Analysis of the Conservation Status, Genetic Diversity and Population Structure of Endangered Ostrya rehderiana Resources Using SSR Markers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Information
2.2. DNA Extraction and Genotyping with SSR Markers
2.3. Data Analysis
3. Results
3.1. Genetic Diversity
3.2. Genetic Variation and Genetic Structure
3.3. Unique Alleles
4. Discussion
4.1. Genetic Diversity
4.2. Genetic Variation
4.3. Conservation of O. rehderiana
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cardinale, B.J.; Duffy, J.E.; Gonzalez, A.; Hooper, D.U.; Perrings, C.; Venail, P.; Narwani, A.; Mace, G.M.; Tilman, D.; Wardle, D.A.; et al. Biodiversitylossanditsimpactonhumanity. Nature 2012, 486, 59. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Exposito-Alonso, M.; Booker, T.R.; Czech, L.; Gillespie, L.; Hateley, S.; Kyriazis, C.C.; Lang, P.L.M.; Leventhal, L.; Nogues-Bravo, D.; Pagowski, V.; et al. Genetic diversity loss in the Anthropocene. Science 2022, 377, 1431–1435. [Google Scholar] [CrossRef] [PubMed]
- Krishna, U.; Kanta, B.S.; Dibyendu, A.; Ratul, B.; John, L.N. Regeneration ecology and population status of a critically endangered and endemic tree species (Ilex khasiana Purk.) in north-eastern India. J. Forestry Res. 2009, 20, 223–228. [Google Scholar] [CrossRef]
- Pimm, S.L.; Jenkins, C.N.; Abell, R.; Brooks, T.M.; Gittleman, J.L.; Joppa, L.N.; Raven, P.H.; Roberts, C.M.; Sexton, J.O. The biodiversity of species and their rates of extinction, distribution, and protection. Science 2014, 344, 1246752. [Google Scholar] [CrossRef] [PubMed]
- Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; Da Fonseca, G.A.; Kent, J. Biodiversity hotspots for conservation priorities. Nature 2000, 403, 853–858. [Google Scholar] [CrossRef]
- Xu, Y.; Zang, R. Conservation of rare and endangered plant species in China. iScience 2023, 26, 106008. [Google Scholar] [CrossRef]
- Yang, Y.Z.; Ma, T.; Wang, Z.F.; Lu, Z.Q.; Li, Y.; Fu, C.X.; Chen, X.Y.; Zhao, M.S.; Olson, M.S.; Liu, J.Q. Genomic effects of population collapse in a critically endangered ironwood tree Ostrya rehderiana. Nat. Commun. 2018, 9, 5449. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.Y.; Guan, S.M.; Yang, S.Z.; Luo, Y.; Chen, X.Y. Genetic decline and inbreeding depression in an extremely rare tree. Conserv. Genet. 2012, 13, 343–347. [Google Scholar] [CrossRef]
- Luo, Y.; Wu, S.B.; Ku, W.P.; Yang, S.Z.; Wu, J.S. Biocoenosis structure and species diversity of rare and endangered plant Ostrya rehderiana. J. Zhejiang Agr. Sci. 2018, 59, 2061–2064. [Google Scholar] [CrossRef]
- Fu, D. Reproductive biology research of rare and endangered plant Ostrya rehderiana Chun. Master Thesis, Hangzhou Normal University, Hangzhou, China, 2019. [Google Scholar]
- Lu, Z.Q.; Zhang, D.; Liu, S.Y.; Yang, X.Y.; Liu, X.; Liu, J.Q. Species delimitation of Chinese hop-hornbeams based on molecular and morphological evidence. Ecol. Evol. 2016, 6, 4731–4740. [Google Scholar] [CrossRef] [Green Version]
