7, 914–922. [Google Scholar] [CrossRef]
  32. Ludwig, A.A.; Saitoh, H.; Felix, G.; Freymark, G.; Miersch, O.; Wasternack, C.; Boller, T.; Jones, J.D.G.; Romeis, T. Ethylene-mediated cross-talk between calcium-dependent protein kinase and MAPK signaling controls stress responses in plants. Proc. Natl. Acad. Sci. USA 2005, 102, 10736–10741. [Google Scholar] [CrossRef] [PubMed]
  33. Zhu, J.K. Abiotic Stress Signaling and Responses in Plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, Q.Y.; Li, Y.; Cao, K.; Xu, H.W.; Zhou, X.F. Transcriptome and proteome depth analysis indicate ABA, MAPK cascade and Ca2+ signaling co-regulate cold tolerance in Rhododendron chrysanthum Pall. Front. Plant Sci. 2023, 14, 1146663. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  35. Liu, W.X.; Liu, Z.P.; Xie, W.G.; Wang, Y.R. Responses of fatty acid and its derivatives to stress in plants. Pratacult. Sci. 2014, 8, 1556–1565. [Google Scholar] [CrossRef]
  36. Lian, H.D.; Qin, C.; Zhao, Q.S.; Begum, N.; Zhang, S.Q. Exogenous calcium promotes growth of adzuki bean (Vigna angularis Willd.) seedlings under nitrogen limitation through the regulation of nitrogen metabolism. Plant Physiol. Biochem. 2022, 190, 90–100. [Google Scholar] [CrossRef] [PubMed]
  37. Chen, J.S.; Wang, S.T.; Mei, Q.; Sun, T.; Hu, J.T.; Xiao, G.S.; Chen, H.; Xuan, Y.H. The role of CBL-CIPK signaling in plant responses to biotic and abiotic stresses. Plant Mol. Biol. 2024, 114, 53. [Google Scholar] [CrossRef]
  38. Ding, Y.D.; Yang, H.; Wu, S.F.; Fu, D.Y.; Li, M.Z.; Gong, Z.Z.; Yang, S.H. CPK28-NLP7 module integrates cold-induced Ca2+ signal and transcriptional reprogramming in Arabidopsis. Sci. Adv. 2022, 8, eabn7901. [Google Scholar] [CrossRef]
  39. Klimecka, M.; Muszyńska, G. Structure and functions of plant calcium-dependent protein kinases. Acta Biochim. Pol. 2007, 54, 219–233. [Google Scholar] [CrossRef]
  40. Dolmetsch, R.E.; Xu, K.; Lewis, R.S. Calcium oscillations increase the efficiency and specificity of gene expression. Nature 1998, 392, 933–936. [Google Scholar] [CrossRef]
  41. Liu, Y.M.; Bai, L.Q.; Sun, M.T.; Wang, J.; Li, S.Z.; Miao, L.; Yan, Y.; He, C.X.; Yu, X.C.; Li, Y.S. Adaptation of cucumber seedlings to low temperature stress by reducing nitrate to ammonium during it’s transportation. BMC Plant Biol. 2021, 21, 189. [Google Scholar] [CrossRef]
  42. Ju, C.F.; Zhang, Z.Q.; Deng, J.P.; Miao, C.C.; Wang, Z.Q.; Wallrad, L.; Javed, L.; Fu, D.; Zhang, T.; Kudla, J.; et al. Ca2+-dependent successive phosphorylation of vacuolar transporter MTP8 by CBL2/3-CIPK3/9/26 and CPK5 is critical for manganese homeostasis in Arabidopsis. Mol. Plant 2022, 15, 419–437. [Google Scholar] [CrossRef] [PubMed]
  43. Liu, K.H.; Liu, M.H.; Lin, Z.W.; Wang, Z.F.; Chen, B.Q.; Liu, C.; Guo, A.; Konishi, M.; Yanagisawa, S.; Wagner, G.; et al. NIN-like protein 7 transcription factor is a plant nitrate sensor. Science 2022, 377, 1419–1425. [Google Scholar] [CrossRef] [PubMed]
  44. Liu, J.Y.; Shi, Y.T.; Yang, S.H. CBF: A key factor balancing plant cold stress responses and growth. Chin. Bull. Bot. 2017, 52, 689–698. [Google Scholar] [CrossRef]
