Next Article in Journal
The Spectral Response Characteristics of Potassium in Camellia oleifera Leaves at Different Growth Stages
Previous Article in Journal
Species Differentiation of Prunus serrulata and Prunus xueluoensis Based on Combined Analysis of SSR and cpDNA Markers
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana

1
Key Laboratory of Forest Protection of National Forestry and Grassland Administration, Ecology and Nature Conservation Institute, Chinese Academy of Forestry, Beijing 100091, China
2
Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China
3
Kunyushan Forest Ecosystem National Observation and Research Station, Yantai 264100, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(11), 1929; https://doi.org/10.3390/f15111929
Submission received: 14 September 2024 / Revised: 23 October 2024 / Accepted: 29 October 2024 / Published: 1 November 2024
(This article belongs to the Section Forest Ecophysiology and Biology)

Abstract

The pine wood nematode (Bursaphelenchus xylophilus), the pathogen of pine wilt disease (PWD), has caused enormous economic losses in Asian forests. Whether venom allergen proteins (VAPs) are involved in the accumulation of key defense substances in pine trees during the interaction between B. xylophilus and host trees, and their specific function as putative effectors secreted through stylets, has not been fully elucidated. In this study, the role of the BxVAP2 effector protein in the infection process was analyzed through bioinformatics and phylogenetic tree construction. The expression profile of BxVAP2 during infection was analyzed using qRT-PCR, and its expression under the stress of Pinus massoniana metabolites was examined. Toxicity assays were conducted through the Agrobacterium transient expression of BxVAP2 in Nicotiana benthamiana, and its subcellular localization was investigated. The results showed that BxVAP2 contains a CAP domain and shares close evolutionary relationships with venom allergen proteins from related species, such as Bursaphelenchus mucronatus, Aphelenchoides besseyi, Aphelenchoides fujianensis, and Meloidogyne graminicola. BxVAP2 was upregulated during the infection of P. massoniana, indicating that BxVAP2 is a key effector in the infection and colonization process of B. xylophilus and may play an important role during the rapid population growth phase. BxVAP2 responds to P. massoniana metabolites, where different concentrations of α-pinene suppressed its expression, while high concentrations of β-pinene promoted its expression. Subcellular localization revealed that BxVAP2 localizes to the cell membrane and nucleus. The transient expression of BxVAP2 in N. benthamiana induced programmed cell death and regulated pattern-triggered immunity marker genes. These findings suggest that BxVAP2 plays an important role in the interaction between B. xylophilus and its host, responding to terpene stress and triggering plant defense.

1. Introduction

The pine wood nematode (PWN), a migratory endoparasitic nematode associated with the vascular system of plants, is the causative agent of pine wilt disease (PWD) [1]. Due to its origin, its strong environmental adaptability, its diverse distribution of host plants, its widespread presence of vector insects, and its rapid development of economic and logistical activities [2,3,4,5], PWD has significant economic and ecological impacts on forests in Asia and Europe [6]. Furthermore, most pine forests in China are susceptible to PWN infection, with the added complication of latent infection, making control efforts difficult [7]. Despite being a destructive plant-parasitic nematode that threatens the safety of pine forests worldwide, effective and safe control measures for PWD remain lacking. To develop new control strategies, there is an urgent need to unravel the pathogenic mechanisms of PWNs.
Interactions between plant-parasitic nematodes and their host plants are mediated by effectors, which are secreted from the esophageal gland cells through the stylet into host plant cells. These effectors manipulate host cells, suppressing the plant’s basal defense mechanisms to facilitate nematode feeding, reproduction, and migration. In response, plants activate several complementary immune systems to recognize and resist nematode infection [8,9,10]. In recent years, bioinformatic approaches combining genomic and transcriptomic data have predicted several candidate effectors from Bursaphelenchus xylophilus [11,12]. These studies have identified effectors specifically involved in the interaction between B. xylophilus and its host, focusing primarily on whether these effectors promote or suppress host defense responses. For example, BxSapB1, BxSapB2, and BxSapB3 induce programmed cell death in Nicotiana benthamiana, while BxFAR-1 and BxCDP1 inhibit programmed cell death [13,14,15]. Effectors play crucial roles in the host–pathogen interaction during the infection process [16]. Therefore, functional studies of effectors are key to understanding the molecular mechanisms of plant nematode pathogenicity.
Venom allergen proteins (VAPs) belong to the SCP/TAPS (sperm-coating protein/Tpx-1/Ag-5/Pr-1/Sc-7) superfamily, also known as the cysteine-rich secretory protein (CRISP)/Ag-5/Pr-1 (CAP) superfamily [17,18,19]. VAPs are commonly found in plant-parasitic nematodes and are relatively conserved in structure [17]. VAPs can act as activators or inhibitors that interfere with host plant defense mechanisms triggered by damage-associated molecular patterns (DAMPs) or nematode-associated molecular patterns (NAMPs), playing an essential role in establishing persistent infection in the host [9,20,21,22]. Genes encoding VAP proteins have been identified in various plant-parasitic nematodes, including Meloidogyne incognita, Heterodera glycines, Ditylenchus destructor, Bursaphelenchus xylophilus, Globodera rostochiensis, and Heterodera schachtii [20,21,22,23,24,25,26,27]. These proteins are presumed to play important roles in the infection process of plant-parasitic nematodes. VAPs secreted through the stylet are crucial for regulating host responses during the nematode’s migration through host tissues and in the early stages of infection.
Shinya et al. conducted a proteomic analysis of the secretome of B. xylophilus and suggested that VAPs, as resistance-related proteins, are key factors enabling successful nematode infection and colonization. The transcriptomic analysis of the esophageal gland cells of B. xylophilus revealed that VAPs are presumed to be effector proteins [11,28]. In 2011, three functional VAP genes (BxVAP1, BxVAP2, and BxVAP3) were first cloned from B. xylophilus, all of which were specifically expressed in the subventral esophageal glands [29]. These proteins may be secreted through the stylet to suppress the host pine’s defense response and participate in the early parasitic behavior and migration process of the nematode [22]. The BxVAP1 protein expressed in vitro can induce the upregulation of α-pinene synthase genes in host pine, leading to an increase in α-pinene content in the tree, which in turn causes tissue damage and programmed cell death [27,30]. The accumulation of terpenoids is the primary defense response of pine trees against pathogens. After nematode infection, the substantial increase in volatile monoterpenes such as α-pinene can lead to tracheid cavitation in the xylem, ultimately causing the tree to die due to impaired water transport. Both α-pinene and β-pinene are the major monoterpenes produced by pine trees. Niu et al. reported that low concentrations of α-pinene and β-pinene inhibit the reproduction of PWNs, while high concentrations promote reproduction [31]. The role of VAP proteins in response to terpene accumulation is a key factor in the interaction between B. xylophilus and its host. Transcriptome analysis has revealed the expression of multiple VAPs in PWN, which, as resistance-related genes, may possess antibacterial functions [32,33,34]. After treating pine wood nematodes with emamectin benzoate for 24 h, the expression of BxVAP2 (Wormbase ID: BXY_1378600) in PWN was upregulated by 1.52-fold [34]. BxVAP2 in pine wood nematodes was highly expressed during the adult stage, potentially related to adult development [35]. However, the specific function of BxVAP2 as an effector protein in pine wood nematodes has not been confirmed.
Therefore, in this study, we conducted a conservative domain and motif analysis on the protein sequences of multiple nematode CAP gene families, and constructed a phylogenetic tree for BxVAP2. Quantitative Real-Time PCR was used to analyze the expression profile of BxVAP2 during the infection of pine wood nematodes in Pinus massoniana, and simultaneously detect the expression profile of BxVAP2 in response to α-pinene and β-pinene. To clarify the localization of BxVAP2 in plants, subcellular localization detection was performed. To verify its effector function, transient expression was conducted in Nicotiana benthamiana using a Potato Virus X (PVX) expression vector to investigate whether it induces cell death and affects PTI-related immune responses in N. benthamiana, thereby clarifying the effector protein function of BxVAP2 in PWN. This study lays the foundation for elucidating the molecular mechanism of pine wood nematode pathogenicity.

