Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana
Abstract
1. Introduction
2. Materials and Methods
2.1. Nematode Source
2.2. Phylogenetic Analysis and Conserved Motif Identification of BxVAP2
2.3. Quantitative Real-Time PCR (qRT-PCR) Analysis of BxVAP2 Expression
2.4. Subcellular Localization of BxVAP2
2.5. Construction of Agrobacterium Expression Plasmids
2.6. Protein Expression and Western Blot Analysis
2.7. Expression Analysis of Pattern-Triggered Immunity (PTI) Marker Genes and Drought-Related Genes in N. benthamiana After Transient Expression of BxVAP2
2.8. Statistical Analysis
3. Results and Analysis
3.1. Phylogenetic Analysis, Structural Domains, and Conserved Motifs of BxVAP2
3.2. Expression Pattern of BxVAP2 in B. xylophilus
3.3. Subcellular Localization of BxVAP2 in Nicotiana benthamiana
3.4. Heterologous Expression of BxVAP2 Induces Cell Death and Affects PTI-Marker Genes Response in N. benthamiana
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, B.; Liu, Q.; Zhou, Z.; Yin, H.; Xie, Y.; Wei, Y. Two Terpene Synthases in Resistant Pinus massoniana Contribute to Defence against Bursaphelenchus xylophilus. Plant Cell Environ. 2021, 44, 257–274. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.Y.; Wu, H. New Host Plant and New Vector Insect of Bursaphelenchus xylophilus Found in Liaoning Province. For. Pest Dis. 2018, 37, 61. [Google Scholar]
- Fan, L.; Shi, Y.; Jiang, W.; Zheng, Y. Study on the Species of Long-Horned Beetles Carrying Bursaphelenchus xylophilus in Liaoning. For. Res. 2021, 34, 174–181. [Google Scholar]
- Pan, L.; Li, Y.X.; Liu, Z.K.; Meng, F.L.; Chen, J.; Zhang, X.Y. Isolation and Identification of Pine Wood Nematode in Pinus koraiensis in Fengcheng, Liaoning Province. For. Pest Dis. 2019, 38, 1–4. [Google Scholar]
- Yu, H.Y.; Wu, H.; Huang, R.F.; Wang, J.; Zhang, R.X.; Song, Y.S. Separation and Identification of Bursaphelenchus xylophilus from Pinus sylvestris var. mongolica in Fushun City. For. Pest Dis. 2020, 39, 6–10. [Google Scholar]
- Kikuchi, T.; Cotton, J.A.; Dalzell, J.J.; Hasegawa, K.; Kanzaki, N.; McVeigh, P.; Takanashi, T.; Tsai, I.J.; Assefa, S.A.; Cock, P.J.A.; et al. Genomic Insights into the Origin of Parasitism in the Emerging Plant Pathogen Bursaphelenchus xylophilus. PLoS Pathog. 2011, 7, e1002219. [Google Scholar] [CrossRef]
- Li, Y.X.; Zhang, X.Y. Analysis on the Trend of Invasion and Expansion of Bursaphelenchus xylophilus. For. Pest Dis. 2018, 37, 1–4. [Google Scholar]
- Goverse, A.; Smant, G. The Activation and Suppression of Plant Innate Immunity by Parasitic Nematodes. Annu. Rev. Phytopathol. 2014, 52, 243–265. [Google Scholar] [CrossRef]
- Holbein, J.; Grundler, F.M.; Siddique, S. Plant Basal Resistance to Nematodes: An Update. J. Exp. Bot. 2016, 67, 2049–2061. [Google Scholar] [CrossRef]
- Khan, M.; Khan, A.U. Plant Parasitic Nematodes Effectors and Their Crosstalk with Defense Response of Host Plants: A Battle Underground. Rhizosphere 2021, 17, 100288. [Google Scholar] [CrossRef]