- Li, N.; Yang, Y.M.; Xu, F.; Chen, X.Y.; Wei, R.Y.; Li, Z.Y.; Pan, W.; Zhang, W.H. Genetic diversity and population structure analysis of Castanopsis hystrix and construction of a core collection using phenotypic traits and molecular markers. Genes 2022, 13, 2383. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; An, W.N.; Peng, J.; Li, J.W.; Gu, Y.J.; Jiang, B.; Chen, L.H.; Zhu, P.; Yang, H.B. Genetic Diversity of Nanmu (Phoebe zhennan S. Lee. et F. N. Wei) Breeding Population and Extraction of Core Collection Using nSSR, cpSSR and Phenotypic Markers. Forests 2022, 13, 1320. [Google Scholar] [CrossRef]
- Zhao, Z.N.; Zhang, H.W.; Wang, P.X.; Yang, Y.; Sun, H.Y.; Li, J.Y.; Chen, X.; Li, J.; Ji, N.Z.; Feng, H.; et al. Development of SSR molecular markers and genetic diversity analysis of Clematis acerifolia from Taihang Mountains. PLoS ONE 2023, 18, e0285754. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.L.; Ding, L.X.; Zhao, M.S.; Cheng, X.Y.; Shen, Q. Genetic diversity of Ostrya rehderiana revealed by RPAD markers. J. Zhejiang For. Coll. 2008, 25, 304–308. [Google Scholar]
- Zhou, Q.; Mu, K.; Ni, Z.; Liu, X.; Li, Y.; Xu, L.A. Analysis of genetic diversity of ancient Ginkgo populations using SSR markers. Ind. Crops Prod. 2020, 145, 111942. [Google Scholar] [CrossRef]
- Nin, S.; Antonetti, M.; Burchi, G.; Gori, M.; Bini, L. Validation by SSRs of Morphometric Markers for Genetic Variability in Araucaria araucana (Molina) K. Koch. Forests 2023, 14, 466. [Google Scholar] [CrossRef]
- Cota-Sánchez, J.H.; Remarchuk, K.; Ubayasena, K. Ready-to-use DNA extracted with a CTAB method adapted for herbarium specimens and mucilaginous plant tissue. Plant Mol. Biol. Rep. 2006, 24, 161–167. [Google Scholar] [CrossRef]
- Zhou, Q.; Zhou, P.Y.; Zou, W.T.; Li, Y.G. EST-SSR marker development based on transcriptome sequencing and genetic analyses of Phoebe bournei (Lauraceae). Mol. Biol. Rep. 2021, 48, 2201–2208. [Google Scholar] [CrossRef]
- Palero, F.; González-Candelas, F.; Pascual, M. MICROSATELIGHT--pipeline to expedite microsatellite analysis. J. Hered. 2011, 102, 247–249. [Google Scholar] [CrossRef]
- Yeh, F.C.; Yang, R.C.; Boyle, T.B.J.; Ye, Z.H.; Mao, J.X. POPGENE, the User-Friendly Shareware for Population Genetic Analysis; Molecular Biology and Biotechnology Centre, University of Alberta: Edmonton, AB, Canada, 1997. [Google Scholar]
- Liu, K.J.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [Green Version]
- Goudet, J. FSTAT (version 1.2): A computer program to calculate F-statistics. J. Hered. 1995, 86, 485–486. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. Genalex 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Piry, S.; Luikart, G.; Cornuet, J.M. BOTTLENECK: A computer program for detecting recent reductions in the effective population size using allele frequency data. J. Hered. 1999, 90, 502–503. [Google Scholar] [CrossRef]
- Shi, X.M.; Wen, Q.; Cao, M.; Guo, X.; Xu, L.A. Genetic diversity and structure of natural Quercus variabilis population in China as revealed by microsatellites markers. Forests 2017, 8, 495. [Google Scholar] [CrossRef] [Green Version]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Green Version]
- Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Jakobsson, M.; Rosenberg, N.A. CLUMPP: A cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 2007, 23, 1801–1806. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosenberg, N.A. Distruct: A program for the graphical display of population structure. Mol. Ecol. Notes 2004, 4, 137–138. [Google Scholar] [CrossRef]
- Allendorf, F.W.; Hohenlohe, P.A.; Luikart, G. Genomics and the future of conservation genetics. Nat. Rev. Genet. 2010, 11, 697–709. [Google Scholar] [CrossRef]
- Wu, L.X.; Xu, H.Y.; Jian, S.G.; Gong, X.; Feng, X.Y. Geographic factors and climatic fluctuation drive the genetic structure and demographic history of Cycas taiwaniana (Cycadaceae), an endemic endangered species to Hannan Island in China. Ecol. Evol. 2022, 12, e9508. [Google Scholar] [CrossRef]
- Mantiquilla, J.A.; Lu, H.Y.; Shih, H.C.; Ju, L.P.; Shiao, M.S.; Chiang, Y.C. Structured populations of critically endangered yellow water lily (Nuphar shimadai Hayate, Nymphaeaceae). Plants 2022, 11, 2433. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, A.; García-Martínez, S.; Carhonell, P.; Ruiz, J.J.; Loumerem, M. Genetic diversity assessment of Spanish and some endangered Tunisian pea (Pisum sativum L.) accessions based on microsatellite markers (SSRs). Chem. Biodivers. 2022, 20, e202201033. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.Z.; Wen, G.W.; Zhang, M.Z.; Liu, Y.P.; Fan, H.H.; Zhang, G.F.; Chen, S.P.; Liu, B. Genetic diversity and genetic structure of a rare and endangered plant in Semiliquidambar cathayensis Hung T. Chang. Plant Sci. J. 2021, 39, 415–423. [Google Scholar]
- Zhou, H.J. Genetic diversity and population structure of natural endangered forest tree Pinus bungeana in China. Master Thesis, Northwest University, Xi’an, China, 2013. [Google Scholar]
- Maruyama, T.; Fuerst, P.A. Population bottlenecks and nonequilibrium models in population genetics. II. Number of alleles in a small population that was formed by a recent bottleneck. Genetics 1985, 111, 675–689. [Google Scholar] [CrossRef] [PubMed]
- Mularo, A.J.; Bernal, X.E.; DeWoody, J.A. Dominance can increase genetic variance after a population bottleneck: A synthesis of the theoretical and empirical evidence. J. Hered. 2022, 113, 257–271. [Google Scholar] [CrossRef]
- Tang, S.L.; Song, Y.B.; Zeng, B.; Dong, M. Potential distribution of the extremely endangered species Ostrya rehderiana (Betulaceae) in China under future climate change. Environ. Sci. Pollut. R. 2022, 29, 7782–7792. [Google Scholar] [CrossRef]
- Gijbels, P.; De Hert, K.; Jacquemyn, H.; Honnay, O. Reduced fecundity and genetic diversity in small populations of rewarding versus deceptive orchid species: A meta-analysis. Plant Ecol. Evol. 2015, 148, 153–159. [Google Scholar] [CrossRef]
- Vu, D.D.; Nguyen, M.T.; Nguyen, M.D.; Nguyen, P.L.H.; Bui, T.T.X.; Phan, K.L.; Vu, D.G.; Pham, Q.T.; Nguyen, T.P.T. Genetic population structure of the Vietnamese ginseng (Panax vietnamensis Ha et Grushv.) detected by microsatellite analysis. Braz. J. Biol. 2022, 84, e264369. [Google Scholar] [CrossRef]
- Otto, M.; Zheng, Y.; Wiehe, T. Recombination, selection, and the evolution of tandem gene arrays. Genetics 2022, 221, iyac052. [Google Scholar] [CrossRef]