2. Materials and Methods

2.1. Nematode Source

The NXY61 strain was preserved in our laboratory and used in this study. This strain was isolated from Pinus massoniana branches that exhibited symptoms of pine wilt disease in Ningbo, Zhejiang Province, in October 2012. After isolation using the Baermann funnel technique [36], the nematodes were stored long-term on Botrytis cinerea cornmeal agar medium [37].
According to the method of previous research [38], 3-year-old P. massoniana trees grown in a greenhouse were inoculated. The lateral branches were cut 1 cm away from the main stem, and a 1.5 mL centrifuge tube with its bottom removed was fixed to the incision with parafilm. A 100 μL suspension of 1000 NXY61 nematodes was injected into the centrifuge tube. Samples were collected every 3 days after inoculation, for a total of 10 times. Each treatment had three replicates. Nematodes were collected from the inoculated pine trees using the Baermann funnel technique, washed three times with sterile water, and frozen in liquid nitrogen before being stored at −80 °C for subsequent qPCR analysis of the BxVAP2 gene expression during infection.
To analyze the effects of α-pinene and β-pinene on nematode gene expression, α-pinene (Acros Organics, purity 97%, Geel, Belgium) and β-pinene (Alfa Aesar, purity 99%, Heysham, UK) were each dissolved in ddH2O containing 0.5% Triton X-100 to prepare solutions of five concentrations: 13.76 mg/mL, 25.74 mg/mL, 42.90 mg/mL, 110.00 mg/mL and 137.6 mg/mL. These concentrations were chosen based on previous studies showing their effects on the reproductive rate of PWNs [31]. The PWNs were soaked in 96-well plates. In the pinene treatment group, 200 μL α-pinene solution or β-pinene solution of different concentrations were added to each well, and 500 nematodes (mixed development stage) were incubated at 25 °C for 72 h. The control group CK-0 h consisted of nematodes in mixed stages without any treatment. The nematodes of the control group CK-72 h were soaked in ddH2O of 0.5% Triton X-100 for 72 h. After treatment, the 96-well plates were placed on a shaker (150 rpm) for 30 min, washed with ddH2O, and frozen in liquid nitrogen before storage at −80 °C for the subsequent qPCR analysis of BxVAP2 expression in response to terpenes.

2.2. Phylogenetic Analysis and Conserved Motif Identification of BxVAP2

To explore the evolutionary relationship of the BxVAP2 protein, a BLAST search was conducted using the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 6 August 2024)) to identify homologous gene sequences. A total of 44 CAP family protein sequences were obtained for comparison. Conserved domain analysis was conducted using the NCBI Conserved Domain Database (https://www.ncbi.nlm.nih.gov/cdd (accessed on 8 September 2024)), and conserved motifs were analyzed using the MEME suite (https://meme-suite.org/meme/ (accessed on 8 September 2024)) [39]. The number of motifs was set to 10, and other parameters were kept at default values. A phylogenetic tree of BxVAP2 was constructed using the maximum likelihood method in MEGA 11.0 software. The results of the phylogenetic analysis, motif identification, and conserved domain analysis were visualized using the Gene Structure View tool in TBtools software 2.025 to construct a phylogenetic tree of the CAP family proteins from B. xylophilus and other species.

2.3. Quantitative Real-Time PCR (qRT-PCR) Analysis of BxVAP2 Expression

Total RNA was extracted from the nematodes using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. The first-strand cDNA was synthesized using the PrimeScript RT Reagent Kit with a gDNA Eraser (TaKaRa, Shiga, Japan) with 1000 ng of total RNA. Specific primers were designed based on the BxVAP2 gene sequence (GenBank accession number: GQ272490.1) for qRT-PCR analysis. The primer sequences were as follows: RT-BxVAP2-qF: GCTGTGCCATTCAGAACT and RT-BxVAP2-qR: GCTCCCATCATGTTTCCA. Nematode β-actin (GenBank accession number: MT769316.1) was used as the internal reference gene (β-actin-qF: TCCGTACCCTGAAGTTGGCTAACC, β-actin-qR: AAGTGGAGACGAGGGAATGGAACC). Real-time PCR was performed using a Roche 480 Real-time PCR System with a KAPA SYBR Fast qPCR Master Mix (Roche, Beijing, China). The expression levels of BxVAP2 were analyzed during the nematode infection of P. massoniana and after treatment with α-pinene and β-pinene using the 2−ΔΔCt method [23].

2.4. Subcellular Localization of BxVAP2

To investigate the subcellular localization of BxVAP2, a plasmid containing the green fluorescent protein (GFP) gene fused to the C-terminal of BxVAP2 was constructed. The plasmid pBI121-BxVAP2-GFP was generated using the primers pBI121-BxVAP2-F (CTCTAGACTGGTACCACCAAATTCAGCGAAAGCCAA) and pBI121-BxVAP2-R (GTCGACCCGGGTACCTCAGGCGCTACACAGACTGT). The PCR-amplified BxVAP2 fragment was purified using a PCR product purification kit (EZNA cycle pure, kit vacuum protocol, OMEGA Bio-Tek, Norcross, GA, USA). The purified fragment was cloned into the pBI121 vector using the ClonExpress® II One Step Cloning Kit (Vazyme, Nanjing, China) to fuse BxVAP2 with GFP. The recombinant plasmid was transformed into Agrobacterium tumefaciens strain GV3101 and cultured overnight. After sedimentation, the Agrobacterium cells were resuspended in infiltration buffer containing 10 mM 2-(N-morpholino) ethanesulfonic acid (MES, Sigma-Aldrich, St. Louis, MO, USA), 10 mM MgCl2, and 200 μM acetosyringone (AS, Sigma-Aldrich) to reach an OD600 of 1.0. The Agrobacterium suspension was incubated at room temperature for 2–4 h before being injected into healthy N. benthamiana leaves using a syringe. The infiltrated plants were incubated in darkness for 48 h. The subcellular localization of BxVAP2 was observed using a Zeiss LSM 880 laser scanning confocal microscope (Zeiss, Jena, Germany). GFP fluorescence was excited at 488 nm, and emission was collected at 510 nm to visualize the distribution of BxVAP2 in N. benthamiana cells.

2.5. Construction of Agrobacterium Expression Plasmids

Linearized Potato virus X (PVX) vectors were obtained by PCR amplification using PVX-specific primers, and homologous arms were added to the target gene amplification primers (Table 1). The BxVAP2 gene with and without its signal peptide, as well as the BAX gene, were cloned into the linearized PVX vector using the ClonExpress® II One Step Cloning Kit (Vazyme). The recombinant plasmids were transformed into Escherichia coli DH5α competent cells. Single colonies were selected and verified via PCR amplification using primers PVX-CX-F (GTTGAACGGTTAAGTTTCCA) and PVX-CX-R (ATCGTCATCGTCCTTGTAAT), followed by sequencing to confirm the correct insertion of the target gene. The confirmed recombinant plasmids, including PVX:GFP, PVX:BAX, PVX:BxVAP2, and PVX:BxVAP2nsp, were transformed into A.tumefaciens GV3101 for use in tobacco injection.

2.6. Protein Expression and Western Blot Analysis

Total protein extraction and Western blot analysis were performed following a previously described protocol [40]. The expression of BxVAP2 in N. benthamiana was detected using an anti-flag primary antibody (Abcam, Cambridge, UK).

2.7. Expression Analysis of Pattern-Triggered Immunity (PTI) Marker Genes and Drought-Related Genes in N. benthamiana After Transient Expression of BxVAP2

To analyze the effects of BxVAP2 on PTI and drought-related genes in N. benthamiana, 1 mL of Agrobacterium suspension (OD600 = 1) was injected into tobacco leaves. PVX: GFP and PVX: BAX were used as negative and positive controls, respectively. The same recombinant Agrobacterium plasmids were injected into different leaves of each tobacco plant, with three biological replicates. After 48 h, the samples were collected for gene expression analysis. The expression levels of PTI marker genes NbACRE31 (a putative calcium-binding protein), NbPTI5 (pathogenesis-related genes transcriptional activator), and NbCyp71D20 (a putative cytochrome P450) were quantified, using NbEF1α (GenBank accession number: XM_016637415.1) as the internal reference gene.

2.8. Statistical Analysis

For gene expression level assays and analyses, statistical comparisons were performed with one-way ANOVA followed by a least-significant difference comparison. A p value < 0.05 was considered statistically significant.

3. Results and Analysis

3.1. Phylogenetic Analysis, Structural Domains, and Conserved Motifs of BxVAP2

The phylogenetic tree analysis showed that the BxVAP2 protein from Bursaphelechus xylophilus clustered closely with Bursaphelenchus mucronatus, Aphelenchoides besseyi, Aphelenchoides fujianensis, and Meloidogyne graminicola in a single small clade, indicating close genetic relationships among these species. The CAP family proteins mainly contained two structural domains: CAP-euk and SCP (Figure 1A). The conserved motif analysis revealed that the 44 CAP family members contained 10 motifs, named Motif1 through Motif10 (Figure 1B). All the members except KAF7632430.1MgVAP had Motif1~Motif5. All the motifs were located in the CAP-euk and SCP domains.

3.2. Expression Pattern of BxVAP2 in B. xylophilus

The expression pattern of the BxVAP2 gene in B. xylophilus during infection of P. massoniana was analyzed using qRT-PCR. The results showed that the expression of BxVAP2 varied significantly throughout the infection process (p < 0.01). During the first 9 days, the BxVAP2 expression remained low and stable, but starting on day 12, its expression increased (4.63-fold), peaking on day 21 (9.32-fold), before gradually decreasing, reaching its lowest level on day 30 (Figure 2A). Additionally, to determine whether major defense substances in P. massoniana regulate the expression of BxVAP2, nematodes were treated with different concentrations of terpenoids. The results indicated that, compared to the CK-0h group, different concentrations of α-pinene inhibited the expression of the BxVAP2 gene in pine wood nematodes. In contrast, when compared to the CK-72h group, different concentrations of α-pinene promoted the expression of the BxVAP2 gene in pine wood nematodes (p < 0.01). Additionally, compared to the CK-0h group, 137.60 mg/mL of β-pinene increased the expression of BxVAP2 after 72 h. When compared to the CK-72h group, different concentrations of β-pinene all promoted the expression of the BxVAP2 gene in pine wood nematodes (p < 0.01). Therefore, different concentrations of α-pinene inhibited the expression of the BxVAP2 gene in pine wood nematodes, with a more significant inhibitory effect observed at concentrations below 42.90 mg/mL. Conversely, 137.60 mg/mL of β-pinene promoted the expression of BxVAP2.

3.3. Subcellular Localization of BxVAP2 in Nicotiana benthamiana

The BxVAP2-GFP fusion protein was transiently expressed in Nicotiana benthamiana leaves, and its subcellular localization was examined 48 h after infiltration. The results showed that BxVAP2nsp-GFP localized to both the cell membrane and nucleus (Figure 3B), while the control vector pBIN121-GFP was also distributed in the cell membrane and nucleus (Figure 3A).