- Espada, M.; Eves van den Akker, S.; Maier, T.; Vijayapalani, P.; Baum, T.; Mota, M.; Jones, J.T. Statawaars: A Promoter Motif Associated with Spatial Expression in the Major Effector-Producing Tissues of the Plant-Parasitic Nematode Bursaphelenchus xylophilus. BMC Genom. 2018, 19, 553. [Google Scholar] [CrossRef] [PubMed]
- Espada, M.; Silva, A.C.; Eves van den Akker, S.; Cock, P.J.; Mota, M.; Jones, J.T. Identification and Characterization of Parasitism Genes from the Pinewood Nematode Bursaphelenchus xylophilus Reveals a Multilayered Detoxification Strategy. Mol. Plant Pathol. 2016, 17, 286–295. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.-J.; Wu, X.-Q.; Li, H.-Y.; Zhao, Q.; Wang, Y.-C.; Ye, J.-R. An Effector, Bxsapb1, Induces Cell Death and Contributes to Virulence in the Pine Wood Nematode Bursaphelenchus xylophilus. Mol. Plant-Microbe Interact. 2019, 32, 452–463. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Hu, L.; Wu, X. Identification of a Novel Effector Bxsapb3 That Enhances the Virulence of Pine Wood Nematode Bursaphelenchus xylophilus. Acta Biochim. Biophys. Sin. 2019, 51, 1071–1078. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Hu, L.-J.; Wu, X.-Q.; Wang, Y.-C. A Key Effector, Bxsapb2, Plays a Role in the Pathogenicity of the Pine Wood Nematode Bursaphelenchus xylophilus. For. Pathol. 2020, 50, e12600. [Google Scholar] [CrossRef]
- Haegeman, A.; Mantelin, S.; Jones, J.T.; Gheysen, G. Functional Roles of Effectors of Plant-Parasitic Nematodes. Gene 2012, 492, 19–31. [Google Scholar] [CrossRef]
- Wilbers, R.H.P.; Schneiter, R.; Holterman, M.H.M.; Drurey, C.; Smant, G.; Asojo, O.A.; Maizels, R.M.; Lozano-Torres, J.L. Secreted Venom Allergen-like Proteins of Helminths: Conserved Modulators of Host Responses in Animals and Plants. PLoS Pathog. 2018, 14, e1007300. [Google Scholar] [CrossRef]
- Gaikwad, A.S.; Hu, J.; Chapple, D.G.; O’Bryan, M.K. The Functions of Cap Superfamily Proteins in Mammalian Fertility and Disease. Hum. Reprod. Update 2020, 26, 689–723. [Google Scholar] [CrossRef]
- Cantacessi, C.; Gasser, R.B. Scp/Taps Proteins in Helminths—Where to from Now? Mol. Cell. Probes 2012, 26, 54–59. [Google Scholar] [CrossRef]
- Lozano-Torres, J.L.; Wilbers, R.H.; Gawronski, P.; Boshoven, J.C.; Finkers-Tomczak, A.; Cordewener, J.H.; America, A.H.; Overmars, H.A.; Van ‘t Klooster, J.W.; Baranowski, L.; et al. Dual Disease Resistance Mediated by the Immune Receptor Cf-2 in Tomato Requires a Common Virulence Target of a Fungus and a Nematode. Proc. Natl. Acad. Sci. USA 2012, 109, 10119–10124. [Google Scholar] [CrossRef]
- Lozano-Torres, J.L.; Wilbers, R.H.; Warmerdam, S.; Finkers-Tomczak, A.; Diaz-Granados, A.; van Schaik, C.C.; Helder, J.; Bakker, J.; Goverse, A.; Schots, A.; et al. Apoplastic Venom Allergen-like Proteins of Cyst Nematodes Modulate the Activation of Basal Plant Innate Immunity by Cell Surface Receptors. PLoS Pathog. 2014, 10, e1004569. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.S.; Koh, Y.H.; Moon, Y.S.; Lee, S.H. Molecular Properties of a Venom Allergen-like Protein Suggest a Parasitic Function in the Pinewood Nematode Bursaphelenchus xylophilus. Int. J. Parasitol. 2012, 42, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Somvanshi, V.S.; Phani, V.; Banakar, P.; Chatterjee, M.; Budhwar, R.; Shukla, R.N.; Rao, U. Transcriptomic Changes in the Pre-Parasitic Juveniles of Meloidogyne incognita Induced by Silencing of Effectors Mi-Msp-1 and Mi-Msp-20. 3 Biotech 2020, 10, 360. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, S.; Dutta, T.K.; Tyagi, N.; Shivakumara, T.N.; Papolu, P.K.; Chobhe, K.A.; Rao, U. Host-Induced Silencing of Mi-Msp-1 Confers Resistance to Root-Knot Nematode Meloidogyne incognita in Eggplant. Transgenic Res. 2019, 28, 327–340. [Google Scholar] [CrossRef]
- Gao, B.; Allen, R.; Maier, T.; Davis, E.L.; Baum, T.J.; Hussey, R.S. Molecular Characterisation and Expression of Two Venom Allergen-like Protein Genes in Heterodera glycines. Int. J. Parasitol. 2001, 31, 1617–1625. [Google Scholar] [CrossRef]
- Luo, S.; Liu, S.; Kong, L.; Peng, H.; Huang, W.; Jian, H.; Peng, D. Two Venom Allergen-like Proteins, Havap1 and Havap2, Are Involved in the Parasitism of Heterodera avenae. Mol. Plant Pathol. 2019, 20, 471–484. [Google Scholar] [CrossRef]
- Li, Y.-X.; Wang, Y.; Liu, Z.-Y.; Wang, X.; Lu, Q.; Jia, X.-Z.; Zhang, X.-Y. Functional Analysis of the Venom Allergen-like Protein Gene from Pine Wood Nematode Bursaphelenchus xylophilus Using a Baculovirus Expression System. Physiol. Mol. Plant Pathol. 2016, 93, 58–66. [Google Scholar] [CrossRef]
- Shinya, R.; Morisaka, H.; Kikuchi, T.; Takeuchi, Y.; Ueda, M.; Futai, K. Secretome Analysis of the Pine Wood Nematode Bursaphelenchus xylophilus Reveals the Tangled Roots of Parasitism and Its Potential for Molecular Mimicry. PLoS ONE 2013, 8, e67377. [Google Scholar] [CrossRef]
- Lin, S.; Jian, H.; Zhao, H.; Yang, D.; Liu, Q. Cloning and Characterization of a Venom Allergen-like Protein Gene Cluster from the Pinewood Nematode Bursaphelenchus xylophilus. Exp. Parasitol. 2011, 127, 440–447. [Google Scholar] [CrossRef]
- Wang, Y. Functional Analysis of Venom Allergen-like Protein Gene from the Pinewood Nematode Bursaphelenchus xylophilus Using Insect Cell Expression System. Ph.D. Thesis, Northeast Forestry University, Harbin, China, 2014. [Google Scholar]
- Niu, H.; Zhao, L.; Lu, M.; Zhang, S.; Sun, J. The Ratio and Concentration of Two Monoterpenes Mediate Fecundity of the Pinewood Nematode and Growth of Its Associated Fungi. PLoS ONE 2012, 7, e31716. [Google Scholar] [CrossRef]
- Yan, X.; Cheng, X.Y.; Wang, Y.S.; Luo, J.; Mao, Z.C.; Ferris, V.R.; Xie, B.Y. Comparative Transcriptomics of Two Pathogenic Pinewood Nematodes Yields Insights into Parasitic Adaptation to Life on Pine Hosts. Gene 2012, 505, 81–90. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, T.; Pan, Z.; Lin, L.; Dong, G.; Wang, M.; Li, R. The Alcohol Dehydrogenase with a Broad Range of Substrate Specificity Regulates Vitality and Reproduction of the Plant-Parasitic Nematode Bursaphelenchus xylophilus. Parasitology 2018, 146, 497–505. [Google Scholar] [CrossRef] [PubMed]
- Lu, F.; Guo, K.; Chen, A.; Chen, S.; Lin, H.; Zhou, X. Transcriptomic Profiling of Effects of Emamectin Benzoate on the Pine Wood Nematode Bursaphelenchus xylophilus. Pest Manag. Sci. 2020, 76, 747–757. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Wang, X.; Li, D.; Zhang, W.; Li, Y.; Zhang, X. Prokaryotic Expression, Polyclonal Antibody Preparation and Expression Pattern Analysis of Venom-Allergen Proteins from Bursaphelenchus xylophilus. J. Beijing For. Univ. 2021, 43, 38–50. [Google Scholar]
- Viglierchio, D.R.; Schmitt, R.V. On the Methodology of Nematode Extraction from Field Samples: Baermann Funnel Modifications. J. Nematol. 1983, 15, 7. [Google Scholar]
- Ben, A.L.; Han, Z.M.; Han, X.; Sun, P. A Study of the Acquisition of Sterilized Nematode and Growth of the Pine Wood Nematode. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2008, 51, 99–102. [Google Scholar]
- Otoguro, K.; Liu, Z.X.; Fukuda, K.; Li, Y.; Iwai, Y.; Tanaka, H.; Omura, S. Screening for New Nematocidal Substances of Microbial Origin by a New Method Using the Pine Wood Nematode. J. Antibiot. 1988, 41, 573–575. [Google Scholar] [CrossRef]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The Meme Suite. Nucleic Acids Res. 2015, 43, 11. [Google Scholar] [CrossRef]
- Wen, T.Y.; Wu, X.Q.; Hu, L.J.; Qiu, Y.J.; Rui, L.; Zhang, Y.; Ding, X.L.; Ye, J.R. A Novel Pine Wood Nematode Effector, Bxscd1, Suppresses Plant Immunity and Interacts with an Ethylene-Forming Enzyme in Pine. Mol. Plant Pathol. 2021, 22, 1399–1412. [Google Scholar] [CrossRef]
- Kikuchi, T.; Li, H.; Karim, N.; Kennedy, M.W.; Jones, J.T. Identification of Putative Expansin-like Genes from the Pine Wood Nematode, Bursaphelenchus xylophilus, and Evolution of the Expansin Gene Family within the Nematoda. Nematology 2009, 11, 355–364. [Google Scholar]
- Lunt, D.H.; Kumar, S.; Koutsovoulos, G.; Blaxter, M.L. The Complex Hybrid Origins of the Root Knot Nematodes Revealed through Comparative Genomics. arXiv 2013, arXiv:1306.6163. [Google Scholar] [CrossRef]
- Abad, P.; Gouzy, J.M.; Aury, J.M.; Castagnone-Sereno, P.; Danchin, E.G.J.; Deleury, E.; Perfus-Barbeoch, L.; Anthouard, V.; Artiguenave, F.O.; Blok, V.C. Genome Sequence of the Metazoan Plant-Parasitic Nematode Meloidogyne incognita. Nat. Biotechnol. 2008, 26, 909. [Google Scholar] [CrossRef] [PubMed]
- Akker, E.V.D.; Laetsch, D.R.; Thorpe, P.; Lilley, C.J.; Jones, J.T. The Genome of the Yellow Potato Cyst Nematode, Globodera rostochiensis, Reveals Insights into the Basis of Parasitism and Virulence. Genome Biol. 2016, 17, 124. [Google Scholar]
- Kumar, M.; Gantasala, N.P.; Roychowdhury, T.; Thakur, P.K.; Banakar, P.; Shukla, R.N.; Jones, M.G.K.; Rao, U. De Novo Transcriptome Sequencing and Analysis of the Cereal Cyst Nematode, Heterodera avenae. PLoS ONE 2014, 9, e96311. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Hu, L.-J.; Wu, X.-Q.; Ye, J.-R. A Bursaphelenchus xylophilus Effector, Bx-Far-1, Suppresses Plant Defense and Affects Nematode Infection of Pine Trees. Eur. J. Plant Pathol. 2020, 157, 637–650. [Google Scholar] [CrossRef]
- Wen, T.Y.; Wu, X.Q.; Ye, J.R.; Qiu, Y.J.; Rui, L.; Zhang, Y. A Bursaphelenchus xylophilus Pathogenic Protein Bx-Far-1, as Potential Control Target, Mediates the Jasmonic Acid Pathway in Pines. Pest Manag. Sci. 2022, 78, 1870–1880. [Google Scholar] [CrossRef]
- Modesto, I.; Mendes, A.; Carrasquinho, I.; Miguel, C.M. Molecular Defense Response of Pine Trees (Pinus spp.) to the Parasitic Nematode Bursaphelenchus xylophilus. Cells 2022, 11, 3208. [Google Scholar] [CrossRef]
- Qiu, Y.J.; Wu, X.Q.; Wen, T.Y.; Hu, L.J.; Rui, L.; Zhang, Y.; Ye, J.R. The Bursaphelenchus xylophilus Candidate Effector Bxlip-3 Targets the Class I Chitinases to Suppress Immunity in Pine. Mol. Plant Pathol. 2023, 24, 1033–1046. [Google Scholar] [CrossRef]
- Wen, T.Y.; Wu, X.Q.; Ye, J.R.; Qiu, Y.J.; Rui, L.; Zhang, Y. Two Novel Bursaphelenchus xylophilus Kunitz Effector Proteins Using Different Infection and Survival Strategies to Suppress Immunity in Pine. Phytopathology 2023, 113, 539–548. [Google Scholar] [CrossRef]




| Primer Function | Primer Name | Sequence (5′—3′) |
|---|---|---|
| PVX linearization primers | PVX-F | TCAGCACCAGCTAGCATCGAT |
| PVX-R | GTAGTCCATGGATCCCCCGGG | |
| BxVAP2 with signal peptide | PVX-VAP2-F | TCAGCACCAGCTAGCATCGATATGGTTCGAGTATTAGTTCT |
| PVX-VAP2-R | GTAGTCCATGGATCCCCCGGGTCAGGCACTGCACAAACTGT | |
| BxVAP2 without signal peptide | PVX-VAP1nsp-F | TCAGCACCAGCTAGCATCGATACCAAATTCAGCGAAAGCCAA |
| PVX-VAP1nsp-R | GTAGTCCATGGATCCCCCGGGTCAGGCGCTACACAGACTGT | |
| BAX | PVX-BAX-F | TCAGCACCAGCTAGCATCGATATGGACGGGTCCGGGGAGA |
| PVX-BAX-R | GTAGTCCATGGATCCCCCGGGTCAAGCGTAATCTGGAACAT | |
| Validation primer for recombinant plasmid | PVX-CX-F | GTTGAACGGTTAAGTTTCCA |
| PVX-CX-R | ATCGTCATCGTCCTTGTAAT | |
| NbAcre31 | NbAcre31-qF | AATTCGGCCATGTGATCTTGGTC |
| NbAcre31-qR | GAGAAACTGGGATTGCCTGAAGGA | |
| NbGras2 | NbGras2-qF | TACCTAGCACCAAGCAGATGCAGA |
| NbGras2-qR | CGTTGCCATCTCTCATCTCA | |
| NbPTI5 | NbPTI5-qF | CCTCCAAGTTTGAGCTCGGATAGT |
| NbPTI5-qR | CCAAGAAATTCTCCATGCACTCTGTC | |
| NbCyp71D20 | NbCyp71D20-qF | GTTGACGCCATTGTTGAG |
| NbCyp71D20-qR | ATCTTCGCCTCCTAATGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, Y.; Li, Y.; Li, D.; Liu, Z.; Wang, X.; Zhang, W.; Wen, X.; Zhang, X. Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana. Forests 2024, 15, 1929. https://doi.org/10.3390/f15111929
Feng Y, Li Y, Li D, Liu Z, Wang X, Zhang W, Wen X, Zhang X. Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana. Forests. 2024; 15(11):1929. https://doi.org/10.3390/f15111929
Chicago/Turabian StyleFeng, Yuqian, Yongxia Li, Dongzhen Li, Zhenkai Liu, Xuan Wang, Wei Zhang, Xiaojian Wen, and Xingyao Zhang. 2024. "Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana" Forests 15, no. 11: 1929. https://doi.org/10.3390/f15111929
APA StyleFeng, Y., Li, Y., Li, D., Liu, Z., Wang, X., Zhang, W., Wen, X., & Zhang, X. (2024). Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana. Forests, 15(11), 1929. https://doi.org/10.3390/f15111929