- D’Aguillo, M.; Donohue, K. Changes in phenology can alter patterns of natural selection: The joint evolution of germination time and post-germination traits. New Phytol. 2023, 238, 405–421. [Google Scholar] [CrossRef]
- Wang, S.P.; Altermatt, F. Metapopulations revisited: The area- dependence of dispersal matters. Ecology 2019, 100, e02792. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Angst, P.; Ameline, C.; Haag, C.R.; Ben-Ami, F.; Ebert, D.; Fields, P.D. Genetic drift shapes the evolution of a highly dynamic metapopulation. Mol. Biol. Evol. 2022, 39, msac264. [Google Scholar] [CrossRef] [PubMed]
- Saastamoinen, M.; Bocedi, G.; Cote, J.; Legrand, D.; Guillaume, F.; Wheat, C.W.; Fronhofer, E.A.; Garcia, C.; Henry, R.; Husby, A.; et al. Genetics of dispersal. Biol. Rev. 2018, 93, 574–599. [Google Scholar] [CrossRef] [Green Version]
- Pannell, J.R.; Charlesworth, B. Effects of metapopulation processes on measures of genetic diversity. Phil. Trans. R. Soc. Lond. B Biol. Sci. 2000, 355, 1851–1864. [Google Scholar] [CrossRef] [PubMed]
- Lye, Z.; Choi, J.Y.; Purugganan, M.D. Deleterious mutations and the rare allele burden on rice gene expression. Mol. Biol. Evol. 2022, 39, msac193. [Google Scholar] [CrossRef]
- Ellstrand, N.C. Is gene flow the most important evolutionary force in plants. Am. J. Bot. 2014, 101, 737–753. [Google Scholar] [CrossRef] [PubMed]
Population Code | Location | Longitude (° E) | Latitude (° N) | Altitude (m) | Number | Origin |
---|---|---|---|---|---|---|
TM1 | Mt. Tianmu, Zhejiang | 119.4 | 30.4 | 310 | 25 | Plantation |
TM2 | Mt. Tianmu, Zhejiang | 119.4 | 30.3 | 430 | 37 | Plantation |
WC | Mt. Wuchao, Zhejiang | 120.0 | 30.1 | 220 | 31 | Plantation |
QY | Qingyuan, Zhejiang | 119.0 | 27.5 | 640 | 13 | Plantation |
AF | Academy of forestry, Zhejiang | 120.0 | 30.2 | 20 | 5 | Plantation |
WP | Mt. Tianmu, Zhejiang | 119.8 | 30.2 | 251 | 5 | Nature |
Total | 116 |
Locus Code | Repeat Motif | Primer Sequence (5′~3′) | TM (°C) |
---|---|---|---|
SSR01 | (GGA) 6 | GCAATAGCAACAGCAACAGC | 60 °C |
TGTCGCTCGTGTACTTCACC | |||
SSR02 | (G) 16 | CGCCCCCAAACTACTATCCT | 60 °C |
TGACCATGCATCCATTTGAC | |||
SSR03 | (TAA) 6 | CGAACAAGTCCCTCAAGCAT | 60 °C |
AATTTTGCAACTCCCACAGC | |||
SSR04 | (AC) 7 | CAAACACGAAAGCCAACAGA | 60 °C |
GGCAACCAAACAAAGCCTAA | |||
SSR05 | (CTT) 7 | TCCATTTTGAAGCAAATCCC | 60 °C |
GTGTATCAGGGGGAGGAGGT | |||
SSR06 | (GTC) 8 | TCGTCAAATCCTCGTTTTCC | 60 °C |
CTGACCATCGCGTTTACCTT | |||
SSR07 | (ACC) 7 | ATCGTCTTGCATGAGCCTCT | 60 °C |
ACAGGTCATTGGTGGAGGAG | |||
SSR08 | (TAG) 5 | GCTAGAGGGGAGGAGGAGAA | 60 °C |
ATGGTTGGCTCCATGACTTC | |||
SSR09 | (ACT) 6 | ACAACAATGGTGGTTGGGAT | 60 °C |
TAAGCTTGGTCCACTTGCCT | |||
SSR10 | (AAT) 11 | GATTGAGTTGGCTGGGATGT | 60 °C |
CAACCGCTTCAACACATTCA | |||
SSR11 | (G) 15 | GATGTGCGGTAGTAGGCGAT | 60 °C |
GTCGGTGGTCGTTTCAGTCT | |||
SSR12 | (GTT) 7 | AGGATCCAAATGACTCCGTG | 60 °C |
GAAGAGGAAGCGCAAGAGAA |
Locus | Na | Ne | He | PIC | Fst | HWE |
---|---|---|---|---|---|---|
SSR01 | 14 | 10.18 | 0.91 | 0.89 | 0.26 | ** |
SSR02 | 13 | 7.88 | 0.88 | 0.86 | 0.14 | ** |
SSR03 | 12 | 5.58 | 0.82 | 0.80 | 0.18 | ** |
SSR04 | 12 | 7.64 | 0.87 | 0.86 | 0.17 | ** |
SSR05 | 15 | 6.98 | 0.86 | 0.84 | 0.11 | ** |
SSR06 | 15 | 9.00 | 0.89 | 0.88 | 0.12 | ** |
SSR07 | 16 | 10.50 | 0.91 | 0.90 | 0.06 | ** |
SSR08 | 16 | 10.09 | 0.90 | 0.89 | 0.09 | ** |
SSR09 | 19 | 9.85 | 0.90 | 0.89 | 0.23 | ** |
SSR10 | 15 | 11.02 | 0.91 | 0.90 | 0.10 | ** |
SSR11 | 12 | 8.77 | 0.89 | 0.88 | 0.14 | ** |
SSR12 | 8 | 4.23 | 0.77 | 0.73 | 0.40 | ** |
Mean | 13.92 | 8.48 | 0.88 | 0.86 | 0.17 |
Population Code | Na | Ne | AR | He | Population Level | Species Level | ||
---|---|---|---|---|---|---|---|---|
TPM | SMM | TPM | SMM | |||||
TM1 | 7.75 | 5.21 | 5.11 | 0.81 | 0.002 * | ns | 0.003 * | ns |
TM2 | 8.75 | 5.59 | 5.18 | 0.81 | ns | ns | ||
WC | 8.42 | 5.36 | 4.99 | 0.76 | ns | ns | ||
QY | 7.92 | 5.87 | 5.64 | 0.84 | 0.031 * | ns | ||
AF | 4.00 | 3.31 | 4.00 | 0.70 | ns | ns | ||
WP | 3.83 | 3.19 | 3.83 | 0.72 | 0.007 * | 0.046 * |
Source of Variance | Variance Component | Percentage of Total | p Value |
---|---|---|---|
Among populations | 0.57 | 11% | <0.01 |
Among individuals | 3.28 | 61% | <0.01 |
Within individuals | 1.56 | 29% | <0.01 |
Total | 5.41 | 100% |
Allele | TM1 | TM2 | WC | QY | AF | WP |
---|---|---|---|---|---|---|
SRR01-B | - | - | 0.03 | - | - | - |
SRR01-C | - | 0.05 | - | - | - | - |
SRR01-N | - | - | - | 0.15 | - | - |
SRR02-A | - | - | - | 0.08 | - | - |
SRR02-J | - | - | 0.06 | - | - | - |
SSR03-A | - | - | - | - | - | 0.40 |
SSR03-H | - | - | - | 0.15 | - | - |
SSR03-I | - | - | - | - | - | 0.30 |
SSR04-L | - | - | - | 0.15 | - | - |
SSR05-A | 0.04 | - | - | - | - | - |
SSR05-B | - | 0.03 | - | - | - | - |
SSR05-O | - | - | - | 0.04 | - | - |
SSR06-A | - | - | - | 0.15 | - | - |
SSR06-C | - | - | - | 0.12 | - | - |
SSR06-O | 0.04 | - | - | - | - | - |
SSR07-H | - | - | 0.10 | - | - | - |
SSR07-P | - | - | 0.10 | - | - | - |
SSR08-C | - | - | 0.06 | - | - | - |
SSR08-D | - | - | 0.13 | - | - | - |
SSR09-A | - | - | - | - | - | 0.40 |
SSR09-E | - | - | - | 0.15 | - | - |
SSR09-O | - | - | - | 0.15 | - | - |
SSR09-Q | 0.08 | - | - | - | - | - |
SSR09-R | 0.08 | - | - | - | - | - |
SSR09-S | 0.08 | - | - | - | - | - |
SSR10-O | - | - | - | - | - | 0.10 |
SSR11-K | 0.08 | - | - | - | - | - |
SSR11-L | - | - | - | - | 0.20 | - |
SSR12-G | - | - | - | 0.19 | - | - |
SSR12-H | - | - | - | 0.04 | - | - |
Number | 6 | 2 | 6 | 11 | 1 | 4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Q.; Wang, G.; Li, Y. Analysis of the Conservation Status, Genetic Diversity and Population Structure of Endangered Ostrya rehderiana Resources Using SSR Markers. Forests 2023, 14, 1519. https://doi.org/10.3390/f14081519
Zhou Q, Wang G, Li Y. Analysis of the Conservation Status, Genetic Diversity and Population Structure of Endangered Ostrya rehderiana Resources Using SSR Markers. Forests. 2023; 14(8):1519. https://doi.org/10.3390/f14081519
Chicago/Turabian StyleZhou, Qi, Guangjiong Wang, and Yingang Li. 2023. "Analysis of the Conservation Status, Genetic Diversity and Population Structure of Endangered Ostrya rehderiana Resources Using SSR Markers" Forests 14, no. 8: 1519. https://doi.org/10.3390/f14081519
APA StyleZhou, Q., Wang, G., & Li, Y. (2023). Analysis of the Conservation Status, Genetic Diversity and Population Structure of Endangered Ostrya rehderiana Resources Using SSR Markers. Forests, 14(8), 1519. https://doi.org/10.3390/f14081519