3.4. Heterologous Expression of BxVAP2 Induces Cell Death and Affects PTI-Marker Genes Response in N. benthamiana

10 μL Agrobacterium suspension containing recombinant plasmids were injected into N. benthamiana leaves, and necrosis was observed 5 days later. The results showed that no visible changes occurred in the leaves injected with the control vector PVX:GFP, whereas necrosis was evident in the leaves injected with the positive control PVX:BAX. Similarly, necrosis was observed in the leaves injected with PVX:BxVAP2 and PVX:BxVAP2-nsp, regardless of the presence of the signal peptide. Additionally, the expression of the PTI-related gene NbAcre31 significantly increased 48 h after the injection of PVX:BxVAP2 (p < 0.01), while the expression of Nbcyp71D20 decreased (p < 0.01). The expression of NbGras2 and NbPTI5 did not change significantly compared to the GFP control group. However, the expression of NbPTI5 in the BxVAP2 group was significantly lower than in the BAX group (p < 0.01). In the BxVAP2nsp group, the expression of Nbcyp71D20 decreased, and the expressions of NbAcre31 and NbPTI5 were significantly lower than in the BAX group. The heterologous expression of BxVAP2 in N. benthamiana triggered a cell death response, induced the expression of the PTI marker gene NbAcre31, and suppressed the expression of NbCyp71D20, suggesting that BxVAP2 plays a role in regulating host immune responses (Figure 4).

4. Discussion

Bursaphelenchus xylophilus has caused serious damage to pine forests in China and has become one of the most important forest pathogens in recent years. However, its pathogenic mechanisms remain unclear. During the interaction between plants and nematodes, B. xylophilus secretes a large number of effectors, destroying the powerful innate immune system of plants [41]. With the increasing availability of the nematode genome and transcriptome sequencing data, databases of hypothetical effectors from various nematodes have been established [6,11,42,43,44,45]. The phylogenetic tree analysis indicates that the BxVAP2 protein of the pine wood nematode belongs to the CAP family proteins and is most closely related to B.mucronatus VAP1. Currently, research on the function of VAP1 in B.mucronatus remains relatively scarce and primarily focuses on gene expression, protein structure, and bioinformatics analysis. We can draw insights from the functional studies of VAP in other plant-parasitic nematodes to understand the function and evolutionary significance of B. xylophilus BxVAP2. These bioinformatics-based analyses have promoted the prediction and functional studies of effectors. Many candidate effectors from B. xylophilus have been identified, such as BxSapB1, BxSapB3, Bx-FAR-1, Bx-C, and BxSCD1 [13,14,40,46]. Some studies have reported that these effectors play important roles during the infection of host plants, with Bx-FAR-1 being highly expressed during the early infection stages [47]. In this study, the expression of BxVAP2 increased significantly on day 12 of infection, reaching a peak on day 21, more than 8-fold higher than baseline levels. This corresponds to the time point when the population of B. xylophilus rapidly expanded in 2-year-old P. massoniana (our laboratory’s data). The synthesis of terpene compounds is one of the primary defense responses of pine trees against pine wood nematodes [48]. Previous studies have found that BxVAP2 in PWN is highly expressed during the adult stage. When the concentration of α-pinene in healthy pine trees reaches 137.6 mg/mL, the reproduction of pine wood nematodes is inhibited. Conversely, when the β-pinene concentration exceeds 68.8 mg/mL, it promotes the reproduction of pine wood nematodes. These findings align with the results of this study, which show that 137.6 mg/mL of α-pinene inhibits the expression of BxVAP2, while a high concentration of 137.6mg/mL of β-pinene promotes the substantial expression of BxVAP2. Therefore, it is speculated that high concentrations of β-pinene promote the reproduction of pine wood nematodes and the substantial expression of BxVAP2, whereas α-pinene in healthy pine trees inhibits nematode reproduction and the expression of BxVAP2. In summary, it is hypothesized that BxVAP2 serves as a key effector during the infection and colonization process of B. xylophilus, responding to changes in host terpene content and playing a crucial role during the rapid population growth phase.
During the infection process, some effectors are secreted into host plant cells to exert their functions. Most subcellular localization studies of effectors use fusion gene expression vectors, introduced into plants via Agrobacterium infiltration to determine the site of action. For example, Qiu et al. used Agrobacterium infiltration to study the subcellular localization of the effector BxLip-3, a class III lipase from B. xylophilus, and found that BxLip-3 localized to the cell membrane and nucleus of N. benthamiana leaves [49]. Similarly, Wen et al. observed the distribution of BxKU1 and BxKU2 effectors in both the cell nucleus and cytoplasm using confocal microscopy [50]. In this study, BxVAP2 was transiently expressed in N. benthamiana via Agrobacterium infiltration, and the results showed that BxVAP2 localized to both the cell membrane and nucleus. This suggests that BxVAP2 may be secreted into host cells and interacts with host components in these locations, regulating the plant’s immune responses. However, how BxVAP2 enters the host cells and its specific toxic function remain important scientific questions that require further investigation.
Currently, the expression of candidate effector proteins N. benthamiana are widely used to identify effectors from various pathogens and parasitic nematodes and to study their effects on plant cell necrosis and immune responses. Previous functional studies of effectors have shown that some effectors of B. xylophilus can induce cell death and immune responses. For example, BxSapB1, BxSapB2, and BxSapB3 can induce programmed cell death in N. benthamiana cells [13,14,15]. In this study, we identified the pathogenic effector BxVAP2 from B. xylophilus. The heterologous expression of BxVAP2, regardless of whether the signal peptide was present, induced cell death in N. benthamiana and modulated immune-related responses. This suggests that BxVAP2 is an important effector protein secreted by B. xylophilus, capable of inducing programmed cell death in N. benthamiana cells without relying on the signal peptide. These nematode effectors, which induce PTI immune responses in tobacco, may share a common pathway that leads to cell necrosis. In this study, BxVAP2, relying on its signal peptide, induced the expression of PTI marker genes NbAcre31 and NbGras2 in N. benthamiana, while inhibiting the expression of the Nbcyp71D20 gene involved in the synthesis of secondary metabolic processes. The expression of NbPTI5 remained unaffected, potentially due to the distinct metabolic pathways regulated by BxVAP2 as an effector protein during its interaction with the plant. However, because the genetic system of P. massoniana is not yet well developed, the process of BxVAP2 inducing programmed cell death in tobacco may not fully represent the role of effectors during the B. xylophilus infection of P. massoniana. Further verification is needed. Meanwhile, there has been no research on the role of BxVAP2 from the pine wood nematode in other pine hosts, and whether its function is consistent between susceptible and resistant pine trees is also a scientific issue that deserves attention.
This study demonstrated through qRT-PCR that the BxVAP2 effector is upregulated during the mid-stage of the B. xylophilus infection of P. massoniana, indicating that BxVAP2 is a key gene involved in nematode colonization and plays a role in the nematode population’s growth. To further explore the function of BxVAP2, we constructed PVX and PVX recombinant plasmids, which were introduced into N. benthamiana using Agrobacterium for transient expression. The results showed that BxVAP2 induced cell necrosis and regulated PTI-related gene expression in N. benthamiana, indicating that BxVAP2 plays a significant role in the virulence of B. xylophilus and modulates host immune responses. Additionally, subcellular localization experiments revealed that BxVAP2 is localized to the cell membrane and nucleus, suggesting that it may interact with host cell components at these locations and regulate the host’s immune system. This study did not fully consider the ecological interactions in pine forests, such as the influence of other pathogens, environmental factors, or symbiotic organisms on the effectors of the pine wood nematode. Understanding the role of BxVAP2 in ecological interactions can provide insights for more sustainable management strategies. These findings provide a foundation for further research into the molecular mechanisms by which BxVAP2 interacts with host plants.

Author Contributions

Conceptualization, Y.F., Y.L. and X.Z.; methodology, Y.F. and D.L.; software, Y.F., D.L., W.Z. and X.W. (Xiaojian Wen); validation, Y.F.; formal analysis, Z.L. and X.W. (Xuan Wang); resources, Y.L.; data curation, Y.F. and W.Z.; writing—original draft, Y.F.; writing—review and editing, Y.F.; supervision, Y.L. and X.Z.; project administration, Y.L.; funding acquisition, Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported financially by the National Natural Science Foundation of China (NSFC32201571) and the National Key R&D Program of China (2021YFD1400900).

Data Availability Statement

Requests to access the datasets should be directed to the corresponding author.

Acknowledgments

We thank Yuan Cao from the State Key Laboratory of the Chinese Academy of Forestry for her excellent technical assistance on the morphology investigation (fluorescence observation).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Liu, B.; Liu, Q.; Zhou, Z.; Yin, H.; Xie, Y.; Wei, Y. Two Terpene Synthases in Resistant Pinus massoniana Contribute to Defence against Bursaphelenchus xylophilus. Plant Cell Environ. 2021, 44, 257–274. [Google Scholar] [CrossRef] [PubMed]
  2. Yu, H.Y.; Wu, H. New Host Plant and New Vector Insect of Bursaphelenchus xylophilus Found in Liaoning Province. For. Pest Dis. 2018, 37, 61. [Google Scholar]
  3. Fan, L.; Shi, Y.; Jiang, W.; Zheng, Y. Study on the Species of Long-Horned Beetles Carrying Bursaphelenchus xylophilus in Liaoning. For. Res. 2021, 34, 174–181. [Google Scholar]
  4. Pan, L.; Li, Y.X.; Liu, Z.K.; Meng, F.L.; Chen, J.; Zhang, X.Y. Isolation and Identification of Pine Wood Nematode in Pinus koraiensis in Fengcheng, Liaoning Province. For. Pest Dis. 2019, 38, 1–4. [Google Scholar]
  5. Yu, H.Y.; Wu, H.; Huang, R.F.; Wang, J.; Zhang, R.X.; Song, Y.S. Separation and Identification of Bursaphelenchus xylophilus from Pinus sylvestris var. mongolica in Fushun City. For. Pest Dis. 2020, 39, 6–10. [Google Scholar]
  6. Kikuchi, T.; Cotton, J.A.; Dalzell, J.J.; Hasegawa, K.; Kanzaki, N.; McVeigh, P.; Takanashi, T.; Tsai, I.J.; Assefa, S.A.; Cock, P.J.A.; et al. Genomic Insights into the Origin of Parasitism in the Emerging Plant Pathogen Bursaphelenchus xylophilus. PLoS Pathog. 2011, 7, e1002219. [Google Scholar] [CrossRef]
  7. Li, Y.X.; Zhang, X.Y. Analysis on the Trend of Invasion and Expansion of Bursaphelenchus xylophilus. For. Pest Dis. 2018, 37, 1–4. [Google Scholar]
  8. Goverse, A.; Smant, G. The Activation and Suppression of Plant Innate Immunity by Parasitic Nematodes. Annu. Rev. Phytopathol. 2014, 52, 243–265. [Google Scholar] [CrossRef]
  9. Holbein, J.; Grundler, F.M.; Siddique, S. Plant Basal Resistance to Nematodes: An Update. J. Exp. Bot. 2016, 67, 2049–2061. [Google Scholar] [CrossRef]
  10. Khan, M.; Khan, A.U. Plant Parasitic Nematodes Effectors and Their Crosstalk with Defense Response of Host Plants: A Battle Underground. Rhizosphere 2021, 17, 100288. [Google Scholar] [CrossRef]
  11. Espada, M.; Eves van den Akker, S.; Maier, T.; Vijayapalani, P.; Baum, T.; Mota, M.; Jones, J.T. Statawaars: A Promoter Motif Associated with Spatial Expression in the Major Effector-Producing Tissues of the Plant-Parasitic Nematode Bursaphelenchus xylophilus. BMC Genom. 2018, 19, 553. [Google Scholar] [CrossRef] [PubMed]
  12. Espada, M.; Silva, A.C.; Eves van den Akker, S.; Cock, P.J.; Mota, M.; Jones, J.T. Identification and Characterization of Parasitism Genes from the Pinewood Nematode Bursaphelenchus xylophilus Reveals a Multilayered Detoxification Strategy. Mol. Plant Pathol. 2016, 17, 286–295. [Google Scholar] [CrossRef] [PubMed]
  13. Hu, L.-J.; Wu, X.-Q.; Li, H.-Y.; Zhao, Q.; Wang, Y.-C.; Ye, J.-R. An Effector, Bxsapb1, Induces Cell Death and Contributes to Virulence in the Pine Wood Nematode Bursaphelenchus xylophilus. Mol. Plant-Microbe Interact. 2019, 32, 452–463. [Google Scholar] [CrossRef] [PubMed]
  14. Huang, X.; Hu, L.; Wu, X. Identification of a Novel Effector Bxsapb3 That Enhances the Virulence of Pine Wood Nematode Bursaphelenchus xylophilus. Acta Biochim. Biophys. Sin. 2019, 51, 1071–1078. [Google Scholar] [CrossRef] [PubMed]
  15. Zhao, Q.; Hu, L.-J.; Wu, X.-Q.; Wang, Y.-C. A Key Effector, Bxsapb2, Plays a Role in the Pathogenicity of the Pine Wood Nematode Bursaphelenchus xylophilus. For. Pathol. 2020, 50, e12600. [Google Scholar] [CrossRef]
  16. Haegeman, A.; Mantelin, S.; Jones, J.T.; Gheysen, G. Functional Roles of Effectors of Plant-Parasitic Nematodes. Gene 2012, 492, 19–31. [Google Scholar] [CrossRef]
  17. Wilbers, R.H.P.; Schneiter, R.; Holterman, M.H.M.; Drurey, C.; Smant, G.; Asojo, O.A.; Maizels, R.M.; Lozano-Torres, J.L. Secreted Venom Allergen-like Proteins of Helminths: Conserved Modulators of Host Responses in Animals and Plants. PLoS Pathog. 2018, 14, e1007300. [Google Scholar] [CrossRef]