  45. Hwarari, D.; Guan, Y.L.; Ahmad, B.; Movahedi, A.; Min, T.; Hao, Z.D.; Lu, Y.; Chen, J.H.; Yang, L. ICE-CBF-COR Signaling Cascade and Its Regulation in Plants Responding to Cold Stress. Int. J. Mol. Sci. 2022, 23, 1549. [Google Scholar] [CrossRef] [PubMed]
  46. Shi, Y.T.; Ding, Y.L.; Yang, S.H. Molecular Regulation of CBF Signaling in Cold Acclimation. Trends Plant Sci. 2018, 23, 623–637. [Google Scholar] [CrossRef]
  47. Peng, Y.; Ming, Y.H.; Jiang, B.C.; Zhang, X.Y.; Fu, D.Y.; Lin, Q.H.; Zhang, X.Y.; Wang, Y.; Shi, Y.T.; Gong, Z.Z.; et al. Differential phosphorylation of Ca2+-permeable channel CNGC20 modulates calcium-mediated freezing tolerance in Arabidopsis. Plant Cell 2024, 36, 4356–4371. [Google Scholar] [CrossRef]
  48. Lin, R.; Song, J.N.; Tang, M.J.; Wang, L.Y.; Yu, J.Q.; Zhou, Y.H. CALMODULIN6 negatively regulates cold tolerance by attenuating ICE1-dependent stress responses in tomato. Plant Physiol. 2023, 193, 2105–2121. [Google Scholar] [CrossRef]
  49. Zhu, J.H.; Dong, C.H.; Zhu, J.K. Interplay between cold-responsive gene regulation, metabolism and RNA processing during plant cold acclimation. Curr. Opin. Plant Biol. 2007, 10, 290–295. [Google Scholar] [CrossRef]
  50. Winfield, M.O.; Lu, C.G.; Wilson, I.D.; Coghill, J.A.; Edwards, K.J. Plant responses to cold: Transcriptome analysis of wheat. Plant Biotechnol. J. 2010, 8, 749–771. [Google Scholar] [CrossRef]
Figure 1. Schematic diagram of P. edulis sprouting seedling (test materials) cultivation site. (a) The cultivation site for experimental plant materials, with the red dots on the satellite imagery indicating the planting locations of test P. edulis sprouting seedlings. (b) The detailed status of P. edulis seedling planting encompasses the cultivation environment and growth conditions of the test seedlings.
Figure 1. Schematic diagram of P. edulis sprouting seedling (test materials) cultivation site. (a) The cultivation site for experimental plant materials, with the red dots on the satellite imagery indicating the planting locations of test P. edulis sprouting seedlings. (b) The detailed status of P. edulis seedling planting encompasses the cultivation environment and growth conditions of the test seedlings.
Forests 15 02132 g001
Figure 2. Schematic of the cold-shock treatment setup for P. edulis seedling root tips. The setup comprises 90 mm and 35 mm Petri dishes arranged in a nested configuration. The 90 mm Petri dishes are used to provide low-temperature insulation, and the P. edulis roots are placed in the 35 mm Petri dishes for the 4 °C treatment. The blue color indicates the test liquid at 25 °C, and the orange color denotes the test liquid at 4 °C.
Figure 2. Schematic of the cold-shock treatment setup for P. edulis seedling root tips. The setup comprises 90 mm and 35 mm Petri dishes arranged in a nested configuration. The 90 mm Petri dishes are used to provide low-temperature insulation, and the P. edulis roots are placed in the 35 mm Petri dishes for the 4 °C treatment. The blue color indicates the test liquid at 25 °C, and the orange color denotes the test liquid at 4 °C.
Forests 15 02132 g002
Figure 3. Schematic diagram of flux measurement for Ca2+, NH4+, and NO3. The diagram illustrates an electrode performing dual-point measurements, with its tip coated by an ion-selective liquid membrane that enables ion exchange, referred to as a LIX membrane. The Ca2+, NH4+, and NO3 fluxes were calculated by Fick’s law of diffusion: J = −D·(dc/dx). The diffusion flux, denoted by J, is expressed in units of picomoles·cm⁻2·s⁻1. D represents the diffusion coefficient, dc denotes the difference in concentration, and dx represents the distance of movement. V1 and V2 correspond to the ion voltages measured at two separate test positions.
Figure 3. Schematic diagram of flux measurement for Ca2+, NH4+, and NO3. The diagram illustrates an electrode performing dual-point measurements, with its tip coated by an ion-selective liquid membrane that enables ion exchange, referred to as a LIX membrane. The Ca2+, NH4+, and NO3 fluxes were calculated by Fick’s law of diffusion: J = −D·(dc/dx). The diffusion flux, denoted by J, is expressed in units of picomoles·cm⁻2·s⁻1. D represents the diffusion coefficient, dc denotes the difference in concentration, and dx represents the distance of movement. V1 and V2 correspond to the ion voltages measured at two separate test positions.
Forests 15 02132 g003
Figure 4. GO enrichment of the DEGs in biological progress. The vertical axis represents the GO term names that are enriched, while the abscissa indicates the number of genes enriched within each GO term.
Figure 4. GO enrichment of the DEGs in biological progress. The vertical axis represents the GO term names that are enriched, while the abscissa indicates the number of genes enriched within each GO term.
Forests 15 02132 g004
Figure 5. KEGG pathway analysis of DEGs. Each bubble in the bubble chart symbolizes a molecular pathway, with the significant pathways selected based on their p-values. The abscissa position and size of the bubble indicate the magnitude of the pathway’s influence factor in topological analysis. The larger the bubble, the more substantial its influence factor. The vertical axis position and color of the bubble correspond to the p-value from the enrichment analysis.
Figure 5. KEGG pathway analysis of DEGs. Each bubble in the bubble chart symbolizes a molecular pathway, with the significant pathways selected based on their p-values. The abscissa position and size of the bubble indicate the magnitude of the pathway’s influence factor in topological analysis. The larger the bubble, the more substantial its influence factor. The vertical axis position and color of the bubble correspond to the p-value from the enrichment analysis.
Forests 15 02132 g005
Figure 6. Map of DEGs and metabolites involved in the calcium signaling pathway. The image was modified from map04020 (version 5/18/23) from the KEGG database (https://www.genome.jp/pathway/ko04020 (accessed on 28 May 2024)). Purple indicates the key catalytic enzymes (genes) in the metabolic pathway. It reflects the hierarchical regulation of genes within this pathway. The box in red represents gene enrichment under chilling stress.
Figure 6. Map of DEGs and metabolites involved in the calcium signaling pathway. The image was modified from map04020 (version 5/18/23) from the KEGG database (https://www.genome.jp/pathway/ko04020 (accessed on 28 May 2024)). Purple indicates the key catalytic enzymes (genes) in the metabolic pathway. It reflects the hierarchical regulation of genes within this pathway. The box in red represents gene enrichment under chilling stress.
Forests 15 02132 g006
Figure 7. Expression analysis of the key Ca2+ sensor proteins Genes. Heatmaps of key Ca2+ sensor protein genes expression under chilling stress: (a) CDPK, (b) CaM, (c) CBL, and (d) CIPK. In each heatmap, color blocks represent the expression levels of the respective genes within a sample, with color intensity indicating expression levels—redder indicating higher expression and bluer indicating lower expression. The row clustering dendrogram on the left side of the heatmap represents the clustering of the genes.
Figure 7. Expression analysis of the key Ca2+ sensor proteins Genes. Heatmaps of key Ca2+ sensor protein genes expression under chilling stress: (a) CDPK, (b) CaM, (c) CBL, and (d) CIPK. In each heatmap, color blocks represent the expression levels of the respective genes within a sample, with color intensity indicating expression levels—redder indicating higher expression and bluer indicating lower expression. The row clustering dendrogram on the left side of the heatmap represents the clustering of the genes.
Forests 15 02132 g007
Figure 8. Expression analysis of NRT and AMT Genes. Heatmaps depicting the expression of (a) NRT and (b) AMT genes under chilling stress. Each color block in the heat map corresponds to the expression level of the respective gene within a sample. The expression levels are indicated by color intensity: the redder the color, the higher the expression level; conversely, the bluer the color, the lower the expression level.
Figure 8. Expression analysis of NRT and AMT Genes. Heatmaps depicting the expression of (a) NRT and (b) AMT genes under chilling stress. Each color block in the heat map corresponds to the expression level of the respective gene within a sample. The expression levels are indicated by color intensity: the redder the color, the higher the expression level; conversely, the bluer the color, the lower the expression level.
Forests 15 02132 g008
Figure 9. Heatmap of CBF genes expression under chilling stress compared to the control group. In the heatmap, the color intensity of each block signifies the expression level of the corresponding gene in the sample, with more intense reds representing higher expression levels and more intense blues representing lower expression levels.
Figure 9. Heatmap of CBF genes expression under chilling stress compared to the control group. In the heatmap, the color intensity of each block signifies the expression level of the corresponding gene in the sample, with more intense reds representing higher expression levels and more intense blues representing lower expression levels.
Forests 15 02132 g009
Figure 10. qRT-PCR verification of differentially expressed genes. The vertical axis of the figure represents the relative expression levels of the genes, normalized to a control gene, with error bars indicating the standard error of the mean (SEM) derived from three replicates, p < 0.05 (*).
Figure 10. qRT-PCR verification of differentially expressed genes. The vertical axis of the figure represents the relative expression levels of the genes, normalized to a control gene, with error bars indicating the standard error of the mean (SEM) derived from three replicates, p < 0.05 (*).
Forests 15 02132 g010
Figure 11. The response pattern of Ca2+ and Ca2+ sensor proteins in the roots of P. edulis under 4 °C chilling stress. (a) Ca2+ flux in response to chilling stress at the root tips of P. edulis, where positive values indicate Ca2+ efflux and negative values indicate Ca2+ influx. (b) The enzymatic activities of CDPKs and CIPKs, as well as the protein contents of CaM and CBL, under various durations of 4 °C chilling stress. Different letters indicate a significant difference (p < 0.05, LSD). (c) The characteristics of intensity and distribution of the Ca2+ fluorescence probe at the root tips of P. edulis. Under the control treatment at 25 °C, the root tip (L1) and root cells (L2) of P. edulis; under the chilling stress at 4 °C, the root tip (L3) and root cells (L4) of P. edulis. Scale bar: (L1, L2, L3, L4) 5 µm.
Figure 11. The response pattern of Ca2+ and Ca2+ sensor proteins in the roots of P. edulis under 4 °C chilling stress. (a) Ca2+ flux in response to chilling stress at the root tips of P. edulis, where positive values indicate Ca2+ efflux and negative values indicate Ca2+ influx. (b) The enzymatic activities of CDPKs and CIPKs, as well as the protein contents of CaM and CBL, under various durations of 4 °C chilling stress. Different letters indicate a significant difference (p < 0.05, LSD). (c) The characteristics of intensity and distribution of the Ca2+ fluorescence probe at the root tips of P. edulis. Under the control treatment at 25 °C, the root tip (L1) and root cells (L2) of P. edulis; under the chilling stress at 4 °C, the root tip (L3) and root cells (L4) of P. edulis. Scale bar: (L1, L2, L3, L4) 5 µm.
Forests 15 02132 g011
Figure 12. Changes in NO3 and NH4+ flux and nitrogen transporter protein contents in roots of P. edulis seedlings under chilling stress. (a,c) Indicate the NO3 and NH4+ fluxes, respectively, among the different treatments. (b,d) Present the analysis of variance in average fluxes corresponding to the different treatments depicted in (a,c). (e,f) Represent the contents of ATM and NRT with different durations of chilling stress. (b,d,e,f) Different letters indicate a significant difference (p < 0.05, LSD), n.s. stands for not significant (p < 0.05). (g) The trend line of ATM and NRT content shows the changes with the extension of chilling stress duration. (h) The ammonium to nitrate ratio exhibits a trend of change under chilling stress.
Figure 12. Changes in NO3 and NH4+ flux and nitrogen transporter protein contents in roots of P. edulis seedlings under chilling stress. (a,c) Indicate the NO3 and NH4+ fluxes, respectively, among the different treatments. (b,d) Present the analysis of variance in average fluxes corresponding to the different treatments depicted in (a,c). (e,f) Represent the contents of ATM and NRT with different durations of chilling stress. (b,d,e,f) Different letters indicate a significant difference (p < 0.05, LSD), n.s. stands for not significant (p < 0.05). (g) The trend line of ATM and NRT content shows the changes with the extension of chilling stress duration. (h) The ammonium to nitrate ratio exhibits a trend of change under chilling stress.
Forests 15 02132 g012
Table 1. List of primers used for qRT-PCR analysis.
Table 1. List of primers used for qRT-PCR analysis.
Gene IDForward PrimerReverse Primer
PH02Gene03957GCTGGGCTGGTATTGCTAACGCAAAGGCGAAGAAGACGAT
PH02Gene42787GTCATTCCAAGCAGTGCACAAATGGAGTGTCACCGAACCT
PH02Gene19300GTTCCGGGTTTTCGACGAGATCATGCACTTGAACTCGCC
PH02Gene17971CCACTAACACAGCTTCGACGGCTGGCCTCATTTCTTGGTT
PH02Gene35076ATTGACGAAGCAGGACAGGAGAGCTTGCTATGTCCCCTCT
PH02Gene13036TTCAAGGAACCGAATCGTGCCCAATCGAAGTTGCAGCCTT
PH02Gene03104TGCCTCGACGTCATCTTCTTTTGGGCAGGATCATCATGGT
PH02Gene04394GCAATGGTAGAGAAGCCGTGGATCCATGGTGAAGCTGCAG
PH02Gene14168TCGTGTCTGGCTTGGTACTTTTGTTGACTGCTGGCTTGAC
Table 2. Non-invasive Micro-Test Technology (NMT) test site and test solution constitution.
Table 2. Non-invasive Micro-Test Technology (NMT) test site and test solution constitution.
Ion Species for
Flux Testing
Test Position Site (μm)Measuring Solutions
RootConcentrationConsistingpH
Ca2+500 μM from the root apex0.2 mM
0.1 mM
2-(N-morpholino) ethanesulfonic acid (MES)
CaCl2
6.0
NH4+1500 μM from the root apex0.1 mM
0.1 mM
NH4NO3
CaCl2
6.0
NO31500 μM from the root apex0.1 mM
0.1 mM
NH4NO3
CaCl2
6.0
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jing, X.; Cai, C.; Geng, P.; Wang, Y. Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics. Forests 2024, 15, 2132. https://doi.org/10.3390/f15122132

AMA Style

Jing X, Cai C, Geng P, Wang Y. Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics. Forests. 2024; 15(12):2132. https://doi.org/10.3390/f15122132

Chicago/Turabian Style

Jing, Xiong, Chunju Cai, Pengfei Geng, and Yi Wang. 2024. "Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics" Forests 15, no. 12: 2132. https://doi.org/10.3390/f15122132

APA Style

Jing, X., Cai, C., Geng, P., & Wang, Y. (2024). Moso Bamboo’s Survival Strategy Against Chilling Stress in Signaling Dynamics. Forests, 15(12), 2132. https://doi.org/10.3390/f15122132

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop