RNA Interference-Mediated Knockdown of Tryptophan 2,3-Dioxygenase and Kynurenine-3-Monooxygenase in Monochamus Alternatus: Implications for Insect Control
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Husbandry
2.2. Synthesis of cDNA
2.3. Synthesis and Purification of dsRNA
2.4. Injection
2.5. Expression Analysis of RT-qPCR
3. Results
3.1. Phylogenetic Tree and Sequence Analysis of MaKMO and MaTDO Genes
3.2. Expressions of MaKMO and MaTDO at Different Stages
3.3. The Effect of RNA Interference of MaKMO and MaTDO on Eye Color
3.4. RT-qPCR after MaKMO and MaTDO RNA Interference
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ye, J.R. Analysis on epidemic status, control techniques and countermeasures of pine wilt disease in China. For. Sci. 2019, 55, 1–10. [Google Scholar]
- Tiao, N.Y.; Yu, L.F.; Jian, T.; Sun, J.H. Advances in research on Bursaphelenchus xylophilus and its key vector Monochamus spp. Entomol. Knowl. 2004, 41, 97–104. [Google Scholar]
- Kim, D.S.; Lee, S.M.; Chung, Y.J.; Chung, Y.J.; Moon, Y.S.; Park, C.G. Emergence Ecology of Japanese Pine Sawyer, Monchamus alternatus(Coleptera: Cerambycidae), a Vector of Pinewood Nematode, Bursaphelenchus xylophilus. Korean J. Appl. Entomol. 2003, 42, 307–313. [Google Scholar]
- Zhang, X.Y.; Luo, Y.Q. Major Forest Diseases and Insect Pests in China, 1st ed.; Chinese Forestry Publisher: Beijing, China, 2003; p. 386. [Google Scholar]
- Fielding, N.J.; Evans, H.F. The pine wood nematode Bursaphelenchus xylophilus (Steiner and Buhrer) Nickle (= B. lignicolus Mamiya and Kiyohara): An assessment of the current position. For. Int. J. For. Res. 1996, 69, 35–46. [Google Scholar] [CrossRef] [Scilit]
- Lee, K.S. Stability Analysis and Optimal Control Strategy for Prevention of Pine Wilt Disease. Abstr. Appl. Anal. 2014, 2014, 182680. [Google Scholar] [CrossRef] [Scilit]
- Zhao, B.G.; Futai, K.; Sutherland, J.R.; Takeuchi, Y. Pine Wilt Disease, 1st ed.; Springer: Tokyo, Japan, 2008; p. 459. [Google Scholar]
- Kim, Y.G.; Cha, J.; Chandrasegaran, S. Hybrid restriction enzymes: Zinc finger fusions to Fok I cleavage domain. Proc. Natl. Acad. Sci. USA 1996, 93, 1156–1160. [Google Scholar] [CrossRef] [Scilit]
- Trivedi, D. Using CRISPR-Cas9-based genome engineering tools in Drosophila melanogaster. Prog. Mol. Biol. Transl. Sci. 2021, 180, 85–121. [Google Scholar]
- Zulhussnain, M.; Zahoor, M.K.; Ranian, K.; Ahmad, A.; Jabeen, F. CRISPR Cas9 mediated knockout of sex determination pathway genes in Aedes aegypti. Bull. Entomol. Res. 2023, 113, 243–252. [Google Scholar] [CrossRef] [Scilit]
- Cheng, F.P.; Hu, X.F.; Pan, L.X.; Gong, Z.X.; Qin, K.X.; Li, Z.; Wang, Z.L. Transcriptome changes of Apis mellifera female embryos with fem gene knockout by CRISPR/Cas9. Int. J. Biol. Macromol. 2023, 229, 260–267. [Google Scholar] [CrossRef] [Scilit]
- Heu, C.C.; McCullough, F.M.; Luan, J.; Rasgon, J.L. CRISPR-Cas9-Based Genome Editing in the Silverleaf Whitefly (Bemisia tabaci). CRISPR J. 2020, 3, 89–96. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Tan, Y.; Jiang, Y.; Zhu-Salzman, K.; Xiao, L. CRISPR/Cas9-mediated methoprene-tolerant 1 knockout results in precocious metamorphosis of beet armyworm (Spodoptera exigua) only at the late larval stage. Insect Mol. Biol. 2023, 32, 132–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, H.; Chen, F.; Zhou, M.; Lan, W.; Zhang, W.; Shen, G.; Lin, P.; Xia, Q.; Zhao, P.; Li, Z. CRISPR-Cas9-Mediated Mutation of Methyltransferase METTL4 Results in Embryonic Defects in Silkworm Bombyx mori. Int. J. Mol. Sci. 2023, 24, 3468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Wang, H.; Liu, S.; Liu, L.; Tay, W.T.; Walsh, T.K.; Yang, Y.; Wu, Y. CRISPR/Cas9 mediated genome editing of Helicoverpa armigera with mutations of an ABC transporter gene HaABCA2 confers resistance to Bacillus thuringiensis Cry2A toxins. Insect Biochem. Mol. Biol. 2017, 87, 147–153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bai, Y.; He, Y.; Shen, C.Z.; Li, K.; Li, D.L.; He, Z.Q. CRISPR/Cas9-Mediated genomic knock out of tyrosine hydroxylase and yellow genes in cricket Gryllus bimaculatus. PLoS ONE 2023, 18, e0284124. [Google Scholar] [CrossRef] [Scilit]
- Cornel, A.J.; Benedict, M.Q.; Rafferty, C.S.; Howells, A.J.; Collins, F.H. Transient expression of the Drosophila melanogaster cinnabar gene rescues eye color in the white eye (WE) strain of Aedes aegypti. Insect Biochem. Mol. Biol. 1997, 27, 993–997. [Google Scholar] [CrossRef] [Scilit]
- Tao, H.J.; Lin, L.; Su, Y.; Huang, D.N. The types and functions of genetic markers and the research status of rice genetic markers. China Rice 2011, 17, 21–24. [Google Scholar]
- Du, X.Y.; Huo, X.Y.; Chen, Z.W. Research progress and application of laboratory animal genetic quality monitoring technology. Lab. Anim. Sci. 2021, 38, 1–5. [Google Scholar]
- Quan, G.X.; Kim, I.; Kômoto, N.; Sezutsu, H.; Ote, M.; Shimada, T.; Kanda, T.; Mita, K.; Kobayashi, M.; Tamura, T. Characterization of the kynurenine 3-monooxygenase gene corresponding to the white egg 1 mutant in the silkworm Bombyx mori. Mol. Genet. Genom. MGG 2002, 267, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Khanh, H.D.T.; Bressac, C.; Chevrier, C. Male sperm donation consequences in single and double matings in Anisopteromalus calandrae. Physiol. Entomol. 2005, 30, 29–35. [Google Scholar] [CrossRef] [Scilit]
- Quan, G.X.; Kobayashi, I.; Kojima, K.; Uchino, K.; Kanda, T.; Sezutsu, H.; Shimada, T.; Tamura, T. Rescue of white egg 1 mutant by introduction of the wild-type Bombyx kynurenine 3–monooxygenase gene. Insect Sci. 2007, 14, 85–92. [Google Scholar] [CrossRef] [Scilit]
- Sherry, A.; Marcé, L.; Brenda, O. Metabolic pathway interruption: CRISPR/Cas9-mediated knockout of tryptophan 2,3-dioxygenase in Tribolium castaneum. J. Insect Physiol. 2018, 107, 104–109. [Google Scholar]
- Perera, O.P.; Little, N.S.; Pierce, C.A. CRISPR/Cas9 mediated high efficiency knockout of the eye color gene Vermillion in Helicoverpa zea (Boddie). PLoS ONE 2018, 13, e0197567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, S.H.; Luo, J.; Yang, B.J.; Wang, A.Y.; Tang, J. Karmoisin and cardinal ortholog genes participate in the ommochrome synthesis of Nilaparvata lugens (Hemiptera: Delphacidae). Insect Sci. 2017, 26, 35–43. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.C.; Chang, Y.Y.; Chan, C.C. Strategies for gene disruption in Drosophila. Cell. Biosci. 2014, 4, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsubota, T.; Sakai, H.; Sezutsu, H. Genome Editing of Silkworms. Methods Mol. Biol. 2023, 2637, 359–374. [Google Scholar] [PubMed]
- McMeniman, C.J.; Corfas, R.A.; Matthews, B.J.; Ritchie, S.A.; Vosshall, L.B. Multimodal Integration of Carbon Dioxide and Other Sensory Cues Drives Mosquito Attraction to Humans. Cell. 2014, 156, 1060–1071. [Google Scholar] [CrossRef] [Scilit]
- Merlin, C.; Beaver, L.E.; Taylor, O.R.; Wolfe, S.A.; Reppert, S.M. Efficient targeted mutagenesis in the monarch butterfly using zinc-finger nucleases. Genome Res. 2013, 23, 159–168. [Google Scholar] [CrossRef] [Scilit]
- Ikeda, K.; Daimon, T.; Shiomi, K.; Udaka, H.; Numata, H. Involvement of the Clock Gene Period in the Photoperiodism of the Silkmoth Bombyx mori. Zool. Sci. 2021, 38, 523–530. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Fujii, T.; Ishikawa, Y.; Matsuo, T. Targeted mutagenesis of an odorant receptor co-receptor using TALEN in Ostrinia furnacalis. Insect Biochem. Mol. Biol. 2016, 70, 53–59. [Google Scholar] [CrossRef] [Scilit]
- Guo, X.; Yu, Q.; Chen, D.; Wei, J.; Yang, P.; Yu, J.; Wang, X.; Kang, L. 4-Vinylanisole is an aggregation pheromone in locusts. Nature 2020, 584, 584–588. [Google Scholar] [CrossRef] [Scilit]
- Shirai, Y.; Piulachs, M.-D.; Belles, X.; Daimon, T. DIPA-CRISPR is a simple and accessible method for insect gene editing. Cell Rep. Methods 2022, 2, 100215. [Google Scholar] [CrossRef] [Scilit]
- Capece, L.; Arrar, M.; Roitberg, A.E.; Yeh, S.R.; Marti, M.A.; Estrin, D.A. Substrate stereo-specificity in tryptophan dioxygenase and indoleamine 2,3-dioxygenase. Proteins 2010, 78, 2961–2972. [Google Scholar] [CrossRef] [Scilit]
- Abdulla, A.B. Kynurenine Pathway of Tryptophan Metabolism: Regulatory and Functional Aspects. Int. J. Tryptophan Res. 2017, 10, 1178646917691938. [Google Scholar]
- Zhuravlev, A.V.; Vetrovoy, O.V.; Ivanova, P.N.; Savvateeva-Popova, E.V. 3-Hydroxykynurenine in Regulation of Drosophila Behavior: The Novel Mechanisms for Cardinal Phenotype Manifestations. Front. Physiol. 2020, 11, 971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baum, J.A.; Roberts, J.K. Chapter Five-Progress towards RNAi-Mediated Insect Pest Management. In Advances in Insect Physiology; Dhadialla, T.S., Gill, S.S., Eds.; Academic Press: Cambridge, MA, USA, 2014; Volume 47, pp. 249–295. [Google Scholar]
- Oppert, B.; Chu, F.C.; Reyna, S.; Pinzi, S.; Adrianos, S.; Perkin, L.; Lorenzen, M. Effects of targeting eye color in Tenebrio molitor through RNA interference of tryptophan 2,3-dioxygenase (vermilion): Implications for insect farming. Arch. Insect Biochem. Physiol. 2019, 101, e21546. [Google Scholar] [CrossRef] [Scilit]
- Kennerdell, J.R.; Carthew, R.W. Heritable gene silencing in Drosophila using double-stranded RNA. Nat. Biotechnol. 2000, 18, 896–898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Attardo, G.M.; Higgs, S.; Klingler, K.A.; Vanlandingham, D.L.; Raikhel, A.S. RNA interference-mediated knockdown of a GATA factor reveals a link to anautogeny in the mosquito Aedes aegypti. Proc. Natl. Acad. Sci. USA 2003, 100, 896–898. [Google Scholar] [CrossRef] [Scilit]
- Belles, X. The endocrine regulation of insect metamorphosis and the emerging role of microRNAs. Front. Endocrinol. 2010, 1. [Google Scholar] [CrossRef] [Scilit]
- Brent, C.S.; Spurgeon, D.W. Egg Production and Longevity of Lygus hesperus (Hemiptera: Miridae) Adult Females Under Constant and Variable Temperatures. J. Entomol. Sci. 2019, 54, 69–80. [Google Scholar] [CrossRef] [Scilit]
- Zhu, K.Y.; Palli, S.R. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu. Rev. Entomol. 2020, 65, 293–311. [Google Scholar] [CrossRef] [Scilit]
- Niu, B.L.; Shen, W.F.; Liu, Y.; Weng, H.B.; He, L.H.; Mu, J.J.; Wu, Z.L.; Jiang, P.; Tao, Y.Z.; Meng, Z.Q. Cloning and RNAi-mediated functional characterization of MaLac2 of the pine sawyer, Monochamus alternatus. Insect Mol. Biol. 2008, 17, 303–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weng, H.; Shen, W.; Liu, Y.; He, L.; Niu, B.; Meng, Z.; Mu, J. Cloning and characterization of two EcR isoforms from Japanese pine sawyer, Monochamus alternates. Arch. Insect Biochem. Physiol. 2013, 84, 27–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheng, L.J.; Weng, X.Q.; Weng, M.Q.; Guo, Y.J.; Carballar-Lejarazú, R.; Zhang, F.P.; Wu, S.Q. Function of Tryptophan 2,3-Dioxygenase in Monochamus alternatus Hope Revealed by RNA Interference. Forests 2023, 14, 215. [Google Scholar] [CrossRef] [Scilit]





| Primer Names | Sequences 5′–3′ | Application |
|---|---|---|
| MaKMO-F | TAATACGACTCACTATAGGGAGAAAGTAGCGGCTGGAAGATCG | dsRNA synthesis primer |
| MaKMO-R | TAATACGACTCACTATAGGGAGATGCGCCATCAGCTCCAATTA | |
| MaTDO-F | TAATACGACTCACTATAGGGAGATGGGGGAAATACCAACGAGC | |
| MaTDO-R | TAATACGACTCACTATAGGGAGACTTCTCATGGCGGAGGTGAG |
| Primer Names | Sequences 5′–3′ | Application |
|---|---|---|
| Actin-F | AGCCGGTTTCGCCGGTGATGAC | RT-qPCR primer |
| Actin-R | CACTTCATGATGGAGTTGTAGAC | |
| MaKMO-qPCR-F | TAAATGCGCCATCAGCTCCA | |
| MaKMO-qPCR-R | GAGACCCTCGACGATCAAGC | |
| MaTDO-qPCR-F | AGAACAAACTTGGCGTCCGA | |
| MaTDO-qPCR-R | TTGCTTGGTGGCATCCTCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, M.; Weng, X.; Li, Q.; Sheng, L.; Guo, Y.; Xiong, L.; Zhang, F.; Wu, S. RNA Interference-Mediated Knockdown of Tryptophan 2,3-Dioxygenase and Kynurenine-3-Monooxygenase in Monochamus Alternatus: Implications for Insect Control. Forests 2023, 14, 1280. https://doi.org/10.3390/f14071280
Zhang M, Weng X, Li Q, Sheng L, Guo Y, Xiong L, Zhang F, Wu S. RNA Interference-Mediated Knockdown of Tryptophan 2,3-Dioxygenase and Kynurenine-3-Monooxygenase in Monochamus Alternatus: Implications for Insect Control. Forests. 2023; 14(7):1280. https://doi.org/10.3390/f14071280
Chicago/Turabian StyleZhang, Minghui, Xiaoqian Weng, Qing Li, Liangjing Sheng, Yajie Guo, Liya Xiong, Feiping Zhang, and Songqing Wu. 2023. "RNA Interference-Mediated Knockdown of Tryptophan 2,3-Dioxygenase and Kynurenine-3-Monooxygenase in Monochamus Alternatus: Implications for Insect Control" Forests 14, no. 7: 1280. https://doi.org/10.3390/f14071280
APA StyleZhang, M., Weng, X., Li, Q., Sheng, L., Guo, Y., Xiong, L., Zhang, F., & Wu, S. (2023). RNA Interference-Mediated Knockdown of Tryptophan 2,3-Dioxygenase and Kynurenine-3-Monooxygenase in Monochamus Alternatus: Implications for Insect Control. Forests, 14(7), 1280. https://doi.org/10.3390/f14071280