  18. Gaikwad, A.S.; Hu, J.; Chapple, D.G.; O’Bryan, M.K. The Functions of Cap Superfamily Proteins in Mammalian Fertility and Disease. Hum. Reprod. Update 2020, 26, 689–723. [Google Scholar] [CrossRef]
  19. Cantacessi, C.; Gasser, R.B. Scp/Taps Proteins in Helminths—Where to from Now? Mol. Cell. Probes 2012, 26, 54–59. [Google Scholar] [CrossRef]
  20. Lozano-Torres, J.L.; Wilbers, R.H.; Gawronski, P.; Boshoven, J.C.; Finkers-Tomczak, A.; Cordewener, J.H.; America, A.H.; Overmars, H.A.; Van ‘t Klooster, J.W.; Baranowski, L.; et al. Dual Disease Resistance Mediated by the Immune Receptor Cf-2 in Tomato Requires a Common Virulence Target of a Fungus and a Nematode. Proc. Natl. Acad. Sci. USA 2012, 109, 10119–10124. [Google Scholar] [CrossRef]
  21. Lozano-Torres, J.L.; Wilbers, R.H.; Warmerdam, S.; Finkers-Tomczak, A.; Diaz-Granados, A.; van Schaik, C.C.; Helder, J.; Bakker, J.; Goverse, A.; Schots, A.; et al. Apoplastic Venom Allergen-like Proteins of Cyst Nematodes Modulate the Activation of Basal Plant Innate Immunity by Cell Surface Receptors. PLoS Pathog. 2014, 10, e1004569. [Google Scholar] [CrossRef] [PubMed]
  22. Kang, J.S.; Koh, Y.H.; Moon, Y.S.; Lee, S.H. Molecular Properties of a Venom Allergen-like Protein Suggest a Parasitic Function in the Pinewood Nematode Bursaphelenchus xylophilus. Int. J. Parasitol. 2012, 42, 63–70. [Google Scholar] [CrossRef] [PubMed]
  23. Somvanshi, V.S.; Phani, V.; Banakar, P.; Chatterjee, M.; Budhwar, R.; Shukla, R.N.; Rao, U. Transcriptomic Changes in the Pre-Parasitic Juveniles of Meloidogyne incognita Induced by Silencing of Effectors Mi-Msp-1 and Mi-Msp-20. 3 Biotech 2020, 10, 360. [Google Scholar] [CrossRef] [PubMed]
  24. Chaudhary, S.; Dutta, T.K.; Tyagi, N.; Shivakumara, T.N.; Papolu, P.K.; Chobhe, K.A.; Rao, U. Host-Induced Silencing of Mi-Msp-1 Confers Resistance to Root-Knot Nematode Meloidogyne incognita in Eggplant. Transgenic Res. 2019, 28, 327–340. [Google Scholar] [CrossRef]
  25. Gao, B.; Allen, R.; Maier, T.; Davis, E.L.; Baum, T.J.; Hussey, R.S. Molecular Characterisation and Expression of Two Venom Allergen-like Protein Genes in Heterodera glycines. Int. J. Parasitol. 2001, 31, 1617–1625. [Google Scholar] [CrossRef]
  26. Luo, S.; Liu, S.; Kong, L.; Peng, H.; Huang, W.; Jian, H.; Peng, D. Two Venom Allergen-like Proteins, Havap1 and Havap2, Are Involved in the Parasitism of Heterodera avenae. Mol. Plant Pathol. 2019, 20, 471–484. [Google Scholar] [CrossRef]
  27. Li, Y.-X.; Wang, Y.; Liu, Z.-Y.; Wang, X.; Lu, Q.; Jia, X.-Z.; Zhang, X.-Y. Functional Analysis of the Venom Allergen-like Protein Gene from Pine Wood Nematode Bursaphelenchus xylophilus Using a Baculovirus Expression System. Physiol. Mol. Plant Pathol. 2016, 93, 58–66. [Google Scholar] [CrossRef]
  28. Shinya, R.; Morisaka, H.; Kikuchi, T.; Takeuchi, Y.; Ueda, M.; Futai, K. Secretome Analysis of the Pine Wood Nematode Bursaphelenchus xylophilus Reveals the Tangled Roots of Parasitism and Its Potential for Molecular Mimicry. PLoS ONE 2013, 8, e67377. [Google Scholar] [CrossRef]
  29. Lin, S.; Jian, H.; Zhao, H.; Yang, D.; Liu, Q. Cloning and Characterization of a Venom Allergen-like Protein Gene Cluster from the Pinewood Nematode Bursaphelenchus xylophilus. Exp. Parasitol. 2011, 127, 440–447. [Google Scholar] [CrossRef]
  30. Wang, Y. Functional Analysis of Venom Allergen-like Protein Gene from the Pinewood Nematode Bursaphelenchus xylophilus Using Insect Cell Expression System. Ph.D. Thesis, Northeast Forestry University, Harbin, China, 2014. [Google Scholar]
  31. Niu, H.; Zhao, L.; Lu, M.; Zhang, S.; Sun, J. The Ratio and Concentration of Two Monoterpenes Mediate Fecundity of the Pinewood Nematode and Growth of Its Associated Fungi. PLoS ONE 2012, 7, e31716. [Google Scholar] [CrossRef]
  32. Yan, X.; Cheng, X.Y.; Wang, Y.S.; Luo, J.; Mao, Z.C.; Ferris, V.R.; Xie, B.Y. Comparative Transcriptomics of Two Pathogenic Pinewood Nematodes Yields Insights into Parasitic Adaptation to Life on Pine Hosts. Gene 2012, 505, 81–90. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, L.; Zhang, T.; Pan, Z.; Lin, L.; Dong, G.; Wang, M.; Li, R. The Alcohol Dehydrogenase with a Broad Range of Substrate Specificity Regulates Vitality and Reproduction of the Plant-Parasitic Nematode Bursaphelenchus xylophilus. Parasitology 2018, 146, 497–505. [Google Scholar] [CrossRef] [PubMed]
  34. Lu, F.; Guo, K.; Chen, A.; Chen, S.; Lin, H.; Zhou, X. Transcriptomic Profiling of Effects of Emamectin Benzoate on the Pine Wood Nematode Bursaphelenchus xylophilus. Pest Manag. Sci. 2020, 76, 747–757. [Google Scholar] [CrossRef] [PubMed]
  35. Feng, Y.; Wang, X.; Li, D.; Zhang, W.; Li, Y.; Zhang, X. Prokaryotic Expression, Polyclonal Antibody Preparation and Expression Pattern Analysis of Venom-Allergen Proteins from Bursaphelenchus xylophilus. J. Beijing For. Univ. 2021, 43, 38–50. [Google Scholar]
  36. Viglierchio, D.R.; Schmitt, R.V. On the Methodology of Nematode Extraction from Field Samples: Baermann Funnel Modifications. J. Nematol. 1983, 15, 7. [Google Scholar]
  37. Ben, A.L.; Han, Z.M.; Han, X.; Sun, P. A Study of the Acquisition of Sterilized Nematode and Growth of the Pine Wood Nematode. J. Nanjing For. Univ. (Nat. Sci. Ed.) 2008, 51, 99–102. [Google Scholar]
  38. Otoguro, K.; Liu, Z.X.; Fukuda, K.; Li, Y.; Iwai, Y.; Tanaka, H.; Omura, S. Screening for New Nematocidal Substances of Microbial Origin by a New Method Using the Pine Wood Nematode. J. Antibiot. 1988, 41, 573–575. [Google Scholar] [CrossRef]
  39. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The Meme Suite. Nucleic Acids Res. 2015, 43, 11. [Google Scholar] [CrossRef]
  40. Wen, T.Y.; Wu, X.Q.; Hu, L.J.; Qiu, Y.J.; Rui, L.; Zhang, Y.; Ding, X.L.; Ye, J.R. A Novel Pine Wood Nematode Effector, Bxscd1, Suppresses Plant Immunity and Interacts with an Ethylene-Forming Enzyme in Pine. Mol. Plant Pathol. 2021, 22, 1399–1412. [Google Scholar] [CrossRef]
  41. Kikuchi, T.; Li, H.; Karim, N.; Kennedy, M.W.; Jones, J.T. Identification of Putative Expansin-like Genes from the Pine Wood Nematode, Bursaphelenchus xylophilus, and Evolution of the Expansin Gene Family within the Nematoda. Nematology 2009, 11, 355–364. [Google Scholar]
  42. Lunt, D.H.; Kumar, S.; Koutsovoulos, G.; Blaxter, M.L. The Complex Hybrid Origins of the Root Knot Nematodes Revealed through Comparative Genomics. arXiv 2013, arXiv:1306.6163. [Google Scholar] [CrossRef]
  43. Abad, P.; Gouzy, J.M.; Aury, J.M.; Castagnone-Sereno, P.; Danchin, E.G.J.; Deleury, E.; Perfus-Barbeoch, L.; Anthouard, V.; Artiguenave, F.O.; Blok, V.C. Genome Sequence of the Metazoan Plant-Parasitic Nematode Meloidogyne incognita. Nat. Biotechnol. 2008, 26, 909. [Google Scholar] [CrossRef] [PubMed]
  44. Akker, E.V.D.; Laetsch, D.R.; Thorpe, P.; Lilley, C.J.; Jones, J.T. The Genome of the Yellow Potato Cyst Nematode, Globodera rostochiensis, Reveals Insights into the Basis of Parasitism and Virulence. Genome Biol. 2016, 17, 124. [Google Scholar]
  45. Kumar, M.; Gantasala, N.P.; Roychowdhury, T.; Thakur, P.K.; Banakar, P.; Shukla, R.N.; Jones, M.G.K.; Rao, U. De Novo Transcriptome Sequencing and Analysis of the Cereal Cyst Nematode, Heterodera avenae. PLoS ONE 2014, 9, e96311. [Google Scholar] [CrossRef] [PubMed]
  46. Li, Y.; Hu, L.-J.; Wu, X.-Q.; Ye, J.-R. A Bursaphelenchus xylophilus Effector, Bx-Far-1, Suppresses Plant Defense and Affects Nematode Infection of Pine Trees. Eur. J. Plant Pathol. 2020, 157, 637–650. [Google Scholar] [CrossRef]
  47. Wen, T.Y.; Wu, X.Q.; Ye, J.R.; Qiu, Y.J.; Rui, L.; Zhang, Y. A Bursaphelenchus xylophilus Pathogenic Protein Bx-Far-1, as Potential Control Target, Mediates the Jasmonic Acid Pathway in Pines. Pest Manag. Sci. 2022, 78, 1870–1880. [Google Scholar] [CrossRef]
  48. Modesto, I.; Mendes, A.; Carrasquinho, I.; Miguel, C.M. Molecular Defense Response of Pine Trees (Pinus spp.) to the Parasitic Nematode Bursaphelenchus xylophilus. Cells 2022, 11, 3208. [Google Scholar] [CrossRef]
  49. Qiu, Y.J.; Wu, X.Q.; Wen, T.Y.; Hu, L.J.; Rui, L.; Zhang, Y.; Ye, J.R. The Bursaphelenchus xylophilus Candidate Effector Bxlip-3 Targets the Class I Chitinases to Suppress Immunity in Pine. Mol. Plant Pathol. 2023, 24, 1033–1046. [Google Scholar] [CrossRef]
  50. Wen, T.Y.; Wu, X.Q.; Ye, J.R.; Qiu, Y.J.; Rui, L.; Zhang, Y. Two Novel Bursaphelenchus xylophilus Kunitz Effector Proteins Using Different Infection and Survival Strategies to Suppress Immunity in Pine. Phytopathology 2023, 113, 539–548. [Google Scholar] [CrossRef]
Figure 1. Phylogenetic tree and motif sequences of B. xylophilus BxVAP2 and CAP proteins from other species. (A) Phylogenetic tree; (B) motif sequence distribution.
Figure 1. Phylogenetic tree and motif sequences of B. xylophilus BxVAP2 and CAP proteins from other species. (A) Phylogenetic tree; (B) motif sequence distribution.
Forests 15 01929 g001
Figure 2. BxVAP2 gene expression pattern in Bursaphelechus xylophilus. (A) The changes in BxVAP2 gene expression levels of B. xylophilus during the infection of P. massoniana. (B) BxVAP2 gene expression levels of B. xylophilus treated with different concentrations of β-pinene (C) at 72 h. BxVAP2 gene expression levels of B. xylophilus treated with different concentrations of α-pinene at 72 h. CK-0 h represents the control group, which consists of untreated PWNs. CK-72 h refers to PWNs soaked in ddH2O containing 0.5% Triton X-100 for 72 h. Statistical significances were determined using one-way ANOVA. Different letters over error bars indicate statistically significant differences using least-significant difference comparison test (p < 0.05).
Figure 2. BxVAP2 gene expression pattern in Bursaphelechus xylophilus. (A) The changes in BxVAP2 gene expression levels of B. xylophilus during the infection of P. massoniana. (B) BxVAP2 gene expression levels of B. xylophilus treated with different concentrations of β-pinene (C) at 72 h. BxVAP2 gene expression levels of B. xylophilus treated with different concentrations of α-pinene at 72 h. CK-0 h represents the control group, which consists of untreated PWNs. CK-72 h refers to PWNs soaked in ddH2O containing 0.5% Triton X-100 for 72 h. Statistical significances were determined using one-way ANOVA. Different letters over error bars indicate statistically significant differences using least-significant difference comparison test (p < 0.05).
Forests 15 01929 g002
Figure 3. Subcellular localization of BxVAP2 in Nicotiana benthamiana. (A) Localization of the control vector pBIN121-GFP; (B) localization of BxVAP2-GFP.
Figure 3. Subcellular localization of BxVAP2 in Nicotiana benthamiana. (A) Localization of the control vector pBIN121-GFP; (B) localization of BxVAP2-GFP.
Forests 15 01929 g003
Figure 4. BxVAP2 triggered cell death in N. benthamiana. GFP: Potato virus X expression vector (PVX) with green fluorescent protein, as a negative control; BAX: PVX with Bcl2-associated X protein, as a positive control; BxVAP2: PVX with BxVAP2 fragment containing the signal peptide; BxVAP2nsp: PVX with BxVAP2 fragment without the signal peptide. (A) Phenotypic analysis of N. benthamiana after injection of Agrobacterium expression recombinant plasmid. (B) Western blot analysis of transiently expressed proteins in N.benthamiana leaves, with GFP, BAX, BxVAP2, and BxVAP2nsp fused with 3 × Flag. (C) Transcriptional regulation of pattern-triggered immunity marker genes in N. benthamiana triggered by BxVAP2 overexpression. Statistical significances were determined using one-way ANOVA. Different letters over error bars indicate statistically significant differences using least-significant difference comparison test (p < 0.05).
Figure 4. BxVAP2 triggered cell death in N. benthamiana. GFP: Potato virus X expression vector (PVX) with green fluorescent protein, as a negative control; BAX: PVX with Bcl2-associated X protein, as a positive control; BxVAP2: PVX with BxVAP2 fragment containing the signal peptide; BxVAP2nsp: PVX with BxVAP2 fragment without the signal peptide. (A) Phenotypic analysis of N. benthamiana after injection of Agrobacterium expression recombinant plasmid. (B) Western blot analysis of transiently expressed proteins in N.benthamiana leaves, with GFP, BAX, BxVAP2, and BxVAP2nsp fused with 3 × Flag. (C) Transcriptional regulation of pattern-triggered immunity marker genes in N. benthamiana triggered by BxVAP2 overexpression. Statistical significances were determined using one-way ANOVA. Different letters over error bars indicate statistically significant differences using least-significant difference comparison test (p < 0.05).
Forests 15 01929 g004
Table 1. Primer sequences for the construction of transient expression vectors and gene expression analysis in Nicotiana benthamiana.
Table 1. Primer sequences for the construction of transient expression vectors and gene expression analysis in Nicotiana benthamiana.
Primer FunctionPrimer NameSequence (5′—3′)
PVX linearization primersPVX-FTCAGCACCAGCTAGCATCGAT
PVX-RGTAGTCCATGGATCCCCCGGG
BxVAP2 with signal peptidePVX-VAP2-FTCAGCACCAGCTAGCATCGATATGGTTCGAGTATTAGTTCT
PVX-VAP2-RGTAGTCCATGGATCCCCCGGGTCAGGCACTGCACAAACTGT
BxVAP2 without signal peptidePVX-VAP1nsp-FTCAGCACCAGCTAGCATCGATACCAAATTCAGCGAAAGCCAA
PVX-VAP1nsp-RGTAGTCCATGGATCCCCCGGGTCAGGCGCTACACAGACTGT
BAXPVX-BAX-FTCAGCACCAGCTAGCATCGATATGGACGGGTCCGGGGAGA
PVX-BAX-RGTAGTCCATGGATCCCCCGGGTCAAGCGTAATCTGGAACAT
Validation primer for recombinant plasmidPVX-CX-FGTTGAACGGTTAAGTTTCCA
PVX-CX-RATCGTCATCGTCCTTGTAAT
NbAcre31NbAcre31-qFAATTCGGCCATGTGATCTTGGTC
NbAcre31-qRGAGAAACTGGGATTGCCTGAAGGA
NbGras2NbGras2-qFTACCTAGCACCAAGCAGATGCAGA
NbGras2-qRCGTTGCCATCTCTCATCTCA
NbPTI5NbPTI5-qFCCTCCAAGTTTGAGCTCGGATAGT
NbPTI5-qRCCAAGAAATTCTCCATGCACTCTGTC
NbCyp71D20NbCyp71D20-qFGTTGACGCCATTGTTGAG
NbCyp71D20-qRATCTTCGCCTCCTAATGC
Note: The underlined part is the homologous sequence of the target gene.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Feng, Y.; Li, Y.; Li, D.; Liu, Z.; Wang, X.; Zhang, W.; Wen, X.; Zhang, X. Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana. Forests 2024, 15, 1929. https://doi.org/10.3390/f15111929

AMA Style

Feng Y, Li Y, Li D, Liu Z, Wang X, Zhang W, Wen X, Zhang X. Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana. Forests. 2024; 15(11):1929. https://doi.org/10.3390/f15111929

Chicago/Turabian Style

Feng, Yuqian, Yongxia Li, Dongzhen Li, Zhenkai Liu, Xuan Wang, Wei Zhang, Xiaojian Wen, and Xingyao Zhang. 2024. "Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana" Forests 15, no. 11: 1929. https://doi.org/10.3390/f15111929

APA Style

Feng, Y., Li, Y., Li, D., Liu, Z., Wang, X., Zhang, W., Wen, X., & Zhang, X. (2024). Bursaphelenchus xylophilus Venom Allergen Protein BxVAP2 Responds to Terpene Stress, Triggers Plant Defense in Nicotiana benthamiana. Forests, 15(11), 1929. https://doi.org/10.3390/f15111929

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop